*HEADER    DNA                                     19-APR-13   2M6W              
*TITLE     SOLUTION NMR STRUCTURE OF THE D(GGGGTTGGGGTTTTGGGGAAGGGG) QUADRUPLEX  
*TITLE    2 IN SODIUM CONDITIONS                                                 
*COMPND    MOL_ID: 1;                                                            
*COMPND   2 MOLECULE: DNA (5'-                                                   
*COMPND   3 D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*
*COMPND   4 GP*G)-3');                                                           
*COMPND   5 CHAIN: A;                                                            
*COMPND   6 ENGINEERED: YES                                                      
*SOURCE    MOL_ID: 1;                                                            
*SOURCE   2 SYNTHETIC: YES                                                       
*KEYWDS    G-QUADRUPLEX, FOLDING TOPOLOGY, DNA                                   
*EXPDTA    SOLUTION NMR                                                          
*NUMMDL    8                                                                     
*AUTHOR    A.KARSISIOTIS, M.WEBBA DA SILVA                                       
*REVDAT   1   23-JUL-14 2M6W    0                                                



REMARK 

assign (residue 2 and name H1 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     5.00  1.80  1.80
assign (residue 23 and name H22 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     5.00  1.80  1.80
assign (residue 3 and name H1 and segi DNA1) 
 (residue 5 and name H6 and segi DNA1)      5.00  1.80  1.80
assign (residue 1 and name H1 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     5.00  1.80  1.80        
assign (residue 1 and name H1 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)    5.00  1.80  1.80  
assign (residue 1 and name H1 and segi DNA1) 
 (residue 1 and name H21 and segi DNA1)     3.00  0.80  0.80  
assign (residue 1 and name H1 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     3.00  0.80  0.80  
assign (residue 1 and name H1 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    3.00  0.80  0.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H3' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H4' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H5' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 13 and name H6 and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 15 and name H8 and segi DNA1)     4.00  1.20  1.20 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 16 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 1 and name H3' and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    3.00  0.80  0.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 1 and name H21 and segi DNA1) 
 (residue 15 and name H8 and segi DNA1)     3.00  0.80  0.80 
assign (residue 1 and name H22 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 1 and name H8 and segi DNA1) 
 (residue 10 and name H1 and segi DNA1)     5.00   1.80  1.80 
assign (residue 1 and name H8 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00   1.80  1.80  
assign (residue 23 and name H1 and segi DNA1) 
 (residue 23 and name H21 and segi DNA1)    3.00  0.80  0.80  
assign (residue 23 and name H1 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)    3.00  0.80  0.80  
assign (residue 23 and name H1 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 15 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 15 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 16 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 24 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H21 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 23 and name H21 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H21 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 23 and name H21 and segi DNA1) 
 (residue 16 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H21 and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H21 and segi DNA1)
 (residue 16 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H22 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 3 and name H21 and segi DNA1)     4.00  1.20  1.20 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)     4.00  1.20  1.20 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)    4.00  1.20  1.20 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 2 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)    5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 3 and name H21 and segi DNA1)     3.00  0.80  0.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)     3.00  0.80  0.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 3 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 4 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 17 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 17 and name H8 and segi DNA1)     5.00 1.80  1.80 
assign (residue 3 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 2 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     4.00  1.20  1.20 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)    4.00  1.20  1.20 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 17 and name H1' and segi DNA1)    5.00  1.80  1.80  
assign (residue 3 and name H22 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H22 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H22 and segi DNA1) 
 (residue 18 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 3 and name H8 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 3 and name H8 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 21 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 21 and name H22 and segi DNA1)    4.00  1.20  1.20 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 5 and name H6 and segi DNA1)      4.00  1.20  1.20 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    5.00  1.80  1.80  
assign (residue 21 and name H21 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)     3.00    0.80   0.80 
assign (residue 4 and name H8 and segi DNA1) 
 (residue 18 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 5 and name H6 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 5 and name H6 and segi DNA1) 
 (residue 18 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 8 and name H1 and segi DNA1) 
 (residue 3 and name H8 and segi DNA1)      4.00  1.20  1.20    
assign (residue 8 and name H1 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 8 and name H1 and segi DNA1) 
 (residue 4 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 8 and name H1 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 8 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 9 and name H21 and segi DNA1)     5.00  1.80  1.80 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 9 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 22 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 22 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     4.00  1.20  1.20 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 1 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 3 and name H21 and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)    3.00  0.80  0.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 15 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 16 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 16 and name H21 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 16 and name H22 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 9 and name H8 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 9 and name H8 and segi DNA1) 
 (residue 10 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 9 and name H8 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 1 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 1 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 9 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 10 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 10 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    4.00  1.20  1.20 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 11 and name H6 and segi DNA1)     5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     3.00  0.80  0.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 13 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 10 and name H1 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 10 and name H21 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)    5.00  1.80  1.80 
assign (residue 10 and name H21 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)    5.00  1.80  1.80 
assign (residue 10 and name H8 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 11 and name H6 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80 
assign (residue 12 and name H6 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 1 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 10 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 10 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 10 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    3.00  0.80  0.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)    4.00  1.20  1.20 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H2'' and segi DNA1)   3.00  0.80  0.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H3' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 11 and name H6 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 12 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 12 and name H5' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 12 and name H6 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 13 and name H3' and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 13 and name H5# and segi DNA1)    4.00  1.20  1.20 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 13 and name H6 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 14 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H3 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     5.00  1.80  1.80  
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H21 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 14 and name H1' and segi DNA1)    5.00  1.80  1.80  
assign (residue 15 and name H1 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 15 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 15 and name H22 and segi DNA1)    3.00  0.80  0.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 16 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 24 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 24 and name H8 and segi DNA1)     4.00  1.20  1.20 
assign (residue 15 and name H21 and segi DNA1) 
 (residue 24 and name H8 and segi DNA1)    4.00  1.20  1.20 
assign (residue 15 and name H8 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 15 and name H8 and segi DNA1) 
 (residue 1 and name H21 and segi DNA1)     4.00  1.20  1.20 
assign (residue 15 and name H8 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 15 and name H8 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)    5.00  1.80  1.80 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 8 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 9 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 9 and name H22 and segi DNA1)    3.00  0.80  0.80 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)     5.00  1.80  1.80  
assign (residue 9 and name H1 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)     4.00  1.20  1.20 
assign (residue 9 and name H1 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 9 and name H21 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)    5.00  1.80  1.80  
assign (residue 9 and name H21 and segi DNA1) 
 (residue 9 and name H1 and segi DNA1)    3.00  0.80  0.80 
assign (residue 9 and name H21 and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)   5.00  1.80  1.80 
assign (residue 9 and name H21 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)    5.00  1.80  1.80 
assign (residue 9 and name H21 and segi DNA1) 
 (residue 24 and name H1' and segi DNA1)   5.00  1.80  1.80  
assign (residue 9 and name H22 and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)   5.00  1.80  1.80  
assign (residue 9 and name H22 and segi DNA1) 
 (residue 8 and name H8 and segi DNA1)     5.00  1.80  1.80  
assign (residue 9 and name H22 and segi DNA1) 
 (residue 9 and name H1 and segi DNA1)    5.00  1.80  1.80 
assign (residue 9 and name H22 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)    5.00  1.80  1.80  
assign (residue 16 and name H8 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)      5.00   1.80  1.80 
assign (residue 16 and name H8 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00   1.80  1.80 
assign (residue 16 and name H8 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 16 and name H8 and segi DNA1) 
 (residue 17 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00   1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      4.00  1.20  1.20 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)      3.00 0.80  0.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 21 and name H22 and segi DNA1)     5.00 1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 16 and name H1 and segi DNA1)      4.00   1.20  1.20 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)     5.00   1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 16 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 17 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 17 and name H22 and segi DNA1)    3.00  0.80  0.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 20 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 21 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 17 and name H1 and segi DNA1) 
 (residue 22 and name H8 and segi DNA1)     4.00  1.20  1.20 
assign (residue 17 and name H21 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)     5.00  1.80  1.80  
assign (residue 17 and name H21 and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)   4.00  1.20  1.20 
assign (residue 17 and name H21 and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)  4.00  1.20  1.20 
assign (residue 17 and name H21 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)    3.00  0.80  0.80  
assign (residue 17 and name H21 and segi DNA1) 
 (residue 17 and name H5' and segi DNA1)   5.00  1.80  1.80 
assign (residue 17 and name H21 and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)   5.00  1.80  1.80 
assign (residue 17 and name H21 and segi DNA1) 
 (residue 22 and name H8 and segi DNA1)    4.00  1.20  1.20 
assign (residue 17 and name H22 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)    5.00  1.80  1.80 
assign (residue 17 and name H8 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 17 and name H8 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 8 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 7 and name H1 and segi DNA1)     3.00  0.80  0.80  
assign (residue 22 and name H1 and segi DNA1) 
 (residue 4 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 21 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 22 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 22 and name H22 and segi DNA1)    3.00  0.80  0.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H1 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H21 and segi DNA1) 
 (residue 8 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H21 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)    3.00  0.80  0.80 
assign (residue 22 and name H21 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)    5.00  1.80  1.80 
assign (residue 22 and name H22 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)    5.00  1.80  1.80 
assign (residue 22 and name H8 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00 1.80  1.80 
assign (residue 22 and name H8 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 22 and name H8 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 22 and name H8 and segi DNA1) 
 (residue 17 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 1 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 2 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)      5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      3.00  0.80  0.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 16 and name H22 and segi DNA1)     5.00   1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 9 and name H8 and segi DNA1)      4.00  1.20  1.20 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 10 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 10 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 9 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 2 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 23 and name H8 and segi DNA1) 
 (residue 9 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H8 and segi DNA1) 
 (residue 9 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H8 and segi DNA1) 
 (residue 24 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)    5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 10 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 10 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 10 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 11 and name H5# and segi DNA1)    5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 9 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 9 and name H21 and segi DNA1)    4.00  1.20  1.20 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 9 and name H22 and segi DNA1)    4.00  1.20  1.20  
assign (residue 24 and name H1 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 24 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 24 and name H1 and segi DNA1) 
 (residue 24 and name H8 and segi DNA1)     5.00  1.80  1.80 
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00 1.80  1.80 
assign (residue 24 and name H8 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 24 and name H8 and segi DNA1) 
 (residue 15 and name H21 and segi DNA1)    4.00  1.20  1.20 
assign (residue 24 and name H8 and segi DNA1) 
 (residue 15 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 3 and name H21 and segi DNA1) 
 (residue 17 and name H8 and segi DNA1)     3.00  0.80  0.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 22 and name H8 and segi DNA1)     5.00  1.80  1.80    
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)      3.00   0.80  0.80 
!assign (residue 4 and name H1 and segi DNA1) 
! (residue 5 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 5 and name H6 and segi DNA1)      5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 6 and name H2' and segi DNA1)     5.00  1.80  1.80  
assign (residue 4 and name H1 and segi DNA1) 
 (residue 6 and name H6 and segi DNA1)      5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 18 and name H1 and segi DNA1)      4.00  1.20  1.20  
assign (residue 4 and name H1 and segi DNA1) 
 (residue 4 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 4 and name H22 and segi DNA1)    4.00  1.20  1.20 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 2 and name H8 and segi DNA1)       5.00 1.80  1.80 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 3 and name H1 and segi DNA1)       3.00 0.80  0.80  
assign (residue 18 and name H1 and segi DNA1) 
 (residue 3 and name H21 and segi DNA1)      3.00 0.80  0.80 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 3 and name H22 and segi DNA1)      3.00 0.80  0.80  
assign (residue 18 and name H1 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)       5.00 1.80  1.80 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 4 and name H8 and segi DNA1)       4.00 1.20  1.20 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 5 and name H6 and segi DNA1)       4.00 1.20  1.20 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 6 and name H5# and segi DNA1)      5.00 1.80  1.80 
assign (residue 18 and name H1 and segi DNA1) 
 (residue 6 and name H6 and segi DNA1)       5.00 1.80  1.80       
assign (residue 18 and name H1 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)     5.00 1.80  1.80    
assign (residue 18 and name H1 and segi DNA1) 
 (residue 17 and name H22 and segi DNA1)     5.00  1.80  1.80  
assign (residue 18 and name H1 and segi DNA1) 
 (residue 18 and name H1' and segi DNA1)     5.00 1.80  1.80   
assign (residue 9 and name H21 and segi DNA1) 
 (residue 15 and name H1 and segi DNA1)    5.00  1.80  1.80
assign (residue 4 and name H1 and segi DNA1) 
 (residue 7 and name H1 and segi DNA1)     5.00  1.80  1.80   
assign (residue 21 and name H8 and segi DNA1) 
 (residue 7 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 21 and name H8 and segi DNA1)     4.00  1.20  1.20 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 4 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 21 and name H1 and segi DNA1)      4.00  1.20  1.20 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 5 and name H6 and segi DNA1)      5.00  1.80  1.80  
assign (residue 7 and name H1 and segi DNA1) 
 (residue 8 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 7 and name H8 and segi DNA1) 
 (residue 8 and name H1 and segi DNA1)      5.00  1.80  1.80
assign (residue 8 and name H1 and segi DNA1) 
 (residue 7 and name H8 and segi DNA1)       5.00   1.80  1.80
assign (residue 7 and name H1 and segi DNA1) 
 (residue 22 and name H1 and segi DNA1)     3.00  0.80  0.80 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 22 and name H21 and segi DNA1)    5.00  1.80  1.80  
assign (residue 7 and name H1 and segi DNA1) 
 (residue 22 and name H8 and segi DNA1)     5.00  1.80  1.80  
assign (residue 7 and name H1 and segi DNA1) 
 (residue 7 and name H21 and segi DNA1)    3.00  0.80  0.80 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 7 and name H22 and segi DNA1)    3.00  0.80  0.80
assign (residue 7 and name H1 and segi DNA1) 
 (residue 7 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)    5.00  1.80  1.80  
assign (residue 4 and name H1 and segi DNA1) 
 (residue 4 and name H8 and segi DNA1)      5.00  1.80  1.80
assign (residue 4 and name H1 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    5.00  1.80  1.80 
assign (residue 2 and name H1 and segi DNA1) 
 (residue 13 and name H3 and segi DNA1)     5.00  1.80  1.80  
assign (residue 13 and name H3 and segi DNA1) 
 (residue 2 and name H1 and segi DNA1)     5.00  1.80  1.80
assign (residue 3 and name H21 and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)    4.00  1.20  1.20 
assign (residue 3 and name H22 and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     3.00  1.20  1.20 
assign (residue 3 and name H22 and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)    4.00  1.20  1.20 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H21 and segi DNA1)     5.00   1.80  1.80 
assign (residue 15 and name H1 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)     5.00   1.80  1.80
assign (residue 17 and name H21 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)  5.00  1.80  1.80
assign (residue 24 and name H1 and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     5.00  1.80  1.80 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 23 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 1 and name H1 and segi DNA1) 
 (residue 23 and name H22 and segi DNA1)    5.00  1.80  1.80 
assign (residue 23 and name H1 and segi DNA1) 
 (residue 1 and name H1 and segi DNA1)      4.00  1.20  1.20
assign (residue 7 and name H1 and segi DNA1) 
 (residue 17 and name H1 and segi DNA1)     4.00  1.20  1.20 
assign (residue 7 and name H1 and segi DNA1) 
 (residue 17 and name H21 and segi DNA1)    5.00  1.80  1.80 
assign (residue 5 and name H6 and segi DNA1) 
 (residue 7 and name H1 and segi DNA1)      5.00  1.80  1.80
assign (residue 17 and name H1 and segi DNA1) 
 (residue 7 and name H1 and segi DNA1)     5.00  1.80  1.80 
assign (residue 23 and name H22 and segi DNA1) 
 (residue 1 and name H21 and segi DNA1)     5.00  1.80  1.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 21 and name H8 and segi DNA1)      5.00 1.80  1.80   
assign (residue 2 and name H1 and segi DNA1) 
 (residue 4 and name H1 and segi DNA1)     5.00  1.80  1.80   
assign (residue 18 and name H1 and segi DNA1) 
 (residue 16 and name H21 and segi DNA1)      5.00 1.80  1.80    
assign (residue 18 and name H1 and segi DNA1) 
 (residue 4 and name H1' and segi DNA1)      5.00 1.80  1.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 20 and name H8 and segi DNA1)      5.00 1.80  1.80 
assign (residue 21 and name H1 and segi DNA1) 
 (residue 20 and name H5' and segi DNA1)    5.00  1.80  1.80  
assign (residue 4 and name H1 and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)    5.00  1.80  1.80
assign (residue 4 and name H1 and segi DNA1) 
 (residue 3 and name H8 and segi DNA1)      5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 4 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)     5.00  1.80  1.80 
assign (residue 4 and name H1 and segi DNA1) 
 (residue 7 and name H8 and segi DNA1)      4.00  1.80  1.80 
assign (residue 7 and name H8 and segi DNA1) 
 (residue 4 and name H1 and segi DNA1)     5.00  1.80  1.80  
assign (residue 21 and name H1 and segi DNA1) 
 (residue 17 and name H22 and segi DNA1)     4.00 1.20  1.20  
assign (residue 21 and name H1 and segi DNA1) 
 (residue 20 and name H1' and segi DNA1)     8.00  1.80  1.80 

