NMR Restraints Grid |
Result table
image | mrblock_id | pdb_id | bmrb_id | cing | stage | program | type |
564192 | 2m92 | 19280 | cing | 2-parsed | STAR | comment |
data_2m92_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_2m92 _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_2m92 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_2m92 _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2m92 "Master copy" parsed_2m92 stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_2m92 _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 2m92.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_2m92 1 1 2m92.mr . . XPLOR/CNS 2 distance "hydrogen bond" simple 0 parsed_2m92 1 1 2m92.mr . . XPLOR/CNS 3 distance NOE simple 0 parsed_2m92 1 1 2m92.mr . . XPLOR/CNS 4 "dihedral angle" "Not applicable" "Not applicable" 0 parsed_2m92 1 1 2m92.mr . . XPLOR/CNS 5 planarity "Not applicable" "Not applicable" 0 parsed_2m92 1 1 2m92.mr . . XPLOR/CNS 6 distance NOE simple 0 parsed_2m92 1 1 2m92.mr . . "MR format" 7 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_2m92 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_2m92 _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER DNA 30-MAY-13 2M92 *TITLE STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] QUADRUPLEX-DUPLEX *TITLE 2 HYBRID *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: 34-MER DNA; *COMPND 3 CHAIN: A; *COMPND 4 ENGINEERED: YES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES *KEYWDS QUADRUPLEX-DUPLEX HYBRID, DUPLEX, QUADRUPLEX, DNA *EXPDTA SOLUTION NMR *NUMMDL 10 *AUTHOR K.W.LIM, A.T.PHAN *REVDAT 1 10-JUL-13 2M92 0 set echo=false end ; save_
Contact the webmaster for help, if required. Wednesday, May 22, 2024 4:43:07 AM GMT (wattos1)