NMR Restraints Grid |
Result table
image | mrblock_id | pdb_id | cing | stage | program | type |
38114 | 1qwa | cing | 2-parsed | STAR | comment |
data_1qwa_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_1qwa _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_1qwa 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_1qwa _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1qwa "Master copy" parsed_1qwa stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_1qwa _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 1qwa.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 2 distance NOE simple 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 3 distance "hydrogen bond" simple 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 4 "dihedral angle" "Not applicable" "Not applicable" 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 5 planarity "Not applicable" "Not applicable" 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 6 "dihedral angle" "Not applicable" "Not applicable" 0 parsed_1qwa 1 1 1qwa.mr . . XPLOR/CNS 7 "dipolar coupling" "Not applicable" "Not applicable" 0 parsed_1qwa 1 1 1qwa.mr . . "MR format" 8 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_1qwa 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1qwa _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER RNA 01-SEP-03 1QWA *TITLE NMR STRUCTURE OF 5'-R(GGAUGCCUCCCGAGUGCAUCC): AN RNA *TITLE 2 HAIRPIN DERIVED FROM THE MOUSE 5'ETS THAT BINDS NUCLEOLIN *TITLE 3 RBD12. *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: 18S RIBOSOMAL RNA, 5'ETS; *COMPND 3 CHAIN: A; *COMPND 4 FRAGMENT: B2NRE; *COMPND 5 ENGINEERED: YES; *COMPND 6 OTHER_DETAILS: B2: A RNA HAIRPIN DERIVED FROM NTS 394-410 *COMPND 7 OF THE MOUSE 5' ETS. *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 OTHER_DETAILS: THE RNA WAS CHEMICALLY SYNTHESIZED IN VITRO *SOURCE 4 USING T7 RNA POLYMERASE AND SYNTHETIC DNA TEMPLATES. THE *SOURCE 5 SEQUENCE OF THE RNA IS NATURALLY FOUND IN MUS MUSCULUS *SOURCE 6 (MOUSE). *KEYWDS TETRALOOP, UNCG, UUCG, YNMG, BULGED NUCLEOTIDE, HAIRPIN, A- *KEYWDS 2 FORM HELIX *EXPDTA NMR, 17 STRUCTURES *AUTHOR L.D.FINGER, L.TRANTIREK, C.JOHANSSON, J.FEIGON *REVDAT 1 25-NOV-03 1QWA 0 ; save_
Contact the webmaster for help, if required. Thursday, May 16, 2024 7:50:56 AM GMT (wattos1)