!set echo=false end

remarks structural restraints

assign (residue 20 and name H8 and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)    2.9    0.65    0.65
assign (residue 5 and name H6 and segi DNA1) 
 (residue 20 and name H3' and segi DNA1)     5.05      1.60     1.60 
assign (residue 20 and name H8 and segi DNA1) 
 (residue 18 and name H4' and segi DNA1)    5.1     1.80    1.80  
assign (residue 19 and name H8 and segi DNA1) 
 (residue 20 and name H8 and segi DNA1)     3.6     1.35    1.35 
assign (residue 20 and name H8 and segi DNA1) 
 (residue 19 and name H2'' and segi DNA1)    2.8   0.69    0.69    
assign (residue 20 and name H8 and segi DNA1) 
 (residue 19 and name H3' and segi DNA1)    4.0  1.65    1.65     
assign (residue 20 and name H8 and segi DNA1) 
 (residue 19 and name H4' and segi DNA1)    4.5    0.90    0.90   
assign (residue 20 and name H8 and segi DNA1) 
 (residue 20 and name H2' and segi DNA1)    3.4    0.96    0.96   
assign (residue 18 and name H8 and segi DNA1) 
 (residue 20 and name H1' and segi DNA1)    4.1    1.42    1.42  
assign (residue 20 and name H8 and segi DNA1) 
 (residue 18 and name H1' and segi DNA1)    3.6   1.2    1.2      
assign (residue 20 and name H8 and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)    4.6     1.7   1.7        
assign (residue 20 and name H8 and segi DNA1) 
 (residue 18 and name H8 and segi DNA1)     4.0    1.65    1.65 
assign (residue 12 and name H6 and segi DNA1) 
 (residue 11 and name H3' and segi DNA1)    4.6     0.92    0.92  
assign (residue 12 and name H6 and segi DNA1) 
 (residue 11 and name H6 and segi DNA1)     3.8   0.67    0.67
assign (residue 11 and name H6 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    4.7    1.3      1.3    !%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    4.7    1.3      1.3    !%
assign (residue 1 and name H8 and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)     5.2    2.0      2.0
assign (residue 11 and name H6 and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)    5.1    2.0      2.0    !% 
assign (residue 11 and name H3' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   3.7    1.2      1.2    !%%
assign (residue 11 and name H3' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   3.7    1.2      1.2    !%%
assign (residue 12 and name H6 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    3.5     1.95    1.95  
assign (residue 12 and name H6 and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)    3.7     1.48    1.48  
assign (residue 11 and name H4' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   4.9    1.7      1.7
assign (residue 11 and name H4' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   4.9    1.7      1.7
assign (residue  1 and name H1' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    3.39    1.27    1.27
assign (residue  1 and name H2'' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   5.11    1.40    1.40  
assign (residue  1 and name H4' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    4.20    0.83    0.83
assign (residue  1 and name H8 and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)     3.41    0.66    0.66
assign (residue  2 and name H8 and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)     5.97    1.20    1.20  !0.0
assign (residue  4 and name H3' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)     4.50    1.48    0.78
assign (residue  4 and name H3' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     4.46    1.22    1.22
assign (residue  4 and name H4' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     4.71    0.80    0.80  !0.0
assign (residue  4 and name H8 and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)      3.88    1.29    1.29
assign (residue  4 and name H8 and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)      6.07    1.20    1.20  
assign (residue  5 and name H1' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)     4.59    1.53    1.53    
assign (residue  5 and name H4' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     3.73    1.56    1.56   
assign (residue  5 and name H6 and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)      3.04    0.62    0.62
assign (residue  5 and name H6 and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)      4.29    1.49    1.49
assign (residue  6 and name H2'' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)    5.10    1.29    1.29
assign (residue  6 and name H6 and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)      3.41    1.27    1.27
assign (residue  10 and name H1' and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)   4.37    1.40    1.40
assign (residue  10 and name H2'' and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)  5.39    1.40    1.40
assign (residue  10 and name H2'' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)  4.85    1.60    1.60  
assign (residue  10 and name H8 and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)    5.95    1.23    1.23  
assign (residue  11 and name H1' and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)   4.91    1.16    1.16
assign (residue  11 and name H1' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   4.46    0.82    0.82 
assign (residue  11 and name H2'' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)  4.58    0.91    0.91
assign (residue  11 and name H3' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   3.69    1.21    1.21
assign (residue  11 and name H4' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   4.35    1.41    1.41   
assign (residue  11 and name H6 and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)    4.44    1.60    1.60  
assign (residue  11 and name H6 and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)    5.35    1.90    1.90 
assign (residue  12 and name H1' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   4.67    1.30    1.30 
assign (residue  12 and name H1' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   3.19    0.94    0.94
assign (residue  12 and name H2' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   3.55    1.29    1.29
assign (residue  12 and name H2'' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)  5.46    1.58    1.58 
assign (residue  12 and name H3' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   4.56    1.23    1.23 
assign (residue  12 and name H6 and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)    3.01    0.72    0.72
assign (residue  13 and name H1' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   5.23    0.69    0.69 
assign (residue  13 and name H1' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   5.12    0.81    0.81
assign (residue  13 and name H2'' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)  3.75    0.69    0.69
assign (residue  13 and name H3' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   4.08    1.37    1.37
assign (residue  13 and name H4' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   4.76    1.36    1.36
assign (residue  13 and name H5' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   4.38    1.33    1.33
assign (residue  13 and name H6 and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    3.00    0.54    0.54      
assign (residue  14 and name H1' and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)   5.35    0.90    0.90       
assign (residue  14 and name H6 and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)    3.09    0.82    0.82    
assign (residue  12 and name H1' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   4.82    1.40    1.40 
assign (residue  12 and name H3' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   4.36    1.50    1.50
assign (residue  12 and name H6 and segi DNA1) 
 (residue  14 and name H5# and segi DNA1)    4.35    1.56    1.56  
assign (residue  12 and name H6 and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)    5.07    1.45    1.45
assign (residue  12 and name H6 and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    5.56    1.20    1.20
assign (residue  12 and name H3' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   4.44    1.59    1.59 
assign (residue  12 and name H2' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   3.90    1.59    1.59
assign (residue  10 and name H8 and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)    4.32    1.56    1.56
assign (residue  5 and name H2' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)     4.99    1.46    1.46    
assign (residue  11 and name H2'' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)  3.74    1.22    1.22 
assign (residue  13 and name H3' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)   4.99    1.57    1.57
assign (residue  11 and name H5# and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   4.01    1.51    1.51
assign (residue  10 and name H3' and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)   4.62    0.87    0.87
assign (residue  11 and name H1' and segi DNA1) 
 (residue  12 and name H5# and segi DNA1)   4.57    1.40    1.40 
assign (residue  6 and name H3' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     3.56    1.45    1.45
assign (residue  10 and name H2' and segi DNA1) 
 (residue  11 and name H5# and segi DNA1)   3.28    0.90    0.90
assign (residue  5 and name H1' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     3.62    0.63    0.63
assign (residue  1 and name H3' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    5.19    1.41    1.41
assign (residue  1 and name H2' and segi DNA1) 
 (residue  13 and name H5# and segi DNA1)    3.69    1.53    1.53
assign (residue  3 and name H1' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)     5.18    1.24    1.24
assign (residue  3 and name H2'' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)    3.36    1.27    1.27
assign (residue  5 and name H2' and segi DNA1) 
 (residue  6 and name H5# and segi DNA1)     4.63    1.51    1.51
assign (residue  5 and name H3' and segi DNA1) 
 (residue  5 and name H5# and segi DNA1)     4.90    1.21    1.21   
assign (residue 23 and name H1' and segi DNA1) 
 (residue 24 and name H4' and segi DNA1)   2.8    1.64    1.64 
assign (residue 14 and name H6 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    4.5    1.46    1.46 
assign (residue 16 and name H8 and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)    4.3    0.67    0.67   
assign (residue 22 and name H8 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)    4.0    0.69    0.69    
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H1' and segi DNA1)     5.0    1.44    1.44 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     5.32    1.80    1.80  
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)    5.0     1.63    1.63
assign (residue 13 and name H6 and segi DNA1) 
 (residue 1 and name H3' and segi DNA1)     4.7    1.68    1.68
assign (residue 24 and name H8 and segi DNA1) 
 (residue 14 and name H3' and segi DNA1)    5.8    1.20    1.20 
assign (residue 4 and name H1' and segi DNA1) 
 (residue 4 and name H2'' and segi DNA1)    3.2    0.68    0.68      
assign (residue 4 and name H3' and segi DNA1) 
 (residue 4 and name H2'' and segi DNA1)     3.2    0.68    0.68   
assign (residue 4 and name H1' and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)    3.2    0.68    0.68      
assign (residue 4 and name H3' and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)     3.2    0.68    0.68  
assign (residue 4 and name H8 and segi DNA1) 
 (residue 4 and name H2'' and segi DNA1)     3.2  1.68    1.68 
assign (residue 5 and name H6 and segi DNA1) 
 (residue 4 and name H2'' and segi DNA1)      4.7  1.9      1.9 
assign (residue 4 and name H8 and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)     3.2 0.98    0.98 
assign (residue 4 and name H4' and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)     4.7  1.5      1.5  
assign (residue 5 and name H6 and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)      4.7   1.5      1.5   
assign (residue 6 and name H6 and segi DNA1) 
 (residue 4 and name H2' and segi DNA1)      3.6    1.2      1.2 
assign (residue 1 and name H3' and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)     2.9    0.9      0.9 
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)     3.0    1.0      1.0       
assign (residue 1 and name H2'' and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     2.9    1.7      1.7 
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     2.9    0.9      0.9 
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H4' and segi DNA1)     3.0    1.0      1.0 
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H3' and segi DNA1)     4.4    1.5      1.5   
assign (residue 1 and name H1' and segi DNA1) 
 (residue 2 and name H3' and segi DNA1)     4.1    1.3      1.3 
assign (residue 1 and name H3' and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     3.0    1.0      1.0    
assign (residue 1 and name H3' and segi DNA1) 
 (residue 1 and name H4' and segi DNA1)     3.1    1.0      1.0  
assign (residue 1 and name H4' and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     2.58      1.8      1.8
assign (residue 1 and name H4' and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)     4.1    1.3      1.3  
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H1' and segi DNA1)      2.8    0.9      0.9    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)      4.0    1.3      1.3    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)      4.7   1.6      1.6    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H3' and segi DNA1)      5.6    1.8      1.8    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H4' and segi DNA1)      4.9    1.7      1.7    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)      5.2    1.7      1.7      
assign (residue 1 and name H8 and segi DNA1) 
 (residue 2 and name H3' and segi DNA1)      5.3    1.8      1.8     
assign (residue 1 and name H8 and segi DNA1) 
 (residue 2 and name H4' and segi DNA1)      4.2    1.3      1.3    
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     2.7    0.9      0.9        
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H4' and segi DNA1)     3.2    1.0      1.0    
assign (residue 2 and name H1' and segi DNA1) 
 (residue 3 and name H3' and segi DNA1)     4.9    1.7      1.7     
assign (residue 2 and name H2'' and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     2.42    0.68    0.68
assign (residue 2 and name H2'' and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     2.6    0.8      0.8    
assign (residue 2 and name H3' and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)     2.55    0.67    0.67
assign (residue 2 and name H3' and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)     2.6    0.8      0.8    
assign (residue 2 and name H3' and segi DNA1) 
 (residue 2 and name H4' and segi DNA1)     3.0    1.0      1.0    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 1 and name H1' and segi DNA1)      4.6    1.5      1.5    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)      2.8    0.9      0.9      
assign (residue 2 and name H8 and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)      3.3   1.2      1.2    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 1 and name H3' and segi DNA1)      3.9    1.3      1.3       
assign (residue 2 and name H8 and segi DNA1) 
 (residue 1 and name H8 and segi DNA1)       3.0    1.9      1.9    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H1' and segi DNA1)      4.2    1.3      1.3    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H2' and segi DNA1)      4.2    1.7      1.7         
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H3' and segi DNA1)      3.9    1.83      1.83    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H4' and segi DNA1)      5.0    1.7      1.7    
assign (residue 2 and name H8 and segi DNA1) 
 (residue 17 and name H8 and segi DNA1)      4.8    1.6      1.6 
assign (residue 3 and name H1' and segi DNA1) 
 (residue 3 and name H2'' and segi DNA1)     2.7    0.9      0.9    
assign (residue 3 and name H1' and segi DNA1) 
 (residue 3 and name H3' and segi DNA1)     3.8    1.3      1.3    
assign (residue 3 and name H1' and segi DNA1) 
 (residue 3 and name H4' and segi DNA1)     2.9    0.9      0.9    
assign (residue 3 and name H1' and segi DNA1) 
 (residue 4 and name H4' and segi DNA1)     4.5    1.5      1.5          
assign (residue 3 and name H3' and segi DNA1) 
 (residue 3 and name H2'' and segi DNA1)     2.6    0.8      0.8    
assign (residue 3 and name H4' and segi DNA1) 
 (residue 3 and name H2'' and segi DNA1)     3.2    1.0      1.0    
assign (residue 3 and name H8 and segi DNA1) 
 (residue 2 and name H1' and segi DNA1)      4.6    1.9      1.9    
assign (residue 3 and name H8 and segi DNA1) 
 (residue 3 and name H1' and segi DNA1)      2.6    0.8      0.8      
assign (residue 3 and name H8 and segi DNA1) 
 (residue 3 and name H2'' and segi DNA1)      3.6   1.2      1.2    
assign (residue 3 and name H8 and segi DNA1) 
 (residue 3 and name H3' and segi DNA1)      4.8    1.6      1.6    
assign (residue 3 and name H8 and segi DNA1) 
 (residue 3 and name H4' and segi DNA1)      4.1    1.3      1.3    
assign (residue 3 and name H8 and segi DNA1) 
 (residue 4 and name H1' and segi DNA1)      4.3    1.7      1.7    
assign (residue 5 and name H6 and segi DNA1) 
 (residue 4 and name H3' and segi DNA1)      4.1    1.3      1.3    !%
assign (residue 5 and name H6 and segi DNA1) 
 (residue 5 and name H1' and segi DNA1)      3.5    1.2      1.2    !%
assign (residue 5 and name H6 and segi DNA1) 
 (residue 5 and name H2' and segi DNA1)      3.7    1.2      1.2    !%
assign (residue 5 and name H6 and segi DNA1) 
 (residue 6 and name H6 and segi DNA1)       4.1    1.9      1.9    !%
assign (residue 4 and name H1' and segi DNA1) 
