NMR Restraints Grid |
Result table
image | mrblock_id | pdb_id | bmrb_id | cing | stage | program | type | subtype |
614974 | 5j05 | 30045 | cing | 2-parsed | STAR | entry | full |
data_5j05_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_5j05 _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_5j05 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_5j05 _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 5j05 "Master copy" parsed_5j05 stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_5j05 _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 5j05.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_5j05 1 1 5j05.mr . . unknown 2 "chemical shift" "Not applicable" "Not applicable" 0 parsed_5j05 1 1 5j05.mr . . STAR 3 "chemical shift" "Not applicable" "Not applicable" 0 parsed_5j05 1 1 5j05.mr . . "MR format" 4 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_5j05 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_5j05 _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER DNA 27-MAR-16 5J05 *TITLE DIY G-QUADRUPLEXES: SOLUTION STRUCTURE OF D(GGGTTTGGGTTTTGGGAGGG) IN *TITLE 2 SODIUM *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: DNA (5'- *COMPND 3 D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3'); *COMPND 4 CHAIN: A; *COMPND 5 ENGINEERED: YES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT; *SOURCE 4 ORGANISM_TAXID: 32630 *KEYWDS QUADRUPLEX (-LD+L) TOPOLOGY, STRUCTURE FROM MOLMOL, DNA *EXPDTA SOLUTION NMR *NUMMDL 10 *AUTHOR S.A.DVORKIN,A.I.KARSISIOTIS,M.WEBBA DA SILVA *REVDAT 1 05-APR-17 5J05 0 ; save_
Contact the webmaster for help, if required. Friday, May 17, 2024 8:30:25 AM GMT (wattos1)