NMR Restraints Grid |
Result table
image | mrblock_id | pdb_id | bmrb_id | cing | stage | program | type |
578628 | 2m6w | 19159 | cing | 2-parsed | STAR | comment |
data_2m6w_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_2m6w _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_2m6w 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_2m6w _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2m6w "Master copy" parsed_2m6w stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_2m6w _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 2m6w.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_2m6w 1 1 2m6w.mr . . XPLOR/CNS 2 distance NOE simple 0 parsed_2m6w 1 1 2m6w.mr . . XPLOR/CNS 3 distance NOE simple 0 parsed_2m6w 1 1 2m6w.mr . . "MR format" 4 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_2m6w 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_2m6w _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER DNA 19-APR-13 2M6W *TITLE SOLUTION NMR STRUCTURE OF THE D(GGGGTTGGGGTTTTGGGGAAGGGG) QUADRUPLEX *TITLE 2 IN SODIUM CONDITIONS *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: DNA (5'- *COMPND 3 D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP* *COMPND 4 GP*G)-3'); *COMPND 5 CHAIN: A; *COMPND 6 ENGINEERED: YES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES *KEYWDS G-QUADRUPLEX, FOLDING TOPOLOGY, DNA *EXPDTA SOLUTION NMR *NUMMDL 8 *AUTHOR A.KARSISIOTIS, M.WEBBA DA SILVA *REVDAT 1 23-JUL-14 2M6W 0 REMARK ; save_
Contact the webmaster for help, if required. Thursday, May 16, 2024 4:02:57 PM GMT (wattos1)