 (residue 4 and name H4' and segi DNA1)     3.4    1.2      1.2   
assign (residue 4 and name H1' and segi DNA1) 
 (residue 4 and name H3' and segi DNA1)     4.1    1.3      1.3        
assign (residue 4 and name H3' and segi DNA1) 
 (residue 4 and name H4' and segi DNA1)     3.1    1.0      1.0     
assign (residue 4 and name H8 and segi DNA1) 
 (residue 3 and name H1' and segi DNA1)      4.9    1.7      1.7    !%
assign (residue 4 and name H8 and segi DNA1) 
 (residue 3 and name H2'' and segi DNA1)      3.1   1.0      1.0   !% 
assign (residue 4 and name H8 and segi DNA1) 
 (residue 3 and name H4' and segi DNA1)      4.4    1.5      1.5    !%
assign (residue 4 and name H8 and segi DNA1) 
 (residue 3 and name H8 and segi DNA1)       4.9    1.7      1.7    !%
assign (residue 4 and name H8 and segi DNA1) 
 (residue 4 and name H1' and segi DNA1)      4.1    1.3      1.3    !%%
assign (residue 4 and name H8 and segi DNA1) 
 (residue 4 and name H3' and segi DNA1)      4.0    1.3      1.3    !%%
assign (residue 4 and name H8 and segi DNA1) 
 (residue 4 and name H4' and segi DNA1)      5.0    1.7      1.7    !%
assign (residue 5 and name H1' and segi DNA1) 
 (residue 5 and name H2' and segi DNA1)     3.1    1.0      1.0    !%
assign (residue 5 and name H1' and segi DNA1) 
 (residue 5 and name H4' and segi DNA1)     3.3    1.2      1.2    !%%
assign (residue 5 and name H3' and segi DNA1) 
 (residue 5 and name H2' and segi DNA1)     2.9    0.9      0.9    !%
assign (residue 5 and name H3' and segi DNA1) 
 (residue 5 and name H4' and segi DNA1)     3.1    1.0      1.0    !%%
assign (residue 6 and name H1' and segi DNA1) 
 (residue 6 and name H2' and segi DNA1)     2.9    0.9      0.9   !% 
assign (residue 6 and name H1' and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)     3.5    1.2      1.2    !%
assign (residue 6 and name H1' and segi DNA1) 
 (residue 6 and name H3' and segi DNA1)     3.4    1.2      1.2    !%
assign (residue 6 and name H3' and segi DNA1) 
 (residue 6 and name H2' and segi DNA1)     2.9    1.9      1.9   !% 
assign (residue 6 and name H3' and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)     2.8    0.9      0.9    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 4 and name H1' and segi DNA1)      5.5    1.8      1.8    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 5 and name H3' and segi DNA1)      4.4    1.5      1.5    !%%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H1' and segi DNA1)      4.2    1.3      1.3    !%%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H2' and segi DNA1)      3.2    1.0      1.0    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)      3.1   1.0      1.0    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H3' and segi DNA1)      3.9    1.64      1.64    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H4' and segi DNA1)      4.5    1.5      1.5    !%%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H2' and segi DNA1)     3.3    1.2      1.2    !%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H2'' and segi DNA1)     2.8    0.9      0.9    !%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H3' and segi DNA1)     4.2    1.3      1.3    !%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H4' and segi DNA1)     3.3    1.2      1.2    !%%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)     4.5    1.5      1.5       
assign (residue 7 and name H1' and segi DNA1) 
 (residue 8 and name H3' and segi DNA1)     3.8    1.3      1.3    !%%
assign (residue 7 and name H1' and segi DNA1) 
 (residue 8 and name H4' and segi DNA1)     2.8    0.9      0.9    !%
assign (residue 7 and name H3' and segi DNA1) 
 (residue 7 and name H2' and segi DNA1)     2.9    0.9      0.9    !%  
assign (residue 7 and name H3' and segi DNA1) 
 (residue 7 and name H2'' and segi DNA1)     3.1    1.0      1.0    !%
assign (residue 7 and name H3' and segi DNA1) 
 (residue 7 and name H4' and segi DNA1)     3.0    1.0      1.0    !%
assign (residue 7 and name H4' and segi DNA1) 
 (residue 7 and name H2' and segi DNA1)     2.9    0.9      0.9    !%%
assign (residue 7 and name H4' and segi DNA1) 
 (residue 7 and name H2'' and segi DNA1)     3.1    1.0      1.0    !%%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H1' and segi DNA1)      2.8    0.9      0.9    !%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H2' and segi DNA1)      4.0    1.3      1.3    !%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H2'' and segi DNA1)      4.0   1.3      1.3    !%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H3' and segi DNA1)      5.2    1.7      1.7   !% 
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H4' and segi DNA1)      5.2    1.7      1.7    !% 
assign (residue 7 and name H8 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)      4.0    1.3      1.3    !%%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)      5.1   1.7      1.7    !%  
assign (residue 7 and name H8 and segi DNA1) 
 (residue 8 and name H3' and segi DNA1)      5.3    1.8      1.8    !% 
assign (residue 7 and name H8 and segi DNA1) 
 (residue 8 and name H4' and segi DNA1)      4.3    1.4      1.4    !%
assign (residue 8 and name H1' and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     3.3    1.2      1.2    !%
assign (residue 8 and name H1' and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)     2.6    0.8      0.8    !%%
assign (residue 8 and name H1' and segi DNA1) 
 (residue 8 and name H3' and segi DNA1)     4.0    1.3      1.3    !%
assign (residue 8 and name H1' and segi DNA1) 
 (residue 8 and name H4' and segi DNA1)     2.8    0.9      0.9    !%
assign (residue 8 and name H3' and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     2.7    0.9      0.9    !%
assign (residue 8 and name H3' and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)     2.7    0.9      0.9    !%%
assign (residue 8 and name H4' and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     2.55      1.8      1.8
assign (residue 8 and name H4' and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)     2.7    1.9      1.9    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 7 and name H1' and segi DNA1)      4.5    1.5      1.5    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 7 and name H3' and segi DNA1)      4.7    1.6      1.6    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 7 and name H4' and segi DNA1)      4.9    1.7      1.7       
assign (residue 8 and name H8 and segi DNA1) 
 (residue 8 and name H1' and segi DNA1)      4.1    1.3      1.3    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)      3.3    1.2      1.2    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 8 and name H2'' and segi DNA1)      3.2   1.3      1.3    !%%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 8 and name H3' and segi DNA1)      3.5    1.2      1.2    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 8 and name H4' and segi DNA1)      4.5    1.5      1.5    !%
assign (residue 8 and name H8 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)      4.4    1.5      1.5    !%
assign (residue 9 and name H1' and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)     3.0    1.0      1.0    !%%
assign (residue 9 and name H1' and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)     2.9    0.9      0.9    !%%
assign (residue 9 and name H1' and segi DNA1) 
 (residue 9 and name H3' and segi DNA1)     3.8    1.3      1.3    !%%
assign (residue 9 and name H1' and segi DNA1) 
 (residue 9 and name H4' and segi DNA1)     2.8    0.9      0.9    !%%
assign (residue 9 and name H3' and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)     2.7    0.9      0.9    !%%
assign (residue 9 and name H3' and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)     3.0    1.0      1.0    !%%
assign (residue 9 and name H3' and segi DNA1) 
 (residue 9 and name H4' and segi DNA1)     2.9    0.9      0.9    !%%  
assign (residue 9 and name H4' and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)     3.4    1.2      1.2    !%
assign (residue 9 and name H4' and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)     3.2    1.0      1.0    !%%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)      4.3    1.4      1.4    !%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)      3.8   1.3      1.3    !%%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 9 and name H3' and segi DNA1)      4.7    1.6      1.6   !% 
assign (residue 9 and name H8 and segi DNA1) 
 (residue 9 and name H4' and segi DNA1)      4.1    1.3      1.3    !%%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 10 and name H3' and segi DNA1)     5.5    1.8      1.8         
assign (residue 10 and name H1' and segi DNA1) 
 (residue 10 and name H2' and segi DNA1)   2.8    0.9      0.9    !%%
assign (residue 10 and name H1' and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)  2.59      0.8    0.8
assign (residue 10 and name H1' and segi DNA1) 
 (residue 10 and name H3' and segi DNA1)   3.8    1.3      1.3    !%
assign (residue 10 and name H1' and segi DNA1) 
 (residue 10 and name H4' and segi DNA1)   3.1    1.0      1.0    !%%
assign (residue 10 and name H1' and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)   4.1    1.3      1.3   !% 
assign (residue 10 and name H3' and segi DNA1) 
 (residue 10 and name H2' and segi DNA1)   3.0    1.0      1.0    !% 
assign (residue 10 and name H3' and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)   2.9    0.9      0.9    !%
assign (residue 10 and name H3' and segi DNA1) 
 (residue 10 and name H4' and segi DNA1)   3.1    1.0      1.0    !%        
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H1' and segi DNA1)     4.4    1.5      1.5    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H2' and segi DNA1)     3.4    1.2      1.2    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H2'' and segi DNA1)     2.6    0.8      0.8    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H3' and segi DNA1)     4.5    1.5      1.5    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H4' and segi DNA1)     4.9    1.7      1.7    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 9 and name H8 and segi DNA1)      4.6    1.5      1.5    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 10 and name H1' and segi DNA1)    4.1    1.3      1.3    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 10 and name H2' and segi DNA1)    3.1    1.0      1.0    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)    3.6    1.2      1.2    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 10 and name H3' and segi DNA1)    3.9    1.3      1.3    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 10 and name H4' and segi DNA1)    4.5    1.5      1.5    !%%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    5.8    1.9      1.9    !% 
assign (residue 10 and name H8 and segi DNA1) 
 (residue 11 and name H3' and segi DNA1)    5.6    1.8      1.8    !%
assign (residue 10 and name H8 and segi DNA1) 
 (residue 11 and name H6 and segi DNA1)     4.6    1.2      1.2    !%%
assign (residue 11 and name H1' and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)   2.8    0.9      0.9    !%  
assign (residue 11 and name H1' and segi DNA1) 
 (residue 11 and name H2'' and segi DNA1)   3.1    1.0      1.0    !%%
assign (residue 11 and name H1' and segi DNA1) 
 (residue 11 and name H3' and segi DNA1)   3.3    1.2      1.2    !%%
assign (residue 11 and name H1' and segi DNA1) 
 (residue 11 and name H4' and segi DNA1)   3.0    1.0      1.0    !%%
assign (residue 11 and name H3' and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)   2.7    0.9      0.9    !%  
assign (residue 11 and name H3' and segi DNA1) 
 (residue 11 and name H2'' and segi DNA1)   2.8    0.9      0.9    !%
assign (residue 11 and name H3' and segi DNA1) 
 (residue 11 and name H4' and segi DNA1)   3.1    1.0      1.0   !% 
assign (residue 11 and name H4' and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)   4.3    1.4      1.4    !%  
assign (residue 11 and name H4' and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)   3.4    1.2      1.2    !%%
assign (residue 11 and name H4' and segi DNA1) 
 (residue 11 and name H2'' and segi DNA1)   3.8    1.3      1.3    !%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 10 and name H1' and segi DNA1)    3.6    1.4      1.4    !%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 10 and name H2' and segi DNA1)    4.7    1.6      1.6    !%%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 10 and name H2'' and segi DNA1)    3.7    1.3      1.3    !%%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 11 and name H1' and segi DNA1)    3.1    1.0      1.0    !%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 11 and name H2' and segi DNA1)    3.7    1.2      1.2    !%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 11 and name H2'' and segi DNA1)    4.1    1.7      1.7    
assign (residue 11 and name H6 and segi DNA1) 
 (residue 11 and name H4' and segi DNA1)    5.71      1.80    1.80  
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H2' and segi DNA1)   3.1    1.0      1.0    !%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)   2.8    0.9      0.9    !%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H3' and segi DNA1)   3.7    1.2      1.2    !%%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)   3.6    1.2      1.2    !%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.2    1.0      1.0    !%%
assign (residue 12 and name H3' and segi DNA1) 
 (residue 12 and name H2' and segi DNA1)   2.7    0.9      0.9    !%%
assign (residue 12 and name H3' and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)   3.0    1.0      1.0    !%%
assign (residue 12 and name H3' and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)   3.2    1.0      1.0    !%  
assign (residue 12 and name H3' and segi DNA1) 
 (residue 12 and name H5' and segi DNA1)   3.0    1.0      1.0    !%%
assign (residue 12 and name H3' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   4.3    1.4      1.4    !%%  
assign (residue 12 and name H4' and segi DNA1) 
 (residue 12 and name H2' and segi DNA1)   3.8    1.3      1.3    !%%
assign (residue 12 and name H4' and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)   4.0    1.3      1.3    !%%
assign (residue 12 and name H4' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.7    1.2      1.2    !%  
assign (residue 14 and name H3' and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)   2.8    0.67    0.67    
assign (residue 14 and name H3' and segi DNA1) 
 (residue 14 and name H2'' and segi DNA1)   2.8  0.64    0.64    
assign (residue 14 and name H3' and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)   3.1  0.65    0.65    
assign (residue 14 and name H4' and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   4.1    1.80    1.80     
assign (residue 14 and name H4' and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)   4.0    0.76    0.76    
assign (residue 14 and name H4' and segi DNA1) 
 (residue 14 and name H2'' and segi DNA1)   3.4    0.65    0.65           
assign (residue 14 and name H6 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    4.9   1.62    1.62    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)    3.9   0.65    0.65      
assign (residue 14 and name H6 and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)    4.2    0.92    0.92    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 13 and name H3' and segi DNA1)    3.9   0.67    0.67    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H1' and segi DNA1)    4.2    0.94    0.94    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)    2.7   1.69    1.69    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H2'' and segi DNA1)    3.5   1.30   1.30     
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H3' and segi DNA1)    3.8    1.67    1.67    
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)    4.6   0.63    0.63        
assign (residue 15 and name H1' and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)   3.3     0.61    0.61    
assign (residue 15 and name H1' and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   3.0    0.61    0.61    
assign (residue 15 and name H1' and segi DNA1) 
 (residue 15 and name H3' and segi DNA1)   3.2   0.66    0.66 
assign (residue 15 and name H3' and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)   2.9    0.66    0.66    
assign (residue 15 and name H3' and segi DNA1) 
 (residue 15 and name H4' and segi DNA1)   3.1   0.64    0.64
assign (residue 15 and name H4' and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)   2.6   1.68    1.68    
assign (residue 15 and name H4' and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   4.3  0.68    0.68    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    6.1     1.13    1.13        
assign (residue 15 and name H8 and segi DNA1) 
 (residue 13 and name H4' and segi DNA1)    4.0    1.83    1.83    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 14 and name H3' and segi DNA1)    4.7    1.3    1.3       
assign (residue 15 and name H8 and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)    6.0    1.78    1.78       
assign (residue 15 and name H8 and segi DNA1) 
 (residue 15 and name H1' and segi DNA1)    2.7    0.65    0.65    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)    4.3    0.67    0.67   
assign (residue 15 and name H8 and segi DNA1) 
 (residue 15 and name H3' and segi DNA1)    4.9    1.04    1.04    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 15 and name H4' and segi DNA1)    4.8    0.64    0.64    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)    3.9    1.17    1.17      
assign (residue 15 and name H8 and segi DNA1) 
 (residue 16 and name H3' and segi DNA1)    4.9    0.67    0.67    
assign (residue 15 and name H8 and segi DNA1) 
 (residue 16 and name H4' and segi DNA1)    4.1    1.47    1.47
assign (residue 15 and name H8 and segi DNA1) 
 (residue 16 and name H8 and segi DNA1)     4.3    0.98    0.98    
assign (residue 16 and name H1' and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)   2.6   0.67    0.67    
assign (residue 16 and name H1' and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)   3.1    1.3      1.3     
assign (residue 16 and name H1' and segi DNA1) 
 (residue 16 and name H3' and segi DNA1)   3.3    0.60    0.60    
assign (residue 16 and name H1' and segi DNA1) 
 (residue 16 and name H4' and segi DNA1)   2.7    0.68    0.68    
assign (residue 16 and name H3' and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)   2.8    0.65    0.65    
assign (residue 16 and name H3' and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)   2.57    0.67    0.67    
assign (residue 16 and name H3' and segi DNA1) 
 (residue 16 and name H4' and segi DNA1)   3.0    0.67    0.67       
assign (residue 16 and name H4' and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)   2.7    1.27    1.27
assign (residue 16 and name H8 and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)    3.2   0.68    0.68    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)    2.9     1.26    1.26    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 15 and name H3' and segi DNA1)    4.0    1.09    1.09         
assign (residue 16 and name H8 and segi DNA1) 
 (residue 15 and name H4' and segi DNA1)    4.4    1.65    1.65    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 16 and name H1' and segi DNA1)    3.2    0.65    0.65    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 16 and name H2' and segi DNA1)    3.5    1.27    1.27    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)    3.1    1.28    1.28    
assign (residue 16 and name H8 and segi DNA1) 
 (residue 16 and name H3' and segi DNA1)    4.0    0.69    0.69       
assign (residue 17 and name H1' and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)   3.2   0.69    0.69    
assign (residue 17 and name H1' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   2.8     0.60    0.60    
assign (residue 17 and name H1' and segi DNA1) 
 (residue 17 and name H3' and segi DNA1)   3.8    0.62    0.62    
assign (residue 17 and name H1' and segi DNA1) 
 (residue 17 and name H4' and segi DNA1)   3.4    0.67    0.67    
assign (residue 17 and name H3' and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)   2.9    0.65    0.65    
assign (residue 17 and name H3' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   3.0    0.65    0.65     
assign (residue 17 and name H3' and segi DNA1) 
 (residue 17 and name H4' and segi DNA1)   2.9   0.66    0.66       
assign (residue 17 and name H4' and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)   3.1    1.23    1.23    
assign (residue 17 and name H4' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   3.2     1.26    1.26   
assign (residue 17 and name H8 and segi DNA1)  
 (residue 2 and name H2'' and segi DNA1)    4.7    1.94  1.94      
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H1' and segi DNA1)    2.7    0.65    0.65     
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)    4.3    0.62    0.62    
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)    3.9    0.62    0.62    
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H3' and segi DNA1)    5.2    1.08    1.08    
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H4' and segi DNA1)    5.6    1.50    1.50      
assign (residue 17 and name H8 and segi DNA1) 
 (residue 18 and name H4' and segi DNA1)    4.8    1.32    1.32    
assign (residue 18 and name H1' and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)   2.8     0.61    0.61    
assign (residue 18 and name H1' and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)   2.7    0.64    0.64    
assign (residue 18 and name H1' and segi DNA1) 
 (residue 18 and name H3' and segi DNA1)   3.3    0.65    0.65    
assign (residue 18 and name H1' and segi DNA1) 
 (residue 18 and name H4' and segi DNA1)   3.3    0.65    0.65   
assign (residue 18 and name H3' and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)   3.0   0.65    0.65    
assign (residue 18 and name H3' and segi DNA1) 
 (residue 18 and name H4' and segi DNA1)   3.0   0.66    0.66       
assign (residue 18 and name H4' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   3.4    1.63    1.63    
assign (residue 18 and name H4' and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)   3.5    0.68    0.68    
assign (residue 18 and name H4' and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)   3.3    0.62    0.62    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H1' and segi DNA1)    4.4    0.68    0.68    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)    3.4    1.65    1.65    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)    3.0    1.63    1.63    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H3' and segi DNA1)    4.5    0.68    0.68    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H4' and segi DNA1)    4.3    1.68    1.68    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 17 and name H8 and segi DNA1)     4.9     1.48    1.48    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H1' and segi DNA1)    4.1   0.67    0.67    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)    2.6    0.62    0.62    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)    3.1    0.85    0.85     
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H3' and segi DNA1)    3.8    0.68    0.68    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H4' and segi DNA1)    5.3    1.45    1.45   
assign (residue 18 and name H8 and segi DNA1) 
 (residue 19 and name H2'' and segi DNA1)    3.7     1.45    1.45     
assign (residue 18 and name H8 and segi DNA1) 
 (residue 19 and name H3' and segi DNA1)    4.1    1.44    1.44    
assign (residue 18 and name H8 and segi DNA1) 
 (residue 19 and name H4' and segi DNA1)    4.1    1.4   1.4            
assign (residue 19 and name H1' and segi DNA1) 
 (residue 19 and name H2' and segi DNA1)   2.6    0.63    0.63    
assign (residue 19 and name H1' and segi DNA1) 
 (residue 19 and name H2'' and segi DNA1)   3.3    1.28    1.28    
assign (residue 19 and name H1' and segi DNA1) 
 (residue 19 and name H3' and segi DNA1)   4.3    0.62    0.62    
assign (residue 19 and name H1' and segi DNA1) 
 (residue 20 and name H1' and segi DNA1)   3.7    1.14    1.14    
assign (residue 19 and name H1' and segi DNA1) 
 (residue 20 and name H4' and segi DNA1)   5.1    1.21    1.21 
assign (residue 19 and name H2 and segi DNA1) 
 (residue 19 and name H4' and segi DNA1)    4.2   1.83    1.83    
assign (residue 19 and name H2' and segi DNA1) 
 (residue 19 and name H2'' and segi DNA1)   2.6    0.62    0.62    
assign (residue 19 and name H3' and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)   3.3   1.39    1.39    
assign (residue 19 and name H3' and segi DNA1) 
 (residue 19 and name H2' and segi DNA1)   3.1     0.6    0.6    
assign (residue 19 and name H3' and segi DNA1) 
 (residue 19 and name H2'' and segi DNA1)   2.8    0.61    0.61    
assign (residue 19 and name H3' and segi DNA1) 
 (residue 19 and name H4' and segi DNA1)   3.1    0.64    0.64     
assign (residue 19 and name H8 and segi DNA1) 
 (residue 19 and name H1' and segi DNA1)    4.1   1.68    1.68    
assign (residue 19 and name H8 and segi DNA1) 
 (residue 19 and name H2' and segi DNA1)    3.3    1.25    1.25    
assign (residue 19 and name H8 and segi DNA1) 
 (residue 19 and name H3' and segi DNA1)    3.7   1.62    1.62    
assign (residue 19 and name H8 and segi DNA1) 
 (residue 19 and name H4' and segi DNA1)    5.8    1.42    1.42    
assign (residue 19 and name H8 and segi DNA1) 
 (residue 19 and name H5' and segi DNA1)    4.5    1.89    1.89    
assign (residue 20 and name H1' and segi DNA1) 
 (residue 20 and name H2' and segi DNA1)   3.1    0.69    0.69    
assign (residue 20 and name H1' and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)   2.57     0.8      0.8    
assign (residue 20 and name H1' and segi DNA1) 
 (residue 20 and name H3' and segi DNA1)   3.4    0.67    0.67    
assign (residue 20 and name H1' and segi DNA1) 
 (residue 20 and name H4' and segi DNA1)   3.3     0.66    0.66       
assign (residue 20 and name H2 and segi DNA1) 
 (residue 20 and name H1' and segi DNA1)    5.2   0.80    0.80               
assign (residue 20 and name H3' and segi DNA1) 
 (residue 20 and name H2' and segi DNA1)   2.7    0.68    0.68    
assign (residue 20 and name H3' and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)   2.43     0.8    0.8   
assign (residue 20 and name H3' and segi DNA1) 
 (residue 20 and name H4' and segi DNA1)   2.9    0.65    0.65    
assign (residue 20 and name H4' and segi DNA1) 
 (residue 20 and name H2' and segi DNA1)   3.9    0.64    0.64    
assign (residue 20 and name H4' and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)   3.2    1.33    1.33       
assign (residue 20 and name H8 and segi DNA1) 
 (residue 19 and name H1' and segi DNA1)    3.8    1.61    1.61     
assign (residue 20 and name H8 and segi DNA1) 
 (residue 20 and name H1' and segi DNA1)    3.5   0.64    0.64    
assign (residue 20 and name H8 and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)    4.69    1.48    1.48    
assign (residue 20 and name H8 and segi DNA1) 
 (residue 20 and name H3' and segi DNA1)    3.6  1.64    1.64    
assign (residue 20 and name H8 and segi DNA1) 
 (residue 20 and name H4' and segi DNA1)    4.6    0.64    0.64      
assign (residue 21 and name H1' and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)   2.49      0.8      0.8
assign (residue 21 and name H1' and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)   2.9     0.60    0.60    
assign (residue 21 and name H1' and segi DNA1) 
 (residue 21 and name H3' and segi DNA1)   3.9     0.67    0.67    
assign (residue 21 and name H1' and segi DNA1) 
 (residue 22 and name H4' and segi DNA1)   4.0    1.53    1.53    
assign (residue 21 and name H3' and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)   2.8    0.66    0.66    
assign (residue 21 and name H3' and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)   3.0     0.64    0.64    
assign (residue 21 and name H3' and segi DNA1) 
 (residue 21 and name H4' and segi DNA1)   3.0    0.66    0.66
assign (residue 21 and name H4' and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)   3.9    1.21    1.21 
assign (residue 21 and name H8 and segi DNA1) 
 (residue 21 and name H1' and segi DNA1)    2.6    0.65    0.65    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)    4.9    1.45    1.45    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)    4.1     0.62    0.62    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 21 and name H3' and segi DNA1)    5.4    1.07    1.07    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 22 and name H3' and segi DNA1)    5.0    1.71  1.71     
assign (residue 21 and name H8 and segi DNA1) 
 (residue 22 and name H4' and segi DNA1)    4.0     0.60    0.60    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 22 and name H8 and segi DNA1)     4.1    0.65    0.65  
assign (residue 22 and name H1' and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)   2.9   0.65    0.65    
assign (residue 22 and name H1' and segi DNA1) 
 (residue 22 and name H2'' and segi DNA1)   3.0    0.66    0.66    
assign (residue 22 and name H1' and segi DNA1) 
 (residue 22 and name H3' and segi DNA1)   3.9    1.64    1.64    
assign (residue 22 and name H1' and segi DNA1) 
 (residue 22 and name H4' and segi DNA1)   3.0    0.62    0.62    
assign (residue 22 and name H1' and segi DNA1) 
 (residue 23 and name H3' and segi DNA1)   4.6   1.65    1.65    
assign (residue 22 and name H3' and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)   2.9    0.69    0.69    
assign (residue 22 and name H3' and segi DNA1) 
 (residue 22 and name H2'' and segi DNA1)   2.7    0.67    0.67    
assign (residue 22 and name H3' and segi DNA1) 
 (residue 22 and name H4' and segi DNA1)   3.1     0.66    0.66        
assign (residue 22 and name H4' and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)   3.7    1.2      1.2        
assign (residue 22 and name H4' and segi DNA1) 
 (residue 22 and name H2'' and segi DNA1)   3.0    1.0      1.0                
assign (residue 22 and name H8 and segi DNA1) 
 (residue 21 and name H2' and segi DNA1)    3.2    0.66    0.66    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)    2.9    0.92    0.92    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 21 and name H3' and segi DNA1)    4.3    1.44    1.44 
assign (residue 22 and name H8 and segi DNA1) 
 (residue 22 and name H1' and segi DNA1)    3.4    0.64    0.64    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)    3.2    0.62    0.62    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 22 and name H2'' and segi DNA1)    3.5   0.94    0.94    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 22 and name H3' and segi DNA1)    4.5    0.69    0.69    
assign (residue 22 and name H8 and segi DNA1) 
 (residue 22 and name H4' and segi DNA1)    4.3    0.82    0.82    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)   3.0    0.62    0.62    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   3.0    0.69    0.69    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H3' and segi DNA1)   4.4    0.68    0.68    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H4' and segi DNA1)   3.4    0.68    0.68    
assign (residue 23 and name H3' and segi DNA1) 
 (residue 22 and name H2'' and segi DNA1)   5.5    1.40    1.40   
assign (residue 23 and name H3' and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)   2.8   0.62    0.62       
assign (residue 23 and name H3' and segi DNA1) 
 (residue 23 and name H4' and segi DNA1)   2.7    0.64    0.64    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)    2.7     0.65    0.65      
assign (residue 23 and name H8 and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)    4.9    1.16    1.16    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)    3.9    0.66    0.66    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 23 and name H3' and segi DNA1)    5.6    0.65    0.65    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 24 and name H1' and segi DNA1)    4.5    0.96    0.96    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)    4.1   1.77    1.77    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 24 and name H2'' and segi DNA1)    4.5    1.19    1.19    
assign (residue 23 and name H8 and segi DNA1) 
 (residue 24 and name H4' and segi DNA1)    4.1    0.69    0.69   
assign (residue 13 and name H4' and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)   5.7    1.07    1.07
assign (residue 13 and name H4' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.9    0.66    0.66
assign (residue 13 and name H4' and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   4.2    0.62    0.62 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    5.1    1.38    1.38  
assign (residue 13 and name H6 and segi DNA1) 
 (residue 12 and name H3' and segi DNA1)    5.1    0.97    0.97
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H1' and segi DNA1)    4.0    0.65    0.65  
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)    4.7   1.38    1.38 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)    4.1     0.65    0.65
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H3' and segi DNA1)    4.5     0.68    0.68
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H4' and segi DNA1)    4.1    0.67    0.67 
assign (residue 14 and name H1' and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   4.6    1.80    1.80
assign (residue 14 and name H1' and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)   3.1    0.66    0.66    
assign (residue 14 and name H1' and segi DNA1) 
 (residue 14 and name H2'' and segi DNA1)   2.6    0.65    0.65    
assign (residue 14 and name H1' and segi DNA1) 
 (residue 14 and name H3' and segi DNA1)   3.2     0.99    0.99    
assign (residue 14 and name H1' and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)   3.6    0.68    0.68        
assign (residue 24 and name H1' and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)   4.2     1.61    1.61    
assign (residue 24 and name H1' and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   4.6    0.80    0.80            
assign (residue 24 and name H1' and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)   2.8    0.60    0.60    
assign (residue 24 and name H1' and segi DNA1) 
 (residue 24 and name H2'' and segi DNA1)   3.2    0.91    0.91    
assign (residue 24 and name H1' and segi DNA1) 
 (residue 24 and name H4' and segi DNA1)   3.5    0.95    0.95 
assign (residue 24 and name H3' and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)   3.2    0.93    0.93    
assign (residue 24 and name H3' and segi DNA1) 
 (residue 24 and name H2'' and segi DNA1)   2.6    0.64    0.64    
assign (residue 24 and name H3' and segi DNA1) 
 (residue 24 and name H4' and segi DNA1)   3.1    0.66    0.66    
assign (residue 24 and name H4' and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)   3.0    0.95    0.95    
assign (residue 24 and name H4' and segi DNA1) 
 (residue 24 and name H2'' and segi DNA1)   3.1   0.96    0.96    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H1' and segi DNA1)    4.1    0.65    0.65    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)    3.3    0.98    0.98    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)    2.9    0.65    0.65    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H3' and segi DNA1)    4.4     0.63    0.63    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 23 and name H8 and segi DNA1)     4.1    1.16    1.16    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 24 and name H1' and segi DNA1)    4.2    0.68    0.68    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 24 and name H2' and segi DNA1)    2.8   0.68    0.68    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 24 and name H3' and segi DNA1)    4.9    0.61    0.61    
assign (residue 24 and name H8 and segi DNA1) 
 (residue 24 and name H4' and segi DNA1)    4.9   0.69    0.69    
assign (residue 12 and name H6 and segi DNA1) 
 (residue 12 and name H1' and segi DNA1)    2.55      1.63    1.63
assign (residue 12 and name H6 and segi DNA1) 
 (residue 12 and name H2' and segi DNA1)    3.0     0.94    0.94
assign (residue 12 and name H6 and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)    3.7    0.95    0.95
assign (residue 12 and name H6 and segi DNA1) 
 (residue 12 and name H3' and segi DNA1)    4.7     1.23    1.23
assign (residue 12 and name H6 and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)    4.6    0.66    0.66  
assign (residue 13 and name H1' and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)   4.8    1.07    1.07
assign (residue 13 and name H1' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   2.8     0.63    0.63
assign (residue 13 and name H1' and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   3.2    1.24    1.24
assign (residue 13 and name H1' and segi DNA1) 
 (residue 13 and name H3' and segi DNA1)   3.9     0.66    0.66
assign (residue 13 and name H1' and segi DNA1) 
 (residue 13 and name H5' and segi DNA1)   4.9    1.22    1.22 
assign (residue 13 and name H1' and segi DNA1) 
 (residue 14 and name H3' and segi DNA1)   6.65      1.80    1.80  
assign (residue 13 and name H1' and segi DNA1) 
 (residue 14 and name H4' and segi DNA1)   5.7    1.06    1.06
assign (residue 13 and name H3' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.0     0.66    0.66
assign (residue 13 and name H3' and segi DNA1) 
 (residue 13 and name H2'' and segi DNA1)   2.8     0.69    0.69
assign (residue 13 and name H3' and segi DNA1) 
 (residue 13 and name H4' and segi DNA1)   3.0   0.65    0.65 
assign (residue 23 and name H2' and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   2.45    0.8    0.8
assign (residue 18 and name H2' and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)   2.35    0.8    0.8 
assign (residue 8 and name H2'' and segi DNA1) 
 (residue 8 and name H2' and segi DNA1)     2.39    0.8    0.8
assign (residue 14 and name H2'' and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)   2.34    0.8    0.8
assign (residue 17 and name H2' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   2.41    0.8    0.8
assign (residue 2 and name H3' and segi DNA1) 
 (residue 2 and name H5' and segi DNA1)     4.0   1.3    1.3      
assign (residue 2 and name H5' and segi DNA1) 
 (residue 1 and name H2'' and segi DNA1)    4.0   1.3    1.3   
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H5' and segi DNA1)     5.6    1.8      1.8      
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H5'' and segi DNA1)     4.7    1.2      1.2 
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)    4.0   1.3    1.3   
assign (residue 2 and name H8 and segi DNA1) 
 (residue 2 and name H5' and segi DNA1)      4.4    1.5      1.5      
assign (residue 3 and name H1' and segi DNA1) 
 (residue 3 and name H5'' and segi DNA1)     4.0   1.3    1.3    
assign (residue 5 and name H6 and segi DNA1) 
 (residue 5 and name H2'' and segi DNA1)      5.1   1.7      1.7    !%
assign (residue 5 and name H5'' and segi DNA1) 
 (residue 5 and name H2' and segi DNA1)     4.2    1.3      1.3    !%
assign (residue 5 and name H5'' and segi DNA1) 
 (residue 5 and name H2'' and segi DNA1)    4.8    1.6      1.6    !%
assign (residue 5 and name H4' and segi DNA1) 
 (residue 5 and name H5'' and segi DNA1)     3.1    1.3      1.3    !%
assign (residue 5 and name H1' and segi DNA1) 
 (residue 5 and name H2'' and segi DNA1)     3.5    1.2      1.2    !%%
assign (residue 5 and name H2' and segi DNA1) 
 (residue 5 and name H2'' and segi DNA1)     2.7    0.9      0.9    !%
assign (residue 5 and name H1' and segi DNA1) 
 (residue 5 and name H5' and segi DNA1)     4.1   1.3      1.3    !%
assign (residue 5 and name H1' and segi DNA1) 
 (residue 5 and name H5'' and segi DNA1)     4.1    1.3      1.3    !% 
assign (residue 5 and name H3' and segi DNA1) 
 (residue 5 and name H5' and segi DNA1)     4.1   1.83      1.83    !%%
assign (residue 6 and name H1' and segi DNA1) 
 (residue 6 and name H5'' and segi DNA1)     5.0    1.7      1.7    !% 
assign (residue 6 and name H3' and segi DNA1) 
 (residue 6 and name H5' and segi DNA1)     4.1   1.5      1.5    !%
assign (residue 6 and name H3' and segi DNA1) 
 (residue 6 and name H5'' and segi DNA1)     3.6    1.3      1.3    !%
assign (residue 6 and name H5' and segi DNA1) 
 (residue 6 and name H4' and segi DNA1)     3.6    1.2      1.2    !%
assign (residue 6 and name H5'' and segi DNA1) 
 (residue 6 and name H2'' and segi DNA1)     3.1    1.83      1.83    !%
assign (residue 6 and name H6 and segi DNA1) 
 (residue 6 and name H5' and segi DNA1)      4.3    1.4      1.4   !% 
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H5' and segi DNA1)     4.3    1.4      1.4    !%
assign (residue 7 and name H3' and segi DNA1) 
 (residue 7 and name H5'' and segi DNA1)     3.1    1.0      1.0    !%
assign (residue 7 and name H5' and segi DNA1) 
 (residue 7 and name H2' and segi DNA1)     4.1   1.3      1.3    !%%
assign (residue 7 and name H5' and segi DNA1) 
 (residue 7 and name H2'' and segi DNA1)     5.0    1.7      1.7    !%
assign (residue 7 and name H8 and segi DNA1) 
 (residue 7 and name H5'' and segi DNA1)      5.9   1.9      1.9    !% 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 7 and name H5'' and segi DNA1)      5.6   1.8      1.8   !% 
assign (residue 8 and name H8 and segi DNA1) 
 (residue 7 and name H8 and segi DNA1)       4.6    1.5      1.5    !%
assign (residue 9 and name H1' and segi DNA1) 
 (residue 10 and name H3' and segi DNA1)    3.7    1.9      1.9    !%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 9 and name H1' and segi DNA1)      2.6    0.8      0.8    !%
assign (residue 9 and name H8 and segi DNA1) 
 (residue 10 and name H4' and segi DNA1)     3.1    1.97      1.97    !%%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 10 and name H3' and segi DNA1)    4.0    1.5      1.5    !%%
assign (residue 11 and name H6 and segi DNA1) 
 (residue 11 and name H3' and segi DNA1)    2.9    1.9      1.9    !% 
assign (residue 11 and name H1' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   5.4    1.8      1.8   !% 
assign (residue 11 and name H3' and segi DNA1) 
 (residue 11 and name H5' and segi DNA1)   3.2    1.3      1.3    !%
assign (residue 11 and name H3' and segi DNA1) 
 (residue 11 and name H5'' and segi DNA1)   4.0    1.7      1.7    !%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H5' and segi DNA1)   4.5    1.5      1.5    !%%
assign (residue 12 and name H1' and segi DNA1) 
 (residue 12 and name H5'' and segi DNA1)   4.3    1.4      1.4    !%  
assign (residue 12 and name H1' and segi DNA1) 
 (residue 13 and name H5' and segi DNA1)   5.1    1.7      1.7    !% 
assign (residue 14 and name H3' and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)   3.7   1.2   1.2   
assign (residue 16 and name H3' and segi DNA1) 
 (residue 17 and name H5'' and segi DNA1)   4.6   1.2   1.2        
assign (residue 16 and name H4' and segi DNA1) 
 (residue 17 and name H5' and segi DNA1)   4.6  1.2   1.2      
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H5' and segi DNA1)     5.4    1.8      1.8    
assign (residue 1 and name H1' and segi DNA1) 
 (residue 1 and name H5'' and segi DNA1)     5.1    1.7      1.7   
assign (residue 1 and name H3' and segi DNA1) 
 (residue 1 and name H5' and segi DNA1)     3.1    1.0      1.0                
assign (residue 1 and name H4' and segi DNA1) 
 (residue 1 and name H5' and segi DNA1)     3.9    1.9      1.9    
assign (residue 1 and name H4' and segi DNA1) 
 (residue 1 and name H5'' and segi DNA1)     2.9    1.3      1.3            
assign (residue 1 and name H5' and segi DNA1) 
 (residue 1 and name H5'' and segi DNA1)     2.3    1.2      1.2       
assign (residue 1 and name H5'' and segi DNA1) 
 (residue 1 and name H2' and segi DNA1)     3.7    1.7      1.7    
assign (residue 1 and name H8 and segi DNA1) 
 (residue 1 and name H5'' and segi DNA1)      5.9   1.9      1.9 
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H2'' and segi DNA1)     3.2    1.0      1.0
assign (residue 2 and name H1' and segi DNA1) 
 (residue 2 and name H3' and segi DNA1)     3.6    1.0      1.0
assign (residue 14 and name H4' and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)   2.9   0.65    0.65    
assign (residue 14 and name H5'' and segi DNA1) 
 (residue 14 and name H2' and segi DNA1)   3.1    1.67    1.67    
assign (residue 14 and name H5'' and segi DNA1) 
 (residue 14 and name H2'' and segi DNA1)   3.5    1.67    1.67        
assign (residue 14 and name H6 and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)    3.0    0.65    0.65   
assign (residue 15 and name H3' and segi DNA1) 
 (residue 15 and name H5' and segi DNA1)   3.0   0.65    0.65     
assign (residue 15 and name H3' and segi DNA1) 
 (residue 15 and name H5'' and segi DNA1)   3.0   0.65    0.65     
assign (residue 15 and name H4' and segi DNA1) 
 (residue 15 and name H5'' and segi DNA1)   3.5     1.20    1.20    
assign (residue 15 and name H4' and segi DNA1) 
 (residue 15 and name H5'' and segi DNA1)   3.0    0.60    0.60       
assign (residue 15 and name H5'' and segi DNA1) 
 (residue 15 and name H2' and segi DNA1)   3.0    0.98  0.98      
assign (residue 15 and name H8 and segi DNA1) 
 (residue 14 and name H5'' and segi DNA1)    4.2    1.69    1.69    
assign (residue 17 and name H3' and segi DNA1) 
 (residue 17 and name H5' and segi DNA1)   3.8     0.99    0.99    
assign (residue 17 and name H3' and segi DNA1) 
 (residue 17 and name H5'' and segi DNA1)   3.8     0.99    0.99      
assign (residue 17 and name H5' and segi DNA1) 
 (residue 17 and name H2' and segi DNA1)   4.1    1.48    1.48    
assign (residue 17 and name H8 and segi DNA1) 
 (residue 17 and name H5' and segi DNA1)    5.0    1.48    1.48   
assign (residue 18 and name H1' and segi DNA1) 
 (residue 17 and name H2'' and segi DNA1)   4.6    0.99    0.99    
assign (residue 18 and name H1' and segi DNA1) 
 (residue 18 and name H5' and segi DNA1)   3.3    1.38    1.38         
assign (residue 18 and name H3' and segi DNA1) 
 (residue 18 and name H5' and segi DNA1)   3.9   1.48    1.48    
assign (residue 18 and name H3' and segi DNA1) 
 (residue 18 and name H5'' and segi DNA1)   3.8   1.65    1.65    
assign (residue 18 and name H4' and segi DNA1) 
 (residue 18 and name H5'' and segi DNA1)   3.57     1.2      1.2    
assign (residue 18 and name H5'' and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)   5.5    0.95    0.95  
assign (residue 18 and name H8 and segi DNA1) 
 (residue 18 and name H5'' and segi DNA1)    4.2    1.60    1.60      
assign (residue 18 and name H8 and segi DNA1) 
 (residue 19 and name H5'' and segi DNA1)    4.8    1.75    1.75   
assign (residue 19 and name H1' and segi DNA1) 
 (residue 19 and name H5' and segi DNA1)   4.7    1.07    1.07    
assign (residue 19 and name H1' and segi DNA1) 
 (residue 19 and name H5'' and segi DNA1)   3.9   1.64    1.64       
assign (residue 19 and name H1' and segi DNA1) 
 (residue 20 and name H5' and segi DNA1)   4.8   1.80    1.80       
assign (residue 19 and name H1' and segi DNA1) 
 (residue 20 and name H5'' and segi DNA1)   4.7  1.6    1.6 
assign (residue 19 and name H3' and segi DNA1) 
 (residue 19 and name H5' and segi DNA1)   4.0    1.64    1.64    
assign (residue 19 and name H3' and segi DNA1) 
 (residue 19 and name H5'' and segi DNA1)   3.8    1.3   1.3      
assign (residue 19 and name H3' and segi DNA1) 
 (residue 20 and name H5'' and segi DNA1)   4.6    1.3   1.3             
assign (residue 19 and name H5'' and segi DNA1) 
 (residue 18 and name H2'' and segi DNA1)   4.27    0.99    0.99    
assign (residue 19 and name H8 and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)    4.3    0.69    0.69  
assign (residue 20 and name H3' and segi DNA1) 
 (residue 20 and name H5' and segi DNA1)   4.0    1.37    1.37          
assign (residue 20 and name H5' and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)   3.6     1.64    1.64    
assign (residue 20 and name H5' and segi DNA1) 
 (residue 20 and name H2'' and segi DNA1)   4.7    1.6  1.6        
assign (residue 20 and name H5'' and segi DNA1) 
 (residue 20 and name H2' and segi DNA1)   4.7     0.82    0.82
assign (residue 21 and name H3' and segi DNA1) 
 (residue 21 and name H5' and segi DNA1)   3.1    0.64    0.64    
assign (residue 21 and name H3' and segi DNA1) 
 (residue 21 and name H5'' and segi DNA1)   3.1     0.66    0.66    
assign (residue 21 and name H8 and segi DNA1) 
 (residue 21 and name H5'' and segi DNA1)    5.6    1.34    1.34   
assign (residue 22 and name H8 and segi DNA1) 
 (residue 21 and name H4' and segi DNA1)    4.1     1.95   1.95         
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H5' and segi DNA1)   4.1    0.67    0.67    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 23 and name H5'' and segi DNA1)   4.7    0.65    0.65    
assign (residue 23 and name H1' and segi DNA1) 
 (residue 24 and name H5' and segi DNA1)   3.2    1.64    1.64      
assign (residue 23 and name H8 and segi DNA1) 
 (residue 23 and name H5'' and segi DNA1)   5.0    1.61    1.61 
assign (residue 13 and name H6 and segi DNA1) 
 (residue 13 and name H5'' and segi DNA1)    2.9    1.65    1.65        
assign (residue 13 and name H6 and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)    5.3    1.62    1.62        
assign (residue 23 and name H3' and segi DNA1) 
 (residue 23 and name H5' and segi DNA1)   3.2    0.67    0.67    
assign (residue 23 and name H3' and segi DNA1) 
 (residue 23 and name H5'' and segi DNA1)   3.1    0.64    0.64    
assign (residue 23 and name H5' and segi DNA1) 
 (residue 23 and name H2' and segi DNA1)   3.9    1.66    1.66    
assign (residue 23 and name H5' and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   4.0    1.63    1.63        
assign (residue 23 and name H5'' and segi DNA1) 
 (residue 22 and name H2' and segi DNA1)   4.9    0.68    0.68        
assign (residue 23 and name H5'' and segi DNA1) 
 (residue 23 and name H2'' and segi DNA1)   4.7    0.68    0.68    
assign (residue 23 and name H5'' and segi DNA1) 
 (residue 23 and name H5' and segi DNA1)   3.2    1.8      1.8          
assign (residue 13 and name H5' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.4    1.44    1.44
assign (residue 13 and name H6 and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)    3.7  1.55    1.55   
assign (residue 24 and name H8 and segi DNA1) 
 (residue 24 and name H5' and segi DNA1)    5.2    1.14    1.14    
assign (residue 12 and name H5' and segi DNA1) 
 (residue 12 and name H2' and segi DNA1)   4.4     0.80    0.80  
assign (residue 12 and name H5' and segi DNA1) 
 (residue 12 and name H2'' and segi DNA1)   5.3    0.80    0.80  
assign (residue 12 and name H5' and segi DNA1) 
 (residue 12 and name H4' and segi DNA1)   3.1    0.66    0.66   
assign (residue 13 and name H1' and segi DNA1) 
 (residue 13 and name H5'' and segi DNA1)   5.9    1.27    1.27 
assign (residue 13 and name H1' and segi DNA1) 
 (residue 14 and name H5' and segi DNA1)   3.8     0.62    0.62 
assign (residue 24 and name H1' and segi DNA1) 
 (residue 24 and name H3' and segi DNA1)   4.9    1.20    1.20    
assign (residue 1 and name H1' and segi DNA1) 
 (residue 2 and name H4' and segi DNA1)     3.45    1.64    1.64
assign (residue 6 and name H2' and segi DNA1) 
 (residue 6 and name H5' and segi DNA1)     4.29    1.27    1.27
assign (residue 6 and name H2' and segi DNA1) 
 (residue 6 and name H5' and segi DNA1)     4.23    1.29    1.29
assign (residue 6 and name H5'' and segi DNA1) 
 (residue 6 and name H4' and segi DNA1)     3.50    1.2    1.2
assign (residue 7 and name H1' and segi DNA1) 
 (residue 7 and name H5'' and segi DNA1)     4.43    0.69    0.69
assign (residue 7 and name H4' and segi DNA1) 
 (residue 7 and name H5' and segi DNA1)     3.37    0.93    0.93
assign (residue 14 and name H5'' and segi DNA1) 
 (residue 13 and name H2' and segi DNA1)   3.54    1.64    1.64
assign (residue 15 and name H1' and segi DNA1) 
 (residue 15 and name H4' and segi DNA1)   3.48    0.99    0.99
assign (residue 15 and name H2' and segi DNA1) 
 (residue 15 and name H2'' and segi DNA1)   2.45    0.63    0.63
assign (residue 16 and name H4' and segi DNA1) 
 (residue 16 and name H2'' and segi DNA1)   3.05    1.20    1.20
assign (residue 17 and name H4' and segi DNA1) 
 (residue 17 and name H5' and segi DNA1)   3.23    0.60    0.60
assign (residue 18 and name H4' and segi DNA1) 
 (residue 18 and name H5' and segi DNA1)   3.48    1.68    1.68
assign (residue 19 and name H4' and segi DNA1) 
 (residue 19 and name H5' and segi DNA1)   3.05    0.68    0.68    
assign (residue 20 and name H4' and segi DNA1) 
 (residue 20 and name H5'' and segi DNA1)   3.36    1.65    1.65
assign (residue 21 and name H2' and segi DNA1) 
 (residue 21 and name H2'' and segi DNA1)   3.38    1.61    1.61
assign (residue 21 and name H4' and segi DNA1) 
 (residue 21 and name H5'' and segi DNA1)   2.65  1.69  1.69    
assign (residue 18 and name H3' and segi DNA1) 
 (residue 18 and name H2' and segi DNA1)   2.88   0.65  0.65   
assign (residue 6 and name H6 and segi DNA1) 
 (residue 5 and name H5'' and segi DNA1)      5.8   1.9      1.9   


!set echo=false end
               
               
               
               
               
               
               
               
               
              
              
              
              
              
              
              
              

  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1    H5'   DG   1           H5'       DG   1  -4.815  -5.443  -6.870
    2   H5''   DG   1          H5"        DG   1  -3.793  -5.086  -5.464
    3    H4'   DG   1           H4'       DG   1  -6.826  -5.053  -5.534
    4    H3'   DG   1           H3'       DG   1  -5.196  -2.969  -6.282
    5    H2'   DG   1           H2'       DG   1  -3.983  -2.919  -4.226
    6   H2''   DG   1          H2"        DG   1  -5.242  -1.676  -3.921
    7    H1'   DG   1           H1'       DG   1  -6.630  -3.219  -2.793
    8    H8    DG   1           8H        DG   1  -6.357  -4.107  -0.372
    9    H1    DG   1           1H        DG   1   0.035  -4.229  -0.853
   10    H21   DG   1           1H2       DG   1   0.660  -3.629  -2.863
   11    H22   DG   1           2H2       DG   1  -0.471  -3.104  -4.053
   12   HO5'   DG   1          H5T        DG   1  -4.921  -6.884  -4.432
   13    H5'   DG   2           H5'       DG   2  -8.942  -2.585  -3.475
   14   H5''   DG   2          H5"        DG   2  -9.837  -1.097  -3.844
   15    H4'   DG   2           H4'       DG   2 -10.088  -1.814  -1.482
   16    H3'   DG   2           H3'       DG   2  -9.423   0.817  -2.342
   17    H2'   DG   2           H2'       DG   2  -7.451   1.143  -1.194
   18   H2''   DG   2          H2"        DG   2  -8.457   1.126   0.286
   19    H1'   DG   2           H1'       DG   2  -7.836  -1.010   0.823
   20    H8    DG   2           8H        DG   2  -5.734  -0.206  -2.356
   21    H1    DG   2           1H        DG   2  -2.329  -2.306   2.590
   22    H21   DG   2           1H2       DG   2  -3.688  -2.567   4.401
   23    H22   DG   2           2H2       DG   2  -5.409  -2.287   4.321
   24    H5'   DG   3           H5'       DG   3 -10.351   0.743   1.439
   25   H5''   DG   3          H5"        DG   3 -11.772   0.768   2.502
   26    H4'   DG   3           H4'       DG   3 -11.136   2.710   3.536
   27    H3'   DG   3           H3'       DG   3 -10.768   3.809   0.980
   28    H2'   DG   3           H2'       DG   3  -8.519   3.058   0.769
   29   H2''   DG   3          H2"        DG   3  -8.270   4.654   1.545
   30    H1'   DG   3           H1'       DG   3  -8.226   3.703   3.731
   31    H8    DG   3           8H        DG   3  -6.602   1.841   4.877
   32    H1    DG   3           1H        DG   3  -3.387   1.860  -0.605
   33    H21   DG   3           1H2       DG   3  -4.662   2.662  -2.201
   34    H22   DG   3           2H2       DG   3  -6.284   3.185  -1.971
   35    H5'   DG   4           H5'       DG   4  -8.927   8.645   1.797
   36   H5''   DG   4          H5"        DG   4  -7.552   7.841   1.013
   37    H4'   DG   4           H4'       DG   4  -8.309   7.939   3.892
   38    H3'   DG   4           H3'       DG   4  -5.710   7.824   2.349
   39    H2'   DG   4           H2'       DG   4  -4.704   7.073   4.461
   40   H2''   DG   4          H2"        DG   4  -6.256   7.349   5.339
   41    H1'   DG   4           H1'       DG   4  -6.343   5.008   4.624
   42    H8    DG   4           8H        DG   4  -6.747   5.722   0.991
   43    H1    DG   4           1H        DG   4  -0.744   4.018   2.303
   44    H21   DG   4           1H2       DG   4  -0.441   3.943   4.534
   45    H22   DG   4           2H2       DG   4  -1.733   4.313   5.654
   46    H5'   DT   5           H5'       DT   5  -3.360  11.648   1.675
   47   H5''   DT   5          H5"        DT   5  -3.259  10.180   0.695
   48    H4'   DT   5           H4'       DT   5  -1.566  10.589   3.166
   49    H3'   DT   5           H3'       DT   5  -1.301  12.045   0.702
   50    H2'   DT   5           H2'       DT   5   0.317  10.905  -0.463
   51   H2''   DT   5          H2"        DT   5   1.233  10.527   1.024
   52    H1'   DT   5           H1'       DT   5   0.397   8.391   0.661
   53    H3    DT   5           3H        DT   5  -1.842   9.395  -3.668
   54    H71   DT   5           1H5       DT   5  -5.474   7.516  -1.506
   55    H72   DT   5           2H5       DT   5  -5.162   8.097   0.146
   56    H73   DT   5           3H5       DT   5  -4.633   6.471  -0.338
   57    H6    DT   5           6H        DT   5  -2.579   7.785   0.764
   58    H5'   DT   6           H5'       DT   6   3.013  10.983   3.166
   59   H5''   DT   6          H5"        DT   6   2.751   9.547   2.152
   60    H4'   DT   6           H4'       DT   6   4.211   9.284   4.264
   61    H3'   DT   6           H3'       DT   6   2.126   7.471   3.238
   62    H2'   DT   6           H2'       DT   6   1.509   6.439   5.222
   63   H2''   DT   6          H2"        DT   6   3.130   6.656   5.934
   64    H1'   DT   6           H1'       DT   6   2.143   8.341   7.111
   65    H3    DT   6           3H        DT   6  -1.890  10.265   7.634
   66    H71   DT   6           1H5       DT   6  -2.010   7.974   2.843
   67    H72   DT   6           2H5       DT   6  -3.491   8.359   3.749
   68    H73   DT   6           3H5       DT   6  -2.689   6.788   3.980
   69    H6    DT   6           6H        DT   6   0.070   7.593   4.139
   70    H5'   DG   7           H5'       DG   7   5.709   7.575   7.290
   71   H5''   DG   7          H5"        DG   7   7.146   6.654   6.792
   72    H4'   DG   7           H4'       DG   7   5.984   6.015   9.042
   73    H3'   DG   7           H3'       DG   7   7.588   4.469   7.524
   74    H2'   DG   7           H2'       DG   7   5.929   3.758   5.973
   75   H2''   DG   7          H2"        DG   7   5.904   2.394   7.127
   76    H1'   DG   7           H1'       DG   7   3.998   3.168   8.210
   77    H8    DG   7           8H        DG   7   1.484   3.790   7.504
   78    H1    DG   7           1H        DG   7   3.324   4.397   1.401
   79    H21   DG   7           1H2       DG   7   5.569   4.331   1.262
   80    H22   DG   7           2H2       DG   7   6.590   4.183   2.676
   81    H5'   DG   8           H5'       DG   8   4.268   2.827  10.331
   82   H5''   DG   8          H5"        DG   8   4.727   1.320  11.146
   83    H4'   DG   8           H4'       DG   8   2.345   1.290  10.661
   84    H3'   DG   8           H3'       DG   8   3.962  -0.571   8.890
   85    H2'   DG   8           H2'       DG   8   1.934  -1.283   7.940
   86   H2''   DG   8          H2"        DG   8   0.982  -0.821   9.386
   87    H1'   DG   8           H1'       DG   8   0.540   1.172   8.358
   88    H8    DG   8           8H        DG   8   3.794   0.669   6.357
   89    H1    DG   8           1H        DG   8  -1.688   1.427   2.964
   90    H21   DG   8           1H2       DG   8  -3.378   1.549   4.444
   91    H22   DG   8           2H2       DG   8  -3.150   1.426   6.167
   92    H5'   DG   9           H5'       DG   9   0.849  -1.501  11.707
   93   H5''   DG   9          H5"        DG   9   1.010  -2.996  12.651
   94    H4'   DG   9           H4'       DG   9  -1.347  -2.473  12.167
   95    H3'   DG   9           H3'       DG   9  -0.131  -5.001  11.636
   96    H2'   DG   9           H2'       DG   9  -0.472  -4.926   9.303
   97   H2''   DG   9          H2"        DG   9  -2.118  -5.457   9.786
   98    H1'   DG   9           H1'       DG   9  -2.943  -3.247   9.824
   99    H8    DG   9           8H        DG   9  -3.977  -2.766   7.532
  100    H1    DG   9           1H        DG   9   1.678  -2.744   4.534
  101    H21   DG   9           1H2       DG   9   3.328  -3.176   5.985
  102    H22   DG   9           2H2       DG   9   3.029  -3.439   7.690
  103    H5'   DG  10           H5'       DG  10  -4.571  -4.296  11.229
  104   H5''   DG  10          H5"        DG  10  -5.545  -5.558  12.013
  105    H4'   DG  10           H4'       DG  10  -6.675  -4.804  10.001
  106    H3'   DG  10           H3'       DG  10  -6.190  -7.499  10.465
  107    H2'   DG  10           H2'       DG  10  -4.291  -7.564   8.978
  108   H2''   DG  10          H2"        DG  10  -5.624  -8.105   7.901
  109    H1'   DG  10           H1'       DG  10  -6.022  -5.869   7.144
  110    H8    DG  10           8H        DG  10  -2.312  -6.460   8.139
  111    H1    DG  10           1H        DG  10  -3.241  -4.720   2.097
  112    H21   DG  10           1H2       DG  10  -5.478  -4.417   1.751
  113    H22   DG  10           2H2       DG  10  -6.657  -4.637   3.015
  114    H5'   DT  11           H5'       DT  11  -8.358  -8.695   5.226
  115   H5''   DT  11          H5"        DT  11  -7.017  -9.552   6.008
  116    H4'   DT  11           H4'       DT  11  -6.733  -7.234   4.069
  117    H3'   DT  11           H3'       DT  11  -7.142  -9.993   3.531
  118    H2'   DT  11           H2'       DT  11  -4.989 -10.649   4.015
  119   H2''   DT  11          H2"        DT  11  -4.653 -10.031   2.366
  120    H1'   DT  11           H1'       DT  11  -3.981  -7.943   3.188
  121    H3    DT  11           3H        DT  11   0.231  -9.586   4.145
  122    H71   DT  11           1H5       DT  11  -2.653 -10.548   8.405
  123    H72   DT  11           2H5       DT  11  -2.332  -8.808   8.602
  124    H73   DT  11           3H5       DT  11  -0.980  -9.966   8.570
  125    H6    DT  11           6H        DT  11  -3.933  -9.293   6.466
  126    H5'   DT  12           H5'       DT  12  -4.832 -10.485  -1.499
  127   H5''   DT  12          H5"        DT  12  -5.165 -11.506  -0.084
  128    H4'   DT  12           H4'       DT  12  -2.616  -9.954  -0.674
  129    H3'   DT  12           H3'       DT  12  -3.363 -12.855  -0.661
  130    H2'   DT  12           H2'       DT  12  -1.723 -13.424   0.844
  131   H2''   DT  12          H2"        DT  12  -0.521 -12.413  -0.022
  132    H1'   DT  12           H1'       DT  12  -0.877 -10.639   1.409
  133    H3    DT  12           3H        DT  12   0.064 -12.808   5.348
  134    H71   DT  12           1H5       DT  12  -4.560 -13.293   5.974
  135    H72   DT  12           2H5       DT  12  -5.208 -12.867   4.372
  136    H73   DT  12           3H5       DT  12  -4.821 -11.588   5.549
  137    H6    DT  12           6H        DT  12  -3.850 -11.889   2.753
  138    H5'   DT  13           H5'       DT  13  -2.063  -9.242  -2.414
  139   H5''   DT  13          H5"        DT  13  -2.478  -8.642  -4.030
  140    H4'   DT  13           H4'       DT  13  -0.099  -8.461  -4.593
  141    H3'   DT  13           H3'       DT  13   0.535 -10.295  -2.714
  142    H2'   DT  13           H2'       DT  13   0.180  -9.192  -0.690
  143   H2''   DT  13          H2"        DT  13   1.707  -8.342  -1.067
  144    H1'   DT  13           H1'       DT  13   0.573  -6.414  -1.398
  145    H3    DT  13           3H        DT  13  -2.313  -6.983   2.261
  146    H71   DT  13           1H5       DT  13  -5.777  -7.231  -0.777
  147    H72   DT  13           2H5       DT  13  -4.985  -8.275  -1.981
  148    H73   DT  13           3H5       DT  13  -5.027  -6.511  -2.221
  149    H6    DT  13           6H        DT  13  -2.558  -7.238  -2.524
  150    H5'   DT  14           H5'       DT  14   3.904  -6.950  -1.044
  151   H5''   DT  14          H5"        DT  14   4.093  -7.184  -2.791
  152    H4'   DT  14           H4'       DT  14   6.268  -6.682  -2.016
  153    H3'   DT  14           H3'       DT  14   5.896  -9.047  -3.226
  154    H2'   DT  14           H2'       DT  14   5.697 -10.555  -1.438
  155   H2''   DT  14          H2"        DT  14   7.480 -10.437  -1.388
  156    H1'   DT  14           H1'       DT  14   7.430  -9.203   0.523
  157    H3    DT  14           3H        DT  14   4.670  -9.421   4.124
  158    H71   DT  14           1H5       DT  14   1.233 -11.198   1.586
  159    H72   DT  14           2H5       DT  14   2.177 -12.013   0.317
  160    H73   DT  14           3H5       DT  14   1.531 -10.382   0.036
  161    H6    DT  14           6H        DT  14   4.136 -10.377  -0.549
  162    H5'   DG  15           H5'       DG  15   9.315  -6.294  -5.424
  163   H5''   DG  15          H5"        DG  15   8.334  -6.040  -3.966
  164    H4'   DG  15           H4'       DG  15   7.545  -5.467  -6.838
  165    H3'   DG  15           H3'       DG  15   8.813  -3.801  -4.986
  166    H2'   DG  15           H2'       DG  15   7.029  -3.733  -3.466
  167   H2''   DG  15          H2"        DG  15   6.621  -2.329  -4.515
  168    H1'   DG  15           H1'       DG  15   5.220  -3.641  -5.897
  169    H8    DG  15           8H        DG  15   2.771  -4.152  -5.375
  170    H1    DG  15           1H        DG  15   3.911  -5.015   0.815
  171    H21   DG  15           1H2       DG  15   6.091  -5.109   1.158
  172    H22   DG  15           2H2       DG  15   7.279  -4.986  -0.111
  173    H5'   DG  16           H5'       DG  16   3.889  -4.159  -8.097
  174   H5''   DG  16          H5"        DG  16   4.606  -3.131  -9.351
  175    H4'   DG  16           H4'       DG  16   2.327  -2.408  -8.795
  176    H3'   DG  16           H3'       DG  16   4.628  -0.642  -8.622
  177    H2'   DG  16           H2'       DG  16   4.158   0.209  -6.527
  178   H2''   DG  16          H2"        DG  16   2.762   1.009  -7.317
  179    H1'   DG  16           H1'       DG  16   1.278  -0.681  -6.682
  180    H8    DG  16           8H        DG  16   4.539  -0.911  -4.583
  181    H1    DG  16           1H        DG  16  -0.824  -0.774  -1.127
  182    H21   DG  16           1H2       DG  16  -2.584  -0.725  -2.422
  183    H22   DG  16           2H2       DG  16  -2.501  -0.773  -4.146
  184    H5'   DG  17           H5'       DG  17  -0.584   0.831  -6.699
  185   H5''   DG  17          H5"        DG  17  -0.800  -0.648  -7.657
  186    H4'   DG  17           H4'       DG  17  -1.884   0.509  -9.408
  187    H3'   DG  17           H3'       DG  17  -0.225   2.616  -9.088
  188    H2'   DG  17           H2'       DG  17  -0.967   3.512  -7.063
  189   H2''   DG  17          H2"        DG  17  -2.153   4.325  -8.124
  190    H1'   DG  17           H1'       DG  17  -3.848   2.990  -7.423
  191    H8    DG  17           8H        DG  17  -4.986   2.227  -5.276
  192    H1    DG  17           1H        DG  17   0.555   2.326  -2.198
  193    H21   DG  17           1H2       DG  17   2.258   2.492  -3.634
  194    H22   DG  17           2H2       DG  17   1.965   2.696  -5.338
  195    H5'   DG  18           H5'       DG  18  -6.406   3.241  -9.121
  196   H5''   DG  18          H5"        DG  18  -5.649   3.800 -10.627
  197    H4'   DG  18           H4'       DG  18  -6.281   5.630  -8.996
  198    H3'   DG  18           H3'       DG  18  -3.401   5.305  -9.888
  199    H2'   DG  18           H2'       DG  18  -2.777   7.044  -8.468
  200   H2''   DG  18          H2"        DG  18  -4.360   7.863  -8.631
  201    H1'   DG  18           H1'       DG  18  -5.092   6.863  -6.731
  202    H8    DG  18           8H        DG  18  -1.451   6.074  -7.380
  203    H1    DG  18           1H        DG  18  -3.181   4.992  -1.327
  204    H21   DG  18           1H2       DG  18  -5.462   5.100  -1.153
  205    H22   DG  18           2H2       DG  18  -6.487   5.433  -2.530
  206    H5'   DA  19           H5'       DA  19  -1.341   7.714 -13.000
  207   H5''   DA  19          H5"        DA  19  -1.049   6.471 -11.768
  208    H4'   DA  19           H4'       DA  19   0.668   8.215 -11.660
  209    H3'   DA  19           H3'       DA  19  -0.956   7.504  -9.414
  210    H2'   DA  19           H2"       DA  19  -1.716   9.656  -8.950
  211   H2''   DA  19          H2'        DA  19  -0.028   9.907  -8.358
  212    H1'   DA  19           H1'       DA  19   0.706  10.802 -10.379
  213    H8    DA  19           8H        DA  19  -1.568  12.117  -8.302
  214    H61   DA  19           2H6       DA  19  -3.676  15.737 -10.732
  215    H62   DA  19           1H6       DA  19  -3.785  16.159 -12.426
  216    H2    DA  19           2H        DA  19  -1.526  12.979 -14.659
  217    H5'   DA  20           H5'       DA  20   3.274   6.745  -5.836
  218   H5''   DA  20          H5"        DA  20   1.528   6.859  -6.139
  219    H4'   DA  20           H4'       DA  20   3.537   9.062  -6.691
  220    H3'   DA  20           H3'       DA  20   1.777   8.540  -4.289
  221    H2'   DA  20           H2'       DA  20   0.994  10.769  -4.259
  222   H2''   DA  20          H2"        DA  20   2.378  11.367  -5.233
  223    H1'   DA  20           H1'       DA  20   0.866  11.216  -6.966
  224    H8    DA  20           8H        DA  20  -0.373   7.744  -6.301
  225    H61   DA  20           2H6       DA  20  -5.040   8.790  -5.588
  226    H62   DA  20           1H6       DA  20  -5.937  10.284  -5.421
  227    H2    DA  20           2H        DA  20  -2.906  13.595  -5.677
  228    H5'   DG  21           H5'       DG  21   6.501   8.506  -5.310
  229   H5''   DG  21          H5"        DG  21   5.896   7.549  -6.674
  230    H4'   DG  21           H4'       DG  21   8.125   6.850  -5.487
  231    H3'   DG  21           H3'       DG  21   6.412   5.273  -6.977
  232    H2'   DG  21           H2'       DG  21   5.118   4.457  -5.171
  233   H2''   DG  21          H2"        DG  21   6.403   3.213  -5.217
  234    H1'   DG  21           H1'       DG  21   7.602   4.190  -3.469
  235    H8    DG  21           8H        DG  21   7.022   4.255  -0.937
  236    H1    DG  21           1H        DG  21   0.824   5.127  -2.153
  237    H21   DG  21           1H2       DG  21   0.498   5.403  -4.355
  238    H22   DG  21           2H2       DG  21   1.826   5.403  -5.492
  239    H5'   DG  22           H5'       DG  22   9.697   3.549  -4.421
  240   H5''   DG  22          H5"        DG  22  10.476   2.021  -4.876
  241    H4'   DG  22           H4'       DG  22   9.988   2.288  -2.414
  242    H3'   DG  22           H3'       DG  22   9.556  -0.069  -3.998
  243    H2'   DG  22           H2'       DG  22   7.229  -0.145  -3.614
  244   H2''   DG  22          H2"        DG  22   7.760  -0.853  -2.050
  245    H1'   DG  22           H1'       DG  22   7.737   1.245  -0.967
  246    H8    DG  22           8H        DG  22   5.362   1.845  -4.017
  247    H1    DG  22           1H        DG  22   2.544   1.355   1.751
  248    H21   DG  22           1H2       DG  22   4.082   0.918   3.248
  249    H22   DG  22           2H2       DG  22   5.775   0.725   2.888
  250    H5'   DG  23           H5'       DG  23   8.507  -1.968   0.181
  251   H5''   DG  23          H5"        DG  23   9.171  -0.363   0.548
  252    H4'   DG  23           H4'       DG  23  10.348  -1.272   2.500
  253    H3'   DG  23           H3'       DG  23  10.224  -3.791   1.373
  254    H2'   DG  23           H2'       DG  23   7.832  -3.965   1.626
  255   H2''   DG  23          H2"        DG  23   8.442  -4.799   3.094
  256    H1'   DG  23           H1'       DG  23   8.291  -2.821   4.391
  257    H8    DG  23           8H        DG  23   6.076  -3.025   5.638
  258    H1    DG  23           1H        DG  23   2.735  -2.173   0.314
  259    H21   DG  23           1H2       DG  23   4.030  -1.905  -1.434
  260    H22   DG  23           2H2       DG  23   5.761  -1.979  -1.318
  261    H5'   DG  24           H5'       DG  24   9.257  -3.815   6.228
  262   H5''   DG  24          H5"        DG  24  10.415  -5.061   6.728
  263    H4'   DG  24           H4'       DG  24   8.331  -5.236   8.007
  264    H3'   DG  24           H3'       DG  24   9.531  -7.411   6.729
  265   HO3'   DG  24          H3T        DG  24   7.333  -7.336   8.558
  266    H2'   DG  24           H2'       DG  24   7.953  -7.620   4.999
  267   H2''   DG  24          H2"        DG  24   7.133  -8.608   6.254
  268    H1'   DG  24           H1'       DG  24   5.758  -6.825   6.936
  269    H8    DG  24           8H        DG  24   7.108  -6.477   3.316
  270    H1    DG  24           1H        DG  24   0.781  -5.616   3.911
  271    H21   DG  24           1H2       DG  24   0.173  -5.886   6.073
  272    H22   DG  24           2H2       DG  24   1.342  -6.236   7.327
  Start of MODEL    2
    1    H5'   DG   1           H5'       DG   1  -4.585  -6.815  -5.458
    2   H5''   DG   1          H5"        DG   1  -4.647  -5.687  -6.824
    3    H4'   DG   1           H4'       DG   1  -6.675  -5.462  -5.497
    4    H3'   DG   1           H3'       DG   1  -5.185  -3.268  -6.246
    5    H2'   DG   1           H2'       DG   1  -4.012  -3.123  -4.170
    6   H2''   DG   1          H2"        DG   1  -5.359  -1.966  -3.898
    7    H1'   DG   1           H1'       DG   1  -6.677  -3.613  -2.811
    8    H8    DG   1           8H        DG   1  -6.422  -4.300  -0.332
    9    H1    DG   1           1H        DG   1  -0.015  -4.267  -0.677
   10    H21   DG   1           1H2       DG   1   0.616  -3.740  -2.709
   11    H22   DG   1           2H2       DG   1  -0.505  -3.327  -3.953
   12   HO5'   DG   1          H5T        DG   1  -3.412  -4.951  -4.398
   13    H5'   DG   2           H5'       DG   2  -8.940  -3.134  -3.505
   14   H5''   DG   2          H5"        DG   2  -9.953  -1.708  -3.799
   15    H4'   DG   2           H4'       DG   2 -10.019  -2.572  -1.442
   16    H3'   DG   2           H3'       DG   2  -9.918   0.120  -2.233
   17    H2'   DG   2           H2'       DG   2  -7.766   0.635  -1.470
   18   H2''   DG   2          H2"        DG   2  -8.592   0.733   0.115
   19    H1'   DG   2           H1'       DG   2  -7.897  -1.382   0.763
   20    H8    DG   2           8H        DG   2  -5.798  -0.454  -2.391
   21    H1    DG   2           1H        DG   2  -2.369  -2.305   2.636
   22    H21   DG   2           1H2       DG   2  -3.740  -2.610   4.427
   23    H22   DG   2           2H2       DG   2  -5.472  -2.423   4.316
   24    H5'   DG   3           H5'       DG   3 -11.990   1.328   3.427
   25   H5''   DG   3          H5"        DG   3 -12.436   2.304   2.010
   26    H4'   DG   3           H4'       DG   3 -10.886   3.359   3.802
   27    H3'   DG   3           H3'       DG   3 -10.834   3.660   0.900
   28    H2'   DG   3           H2'       DG   3  -8.599   3.038   0.706
   29   H2''   DG   3          H2"        DG   3  -8.292   4.667   1.388
   30    H1'   DG   3           H1'       DG   3  -8.235   3.830   3.626
   31    H8    DG   3           8H        DG   3  -6.661   1.951   4.824
   32    H1    DG   3           1H        DG   3  -3.517   1.719  -0.697
   33    H21   DG   3           1H2       DG   3  -4.802   2.492  -2.295
   34    H22   DG   3           2H2       DG   3  -6.409   3.049  -2.064
   35    H5'   DG   4           H5'       DG   4  -8.370   9.079   1.959
   36   H5''   DG   4          H5"        DG   4  -8.029   7.520   1.178
   37    H4'   DG   4           H4'       DG   4  -8.173   7.909   4.187
   38    H3'   DG   4           H3'       DG   4  -5.725   7.847   2.382
   39    H2'   DG   4           H2'       DG   4  -4.617   6.967   4.399
   40   H2''   DG   4          H2"        DG   4  -6.111   7.233   5.371
   41    H1'   DG   4           H1'       DG   4  -6.343   4.953   4.537
   42    H8    DG   4           8H        DG   4  -6.765   5.748   0.937
   43    H1    DG   4           1H        DG   4  -0.748   3.988   2.128
   44    H21   DG   4           1H2       DG   4  -0.410   3.903   4.361
   45    H22   DG   4           2H2       DG   4  -1.685   4.272   5.500
   46    H5'   DT   5           H5'       DT   5  -3.131  11.526   1.763
   47   H5''   DT   5          H5"        DT   5  -3.155  10.053   0.784
   48    H4'   DT   5           H4'       DT   5  -1.328  10.347   3.180
   49    H3'   DT   5           H3'       DT   5  -1.089  11.799   0.690
   50    H2'   DT   5           H2'       DT   5   0.552  10.632  -0.429
   51   H2''   DT   5          H2"        DT   5   1.395  10.165   1.071
   52    H1'   DT   5           H1'       DT   5   0.464   8.108   0.613
   53    H3    DT   5           3H        DT   5  -1.669   9.309  -3.704
   54    H71   DT   5           1H5       DT   5  -5.394   7.506  -1.654
   55    H72   DT   5           2H5       DT   5  -5.111   8.069   0.011
   56    H73   DT   5           3H5       DT   5  -4.611   6.431  -0.472
   57    H6    DT   5           6H        DT   5  -2.545   7.663   0.680
   58    H5'   DT   6           H5'       DT   6   3.885  11.090   3.961
   59   H5''   DT   6          H5"        DT   6   4.065   9.977   2.587
   60    H4'   DT   6           H4'       DT   6   4.420   8.957   4.898
   61    H3'   DT   6           H3'       DT   6   2.318   7.859   2.999
   62    H2'   DT   6           H2'       DT   6   1.688   6.273   4.600
   63   H2''   DT   6          H2"        DT   6   3.275   6.331   5.420
   64    H1'   DT   6           H1'       DT   6   2.363   7.814   6.882
   65    H3    DT   6           3H        DT   6  -1.813   8.880   8.112
   66    H71   DT   6           1H5       DT   6  -1.928   7.943   2.836
   67    H72   DT   6           2H5       DT   6  -3.400   8.281   3.776
   68    H73   DT   6           3H5       DT   6  -2.736   6.632   3.719
   69    H6    DT   6           6H        DT   6   0.129   7.563   3.903
   70    H5'   DG   7           H5'       DG   7   7.642   6.024   5.574
   71   H5''   DG   7          H5"        DG   7   6.422   4.903   4.937
   72    H4'   DG   7           H4'       DG   7   6.716   5.928   7.779
   73    H3'   DG   7           H3'       DG   7   7.750   3.637   6.886
   74    H2'   DG   7           H2'       DG   7   5.817   2.951   5.627
   75   H2''   DG   7          H2"        DG   7   5.629   2.007   7.135
   76    H1'   DG   7           H1'       DG   7   4.033   3.458   8.003
   77    H8    DG   7           8H        DG   7   1.574   3.761   7.219
   78    H1    DG   7           1H        DG   7   3.328   4.211   1.080
   79    H21   DG   7           1H2       DG   7   5.565   4.148   0.912
   80    H22   DG   7           2H2       DG   7   6.606   4.032   2.314
   81    H5'   DG   8           H5'       DG   8   4.216   3.126  10.067
   82   H5''   DG   8          H5"        DG   8   4.580   1.744  11.119
   83    H4'   DG   8           H4'       DG   8   2.244   1.633  10.554
   84    H3'   DG   8           H3'       DG   8   3.884  -0.365   8.964
   85    H2'   DG   8           H2'       DG   8   1.894  -1.110   7.984
   86   H2''   DG   8          H2"        DG   8   0.896  -0.592   9.378
   87    H1'   DG   8           H1'       DG   8   0.476   1.361   8.279
   88    H8    DG   8           8H        DG   8   3.702   0.685   6.279
   89    H1    DG   8           1H        DG   8  -1.774   1.443   2.865
   90    H21   DG   8           1H2       DG   8  -3.453   1.657   4.349
   91    H22   DG   8           2H2       DG   8  -3.225   1.598   6.074
   92    H5'   DG   9           H5'       DG   9   0.625  -1.086  11.733
   93   H5''   DG   9          H5"        DG   9   0.797  -2.517  12.771
   94    H4'   DG   9           H4'       DG   9  -1.560  -2.084  12.229
   95    H3'   DG   9           H3'       DG   9  -0.285  -4.606  11.837
   96    H2'   DG   9           H2'       DG   9  -0.577  -4.643   9.495
   97   H2''   DG   9          H2"        DG   9  -2.218  -5.196   9.970
   98    H1'   DG   9           H1'       DG   9  -3.103  -3.009   9.892
   99    H8    DG   9           8H        DG   9  -4.100  -2.626   7.564
  100    H1    DG   9           1H        DG   9   1.610  -2.657   4.673
  101    H21   DG   9           1H2       DG   9   3.237  -3.016   6.168
  102    H22   DG   9           2H2       DG   9   2.910  -3.221   7.877
  103    H5'   DG  10           H5'       DG  10  -4.772  -4.056  11.305
  104   H5''   DG  10          H5"        DG  10  -5.686  -5.321  12.152
  105    H4'   DG  10           H4'       DG  10  -6.848  -4.752  10.106
  106    H3'   DG  10           H3'       DG  10  -6.174  -7.387  10.689
  107    H2'   DG  10           H2'       DG  10  -4.298  -7.412   9.179
  108   H2''   DG  10          H2"        DG  10  -5.610  -8.054   8.135
  109    H1'   DG  10           H1'       DG  10  -6.118  -5.878   7.290
  110    H8    DG  10           8H        DG  10  -2.400  -6.218   8.344
  111    H1    DG  10           1H        DG  10  -3.328  -4.826   2.212
  112    H21   DG  10           1H2       DG  10  -5.564  -4.616   1.827
  113    H22   DG  10           2H2       DG  10  -6.754  -4.804   3.088
  114    H5'   DT  11           H5'       DT  11  -8.150  -9.193   5.668
  115   H5''   DT  11          H5"        DT  11  -6.622  -9.639   6.450
  116    H4'   DT  11           H4'       DT  11  -6.856  -7.445   4.373
  117    H3'   DT  11           H3'       DT  11  -7.058 -10.212   3.879
  118    H2'   DT  11           H2'       DT  11  -4.824 -10.687   4.266
  119   H2''   DT  11          H2"        DT  11  -4.658 -10.131   2.571
  120    H1'   DT  11           H1'       DT  11  -4.107  -7.951   3.248
  121    H3    DT  11           3H        DT  11   0.303  -9.084   3.962
  122    H71   DT  11           1H5       DT  11  -2.160 -10.141   8.458
  123    H72   DT  11           2H5       DT  11  -2.045  -8.367   8.549
  124    H73   DT  11           3H5       DT  11  -0.564  -9.352   8.480
  125    H6    DT  11           6H        DT  11  -3.701  -9.138   6.558
  126    H5'   DT  12           H5'       DT  12  -5.132 -10.795  -1.186
  127   H5''   DT  12          H5"        DT  12  -5.234 -11.682   0.350
  128    H4'   DT  12           H4'       DT  12  -2.894 -10.008  -0.645
  129    H3'   DT  12           H3'       DT  12  -3.413 -12.950  -0.366
  130    H2'   DT  12           H2'       DT  12  -1.573 -13.311   0.959
  131   H2''   DT  12          H2"        DT  12  -0.565 -12.248  -0.074
  132    H1'   DT  12           H1'       DT  12  -0.888 -10.461   1.343
  133    H3    DT  12           3H        DT  12   0.507 -12.247   5.300
  134    H71   DT  12           1H5       DT  12  -4.461 -11.549   5.817
  135    H72   DT  12           2H5       DT  12  -3.970 -13.180   6.327
  136    H73   DT  12           3H5       DT  12  -4.787 -12.944   4.761
  137    H6    DT  12           6H        DT  12  -3.666 -11.910   2.974
  138    H5'   DT  13           H5'       DT  13  -2.212  -8.549  -4.502
  139   H5''   DT  13          H5"        DT  13  -1.184  -9.979  -4.709
  140    H4'   DT  13           H4'       DT  13   0.247  -8.080  -4.650
  141    H3'   DT  13           H3'       DT  13   0.628 -10.114  -2.836
  142    H2'   DT  13           H2'       DT  13   0.127  -9.152  -0.789
  143   H2''   DT  13          H2"        DT  13   1.586  -8.145  -1.037
  144    H1'   DT  13           H1'       DT  13   0.322  -6.325  -1.388
  145    H3    DT  13           3H        DT  13  -2.615  -6.920   2.135
  146    H71   DT  13           1H5       DT  13  -5.214  -6.786  -2.418
  147    H72   DT  13           2H5       DT  13  -5.973  -7.525  -0.986
  148    H73   DT  13           3H5       DT  13  -5.098  -8.542  -2.156
  149    H6    DT  13           6H        DT  13  -2.690  -7.507  -2.629
  150    H5'   DT  14           H5'       DT  14   3.859  -7.315  -0.652
  151   H5''   DT  14          H5"        DT  14   4.528  -7.397  -2.295
  152    H4'   DT  14           H4'       DT  14   6.166  -7.188  -0.292
  153    H3'   DT  14           H3'       DT  14   6.641  -8.170  -2.772
  154    H2'   DT  14           H2'       DT  14   5.996 -10.431  -2.385
  155   H2''   DT  14          H2"        DT  14   7.743 -10.530  -1.989
  156    H1'   DT  14           H1'       DT  14   7.362 -10.509   0.294
  157    H3    DT  14           3H        DT  14   5.549 -14.686   0.447
  158    H71   DT  14           1H5       DT  14   1.538 -11.312   0.793
  159    H72   DT  14           2H5       DT  14   1.262 -12.950   0.155
  160    H73   DT  14           3H5       DT  14   1.565 -11.597  -0.963
  161    H6    DT  14           6H        DT  14   3.780 -10.284  -0.222
  162    H5'   DG  15           H5'       DG  15   8.031  -7.559  -4.421
  163   H5''   DG  15          H5"        DG  15   9.306  -6.323  -4.358
  164    H4'   DG  15           H4'       DG  15   7.638  -6.058  -6.246
  165    H3'   DG  15           H3'       DG  15   8.833  -4.013  -4.855
  166    H2'   DG  15           H2'       DG  15   7.058  -3.867  -3.237
  167   H2''   DG  15          H2"        DG  15   6.660  -2.553  -4.399
  168    H1'   DG  15           H1'       DG  15   5.255  -3.975  -5.666
  169    H8    DG  15           8H        DG  15   2.802  -4.131  -5.115
  170    H1    DG  15           1H        DG  15   3.827  -4.994   1.105
  171    H21   DG  15           1H2       DG  15   5.988  -5.197   1.507
  172    H22   DG  15           2H2       DG  15   7.205  -5.145   0.252
  173    H5'   DG  16           H5'       DG  16   5.125  -3.615  -7.810
  174   H5''   DG  16          H5"        DG  16   5.605  -2.300  -8.898
  175    H4'   DG  16           H4'       DG  16   3.145  -2.634  -8.795
  176    H3'   DG  16           H3'       DG  16   4.454  -0.135  -8.633
  177    H2'   DG  16           H2'       DG  16   3.837   0.387  -6.432
  178   H2''   DG  16          H2"        DG  16   2.295   0.847  -7.219
  179    H1'   DG  16           H1'       DG  16   1.269  -1.183  -6.681
  180    H8    DG  16           8H        DG  16   4.497  -1.189  -4.523
  181    H1    DG  16           1H        DG  16  -0.899  -0.853  -1.142
  182    H21   DG  16           1H2       DG  16  -2.647  -0.851  -2.444
  183    H22   DG  16           2H2       DG  16  -2.556  -0.978  -4.161
  184    H5'   DG  17           H5'       DG  17  -0.552  -0.741  -8.388
  185   H5''   DG  17          H5"        DG  17  -0.420  -0.240 -10.087
  186    H4'   DG  17           H4'       DG  17  -2.586   0.386  -9.628
  187    H3'   DG  17           H3'       DG  17  -0.771   2.591  -9.647
  188    H2'   DG  17           H2'       DG  17  -1.181   3.259  -7.427
  189   H2''   DG  17          H2"        DG  17  -2.662   3.959  -8.156
  190    H1'   DG  17           H1'       DG  17  -3.949   2.067  -7.618
  191    H8    DG  17           8H        DG  17  -5.078   2.044  -5.401
  192    H1    DG  17           1H        DG  17   0.432   2.279  -2.304
  193    H21   DG  17           1H2       DG  17   2.150   2.303  -3.732
  194    H22   DG  17           2H2       DG  17   1.865   2.374  -5.447
  195    H5'   DG  18           H5'       DG  18  -4.923   3.846 -10.422
  196   H5''   DG  18          H5"        DG  18  -5.226   5.172 -11.567
  197    H4'   DG  18           H4'       DG  18  -6.168   5.919  -9.529
  198    H3'   DG  18           H3'       DG  18  -3.416   7.044 -10.000
  199    H2'   DG  18           H2'       DG  18  -3.308   7.914  -7.874
  200   H2''   DG  18          H2"        DG  18  -5.052   8.292  -7.851
  201    H1'   DG  18           H1'       DG  18  -5.507   6.352  -6.763
  202    H8    DG  18           8H        DG  18  -1.729   5.987  -7.616
  203    H1    DG  18           1H        DG  18  -3.225   4.917  -1.501
  204    H21   DG  18           1H2       DG  18  -5.500   5.057  -1.242
  205    H22   DG  18           2H2       DG  18  -6.572   5.414  -2.575
  206    H5'   DA  19           H5'       DA  19  -2.021   8.400 -13.063
  207   H5''   DA  19          H5"        DA  19  -2.352   7.184 -11.816
  208    H4'   DA  19           H4'       DA  19  -0.025   8.186 -11.738
  209    H3'   DA  19           H3'       DA  19  -1.611   7.578  -9.539
  210    H2'   DA  19           H2"       DA  19  -2.214   9.768  -8.958
  211   H2''   DA  19          H2'        DA  19  -0.611   9.688  -8.148
  212    H1'   DA  19           H1'       DA  19   0.506  10.758  -9.876
  213    H8    DA  19           8H        DA  19  -1.867  12.137  -7.978
  214    H61   DA  19           2H6       DA  19  -3.180  16.234 -10.187
  215    H62   DA  19           1H6       DA  19  -3.005  16.845 -11.817
  216    H2    DA  19           2H        DA  19  -0.852  13.654 -14.131
  217    H5'   DA  20           H5'       DA  20   3.036   6.884  -7.699
  218   H5''   DA  20          H5"        DA  20   2.660   6.526  -6.003
  219    H4'   DA  20           H4'       DA  20   3.154   9.033  -7.048
  220    H3'   DA  20           H3'       DA  20   1.726   8.172  -4.504
  221    H2'   DA  20           H2'       DA  20   0.891  10.351  -4.202
  222   H2''   DA  20          H2"        DA  20   2.184  11.087  -5.203
  223    H1'   DA  20           H1'       DA  20   0.642  11.065  -6.893
  224    H8    DA  20           8H        DA  20  -0.896   7.699  -6.352
  225    H61   DA  20           2H6       DA  20  -5.373   9.139  -5.242
  226    H62   DA  20           1H6       DA  20  -6.103  10.696  -4.911
  227    H2    DA  20           2H        DA  20  -2.773  13.709  -5.147
  228    H5'   DG  21           H5'       DG  21   6.241   8.134  -5.943
  229   H5''   DG  21          H5"        DG  21   5.548   7.034  -7.147
  230    H4'   DG  21           H4'       DG  21   7.897   6.525  -6.034
  231    H3'   DG  21           H3'       DG  21   6.227   4.805  -7.380
  232    H2'   DG  21           H2'       DG  21   4.946   4.127  -5.496
  233   H2''   DG  21          H2"        DG  21   6.221   2.870  -5.497
  234    H1'   DG  21           H1'       DG  21   7.470   3.943  -3.840
  235    H8    DG  21           8H        DG  21   6.955   4.118  -1.304
  236    H1    DG  21           1H        DG  21   0.727   5.002  -2.385
  237    H21   DG  21           1H2       DG  21   0.342   5.234  -4.580
  238    H22   DG  21           2H2       DG  21   1.630   5.196  -5.760
  239    H5'   DG  22           H5'       DG  22   9.560   3.307  -4.682
  240   H5''   DG  22          H5"        DG  22  10.340   1.753  -5.044
  241    H4'   DG  22           H4'       DG  22   9.864   2.186  -2.598
  242    H3'   DG  22           H3'       DG  22   9.405  -0.274  -4.036
  243    H2'   DG  22           H2'       DG  22   7.119  -0.398  -3.522
  244   H2''   DG  22          H2"        DG  22   7.729  -0.916  -1.915
  245    H1'   DG  22           H1'       DG  22   7.643   1.267  -1.049
  246    H8    DG  22           8H        DG  22   5.258   1.653  -4.122
  247    H1    DG  22           1H        DG  22   2.440   1.331   1.657
  248    H21   DG  22           1H2       DG  22   3.982   0.954   3.168
  249    H22   DG  22           2H2       DG  22   5.678   0.760   2.813
  250    H5'   DG  23           H5'       DG  23   8.437  -2.088   0.214
  251   H5''   DG  23          H5"        DG  23   8.942  -0.397   0.396
  252    H4'   DG  23           H4'       DG  23  10.188  -0.980   2.439
  253    H3'   DG  23           H3'       DG  23  10.203  -3.626   1.612
  254    H2'   DG  23           H2'       DG  23   7.854  -3.959   1.982
  255   H2''   DG  23          H2"        DG  23   8.552  -4.500   3.546
  256    H1'   DG  23           H1'       DG  23   8.232  -2.376   4.532
  257    H8    DG  23           8H        DG  23   6.032  -2.763   5.785
  258    H1    DG  23           1H        DG  23   2.662  -2.180   0.431
  259    H21   DG  23           1H2       DG  23   3.958  -1.953  -1.318
  260    H22   DG  23           2H2       DG  23   5.684  -1.958  -1.197
  261    H5'   DG  24           H5'       DG  24  10.383  -6.372   6.265
  262   H5''   DG  24          H5"        DG  24   9.017  -6.495   5.140
  263    H4'   DG  24           H4'       DG  24   8.927  -5.195   7.888
  264    H3'   DG  24           H3'       DG  24   8.921  -7.886   7.527
  265   HO3'   DG  24          H3T        DG  24   7.114  -6.382   9.161
  266    H2'   DG  24           H2'       DG  24   7.195  -7.968   5.906
  267   H2''   DG  24          H2"        DG  24   6.249  -8.228   7.411
  268    H1'   DG  24           H1'       DG  24   5.542  -6.010   7.506
  269    H8    DG  24           8H        DG  24   7.056  -6.034   3.926
  270    H1    DG  24           1H        DG  24   0.661  -5.555   4.208
  271    H21   DG  24           1H2       DG  24  -0.015  -5.801   6.353
  272    H22   DG  24           2H2       DG  24   1.115  -6.053   7.661
  Start of MODEL    3
    1    H5'   DG   1           H5'       DG   1  -5.205  -6.143  -6.739
    2   H5''   DG   1          H5"        DG   1  -4.054  -5.792  -5.436
    3    H4'   DG   1           H4'       DG   1  -7.043  -5.306  -5.384
    4    H3'   DG   1           H3'       DG   1  -5.009  -3.611  -6.309
    5    H2'   DG   1           H2'       DG   1  -3.983  -3.222  -4.250
    6   H2''   DG   1          H2"        DG   1  -5.267  -1.975  -4.131
    7    H1'   DG   1           H1'       DG   1  -6.655  -3.365  -2.845
    8    H8    DG   1           8H        DG   1  -6.433  -4.225  -0.395
    9    H1    DG   1           1H        DG   1  -0.021  -4.370  -0.796
   10    H21   DG   1           1H2       DG   1   0.604  -3.813  -2.820
   11    H22   DG   1           2H2       DG   1  -0.522  -3.333  -4.038
   12   HO5'   DG   1          H5T        DG   1  -5.442  -7.265  -4.154
   13    H5'   DG   2           H5'       DG   2  -9.548  -3.887  -2.466
   14   H5''   DG   2          H5"        DG   2 -10.272  -2.539  -3.366
   15    H4'   DG   2           H4'       DG   2 -10.032  -2.163  -0.874
   16    H3'   DG   2           H3'       DG   2  -8.887  -0.299  -2.930
   17    H2'   DG   2           H2'       DG   2  -7.533   0.787  -1.408
   18   H2''   DG   2          H2"        DG   2  -8.782   0.695  -0.136
   19    H1'   DG   2           H1'       DG   2  -7.797  -1.135   0.774
   20    H8    DG   2           8H        DG   2  -5.731  -0.460  -2.462
   21    H1    DG   2           1H        DG   2  -2.303  -2.319   2.581
   22    H21   DG   2           1H2       DG   2  -3.675  -2.592   4.367
   23    H22   DG   2           2H2       DG   2  -5.403  -2.373   4.260
   24    H5'   DG   3           H5'       DG   3 -11.304   1.018   0.863
   25   H5''   DG   3          H5"        DG   3 -12.189   2.507   0.472
   26    H4'   DG   3           H4'       DG   3 -11.308   2.784   2.679
   27    H3'   DG   3           H3'       DG   3 -10.474   4.544   0.602
   28    H2'   DG   3           H2"       DG   3  -8.220   3.835   0.640
   29   H2''   DG   3          H2'        DG   3  -8.176   5.023   1.977
   30    H1'   DG   3           H1'       DG   3  -8.603   3.392   3.616
   31    H8    DG   3           8H        DG   3  -6.759   1.885   4.683
   32    H1    DG   3           1H        DG   3  -3.495   1.722  -0.765
   33    H21   DG   3           1H2       DG   3  -4.751   2.461  -2.404
   34    H22   DG   3           2H2       DG   3  -6.368   3.007  -2.214
   35    H5'   DG   4           H5'       DG   4  -8.744   8.893   2.219
   36   H5''   DG   4          H5"        DG   4  -7.437   8.094   1.322
   37    H4'   DG   4           H4'       DG   4  -8.046   8.051   4.233
   38    H3'   DG   4           H3'       DG   4  -5.544   7.887   2.548
   39    H2'   DG   4           H2'       DG   4  -4.463   6.992   4.554
   40   H2''   DG   4          H2"        DG   4  -5.930   7.328   5.547
   41    H1'   DG   4           H1'       DG   4  -6.235   5.032   4.792
   42    H8    DG   4           8H        DG   4  -6.741   5.609   1.197
   43    H1    DG   4           1H        DG   4  -0.694   3.952   2.344
   44    H21   DG   4           1H2       DG   4  -0.315   3.963   4.571
   45    H22   DG   4           2H2       DG   4  -1.570   4.382   5.715
   46    H5'   DT   5           H5'       DT   5  -3.183  11.532   1.655
   47   H5''   DT   5          H5"        DT   5  -3.217  10.029   0.720
   48    H4'   DT   5           H4'       DT   5  -1.287  10.470   3.005
   49    H3'   DT   5           H3'       DT   5  -1.209  11.807   0.453
   50    H2'   DT   5           H2'       DT   5   0.300  10.580  -0.768
   51   H2''   DT   5          H2"        DT   5   1.305  10.230   0.666
   52    H1'   DT   5           H1'       DT   5   0.377   8.110   0.438
   53    H3    DT   5           3H        DT   5  -2.146   9.063  -3.733
   54    H71   DT   5           1H5       DT   5  -5.672   7.395  -1.281
   55    H72   DT   5           2H5       DT   5  -5.224   7.970   0.343
   56    H73   DT   5           3H5       DT   5  -4.780   6.329  -0.175
   57    H6    DT   5           6H        DT   5  -2.614   7.611   0.786
   58    H5'   DT   6           H5'       DT   6   3.275  10.758   2.633
   59   H5''   DT   6          H5"        DT   6   2.927   9.247   1.763
   60    H4'   DT   6           H4'       DT   6   4.486   9.144   3.831
   61    H3'   DT   6           H3'       DT   6   2.342   7.284   3.033
   62    H2'   DT   6           H2'       DT   6   1.795   6.421   5.112
   63   H2''   DT   6          H2"        DT   6   3.449   6.662   5.738
   64    H1'   DT   6           H1'       DT   6   2.547   8.452   6.820
   65    H3    DT   6           3H        DT   6  -1.440  10.431   7.427
   66    H71   DT   6           1H5       DT   6  -3.261   8.282   3.774
   67    H72   DT   6           2H5       DT   6  -2.457   6.724   4.076
   68    H73   DT   6           3H5       DT   6  -1.835   7.817   2.818
   69    H6    DT   6           6H        DT   6   0.310   7.516   4.013
   70    H5'   DG   7           H5'       DG   7   6.258   7.391   6.909
   71   H5''   DG   7          H5"        DG   7   7.566   6.310   6.380
   72    H4'   DG   7           H4'       DG   7   6.409   5.869   8.701
   73    H3'   DG   7           H3'       DG   7   7.855   4.142   7.226
   74    H2'   DG   7           H2'       DG   7   6.104   3.571   5.700
   75   H2''   DG   7          H2"        DG   7   6.009   2.217   6.865
   76    H1'   DG   7           H1'       DG   7   4.220   3.160   8.021
   77    H8    DG   7           8H        DG   7   1.717   3.837   7.384
   78    H1    DG   7           1H        DG   7   3.346   4.297   1.213
   79    H21   DG   7           1H2       DG   7   5.575   4.166   0.981
   80    H22   DG   7           2H2       DG   7   6.650   4.002   2.354
   81    H5'   DG   8           H5'       DG   8   4.267   2.974  10.120
   82   H5''   DG   8          H5"        DG   8   4.673   1.476  10.979
   83    H4'   DG   8           H4'       DG   8   2.269   1.582  10.594
   84    H3'   DG   8           H3'       DG   8   3.707  -0.467   8.881
   85    H2'   DG   8           H2'       DG   8   1.620  -1.096   8.007
   86   H2''   DG   8          H2"        DG   8   0.730  -0.506   9.446
   87    H1'   DG   8           H1'       DG   8   0.375   1.446   8.309
   88    H8    DG   8           8H        DG   8   3.605   0.753   6.346
   89    H1    DG   8           1H        DG   8  -1.823   1.446   2.845
   90    H21   DG   8           1H2       DG   8  -3.539   1.629   4.293
   91    H22   DG   8           2H2       DG   8  -3.340   1.570   6.024
   92    H5'   DG   9           H5'       DG   9   0.579  -1.205  11.761
   93   H5''   DG   9          H5"        DG   9   0.734  -2.667  12.758
   94    H4'   DG   9           H4'       DG   9  -1.620  -2.172  12.224
   95    H3'   DG   9           H3'       DG   9  -0.389  -4.709  11.811
   96    H2'   DG   9           H2'       DG   9  -0.657  -4.713   9.464
   97   H2''   DG   9          H2"        DG   9  -2.310  -5.247   9.916
   98    H1'   DG   9           H1'       DG   9  -3.164  -3.049   9.847
   99    H8    DG   9           8H        DG   9  -4.114  -2.628   7.502
  100    H1    DG   9           1H        DG   9   1.636  -2.696   4.711
  101    H21   DG   9           1H2       DG   9   3.233  -3.081   6.222
  102    H22   DG   9           2H2       DG   9   2.882  -3.291   7.926
  103    H5'   DG  10           H5'       DG  10  -4.851  -4.086  11.249
  104   H5''   DG  10          H5"        DG  10  -5.809  -5.347  12.054
  105    H4'   DG  10           H4'       DG  10  -6.906  -4.712   9.987
  106    H3'   DG  10           H3'       DG  10  -6.324  -7.372  10.560
  107    H2'   DG  10           H2'       DG  10  -4.412  -7.426   9.098
  108   H2''   DG  10          H2"        DG  10  -5.713  -8.033   8.018
  109    H1'   DG  10           H1'       DG  10  -6.162  -5.830   7.191
  110    H8    DG  10           8H        DG  10  -2.450  -6.272   8.267
  111    H1    DG  10           1H        DG  10  -3.330  -4.803   2.147
  112    H21   DG  10           1H2       DG  10  -5.565  -4.558   1.755
  113    H22   DG  10           2H2       DG  10  -6.759  -4.753   3.010
  114    H5'   DT  11           H5'       DT  11  -8.348  -8.978   5.414
  115   H5''   DT  11          H5"        DT  11  -6.943  -9.649   6.264
  116    H4'   DT  11           H4'       DT  11  -6.829  -7.437   4.189
  117    H3'   DT  11           H3'       DT  11  -7.061 -10.235   3.773
  118    H2'   DT  11           H2'       DT  11  -4.865 -10.729   4.281
  119   H2''   DT  11          H2"        DT  11  -4.576 -10.164   2.605
  120    H1'   DT  11           H1'       DT  11  -4.048  -7.998   3.331
  121    H3    DT  11           3H        DT  11   0.279  -9.179   4.355
  122    H71   DT  11           1H5       DT  11  -2.512 -10.274   8.646
  123    H72   DT  11           2H5       DT  11  -2.356  -8.505   8.780
  124    H73   DT  11           3H5       DT  11  -0.900  -9.532   8.787
  125    H6    DT  11           6H        DT  11  -3.902  -9.230   6.662
  126    H5'   DT  12           H5'       DT  12  -4.710 -10.696  -1.282
  127   H5''   DT  12          H5"        DT  12  -4.978 -11.704   0.156
  128    H4'   DT  12           H4'       DT  12  -2.538 -10.004  -0.481
  129    H3'   DT  12           H3'       DT  12  -3.095 -12.942  -0.332
  130    H2'   DT  12           H2'       DT  12  -1.415 -13.334   1.192
  131   H2''   DT  12          H2"        DT  12  -0.291 -12.277   0.280
  132    H1'   DT  12           H1'       DT  12  -0.765 -10.473   1.632
  133    H3    DT  12           3H        DT  12   0.324 -12.296   5.689
  134    H71   DT  12           1H5       DT  12  -4.230 -13.271   6.309
  135    H72   DT  12           2H5       DT  12  -4.915 -12.954   4.696
  136    H73   DT  12           3H5       DT  12  -4.656 -11.613   5.838
  137    H6    DT  12           6H        DT  12  -3.648 -11.941   3.037
  138    H5'   DT  13           H5'       DT  13  -2.238  -9.429  -2.516
  139   H5''   DT  13          H5"        DT  13  -2.145  -8.923  -4.214
  140    H4'   DT  13           H4'       DT  13   0.304  -9.018  -4.125
  141    H3'   DT  13           H3'       DT  13  -0.069 -10.509  -1.692
  142    H2'   DT  13           H2'       DT  13   0.500  -9.007  -0.030
  143   H2''   DT  13          H2"        DT  13   1.839  -8.340  -1.000
  144    H1'   DT  13           H1'       DT  13   0.511  -6.539  -1.252
  145    H3    DT  13           3H        DT  13  -2.467  -6.970   2.344
  146    H71   DT  13           1H5       DT  13  -4.983  -8.532  -1.927
  147    H72   DT  13           2H5       DT  13  -5.041  -6.776  -2.218
  148    H73   DT  13           3H5       DT  13  -5.819  -7.466  -0.774
  149    H6    DT  13           6H        DT  13  -2.525  -7.548  -2.419
  150    H5'   DT  14           H5'       DT  14   3.858  -7.550  -0.332
  151   H5''   DT  14          H5"        DT  14   4.293  -7.173  -2.011
  152    H4'   DT  14           H4'       DT  14   6.275  -7.070  -0.642
  153    H3'   DT  14           H3'       DT  14   6.270  -8.485  -2.944
  154    H2'   DT  14           H2'       DT  14   5.705 -10.617  -2.015
  155   H2''   DT  14          H2"        DT  14   7.498 -10.710  -1.978
  156    H1'   DT  14           H1'       DT  14   7.609 -10.214   0.291
  157    H3    DT  14           3H        DT  14   5.990 -13.715   2.582
  158    H71   DT  14           1H5       DT  14   1.741 -11.089   1.037
  159    H72   DT  14           2H5       DT  14   1.631 -12.850   1.271
  160    H73   DT  14           3H5       DT  14   1.909 -12.182  -0.356
  161    H6    DT  14           6H        DT  14   3.980 -10.502  -0.349
  162    H5'   DG  15           H5'       DG  15   7.395  -7.604  -5.234
  163   H5''   DG  15          H5"        DG  15   8.885  -6.673  -4.969
  164    H4'   DG  15           H4'       DG  15   7.430  -5.749  -6.790
  165    H3'   DG  15           H3'       DG  15   8.802  -4.259  -4.948
  166    H2'   DG  15           H2'       DG  15   7.043  -4.075  -3.393
  167   H2''   DG  15          H2"        DG  15   6.853  -2.553  -4.329
  168    H1'   DG  15           H1'       DG  15   5.214  -3.483  -5.731
  169    H8    DG  15           8H        DG  15   2.750  -4.105  -5.278
  170    H1    DG  15           1H        DG  15   3.885  -5.108   0.904
  171    H21   DG  15           1H2       DG  15   6.058  -5.202   1.275
  172    H22   DG  15           2H2       DG  15   7.254  -5.056   0.010
  173    H5'   DG  16           H5'       DG  16   4.146  -4.567  -8.086
  174   H5''   DG  16          H5"        DG  16   4.728  -3.485  -9.365
  175    H4'   DG  16           H4'       DG  16   2.363  -3.063  -8.742
  176    H3'   DG  16           H3'       DG  16   4.388  -1.018  -8.910
  177    H2'   DG  16           H2'       DG  16   4.075  -0.202  -6.736
  178   H2''   DG  16          H2"        DG  16   2.588   0.518  -7.438
  179    H1'   DG  16           H1'       DG  16   1.244  -1.274  -6.737
  180    H8    DG  16           8H        DG  16   4.540  -1.269  -4.654
  181    H1    DG  16           1H        DG  16  -0.835  -0.840  -1.222
  182    H21   DG  16           1H2       DG  16  -2.587  -0.941  -2.525
  183    H22   DG  16           2H2       DG  16  -2.494  -1.152  -4.233
  184    H5'   DG  17           H5'       DG  17   0.546   1.206  -7.955
  185   H5''   DG  17          H5"        DG  17   0.180  -0.371  -8.682
  186    H4'   DG  17           H4'       DG  17  -1.823   0.492  -9.712
  187    H3'   DG  17           H3'       DG  17  -0.665   3.035  -9.657
  188    H2'   DG  17           H2'       DG  17  -1.127   3.460  -7.358
  189   H2''   DG  17          H2"        DG  17  -2.656   4.040  -8.095
  190    H1'   DG  17           H1'       DG  17  -3.747   1.994  -7.694
  191    H8    DG  17           8H        DG  17  -4.946   1.928  -5.493
  192    H1    DG  17           1H        DG  17   0.477   2.332  -2.267
  193    H21   DG  17           1H2       DG  17   2.219   2.392  -3.642
  194    H22   DG  17           2H2       DG  17   1.982   2.481  -5.360
  195    H5'   DG  18           H5'       DG  18  -5.063   3.872 -10.252
  196   H5''   DG  18          H5"        DG  18  -5.335   5.258 -11.329
  197    H4'   DG  18           H4'       DG  18  -6.292   5.829  -9.207
  198    H3'   DG  18           H3'       DG  18  -3.660   7.158  -9.802
  199    H2'   DG  18           H2'       DG  18  -3.420   7.901  -7.646
  200   H2''   DG  18          H2"        DG  18  -5.165   8.250  -7.496
  201    H1'   DG  18           H1'       DG  18  -5.549   6.249  -6.493
  202    H8    DG  18           8H        DG  18  -1.774   6.040  -7.453
  203    H1    DG  18           1H        DG  18  -3.140   4.829  -1.304
  204    H21   DG  18           1H2       DG  18  -5.417   4.942  -1.019
  205    H22   DG  18           2H2       DG  18  -6.507   5.301  -2.334
  206    H5'   DA  19           H5'       DA  19  -2.575   8.743 -12.688
  207   H5''   DA  19          H5"        DA  19  -2.650   7.457 -11.469
  208    H4'   DA  19           H4'       DA  19  -0.397   8.517 -11.666
  209    H3'   DA  19           H3'       DA  19  -1.685   7.940  -9.240
  210    H2'   DA  19           H2"       DA  19  -2.063  10.177  -8.606
  211   H2''   DA  19          H2'        DA  19  -0.346  10.016  -8.071
  212    H1'   DA  19           H1'       DA  19   0.511  10.943 -10.032
  213    H8    DA  19           8H        DA  19  -1.105  12.513  -7.668
  214    H61   DA  19           2H6       DA  19  -2.661  16.720  -9.501
  215    H62   DA  19           1H6       DA  19  -2.906  17.317 -11.127
  216    H2    DA  19           2H        DA  19  -1.754  13.962 -13.885
  217    H5'   DA  20           H5'       DA  20   2.729   5.939  -6.625
  218   H5''   DA  20          H5"        DA  20   0.982   6.254  -6.713
  219    H4'   DA  20           H4'       DA  20   3.166   8.354  -6.934
  220    H3'   DA  20           H3'       DA  20   1.287   7.618  -4.649
  221    H2'   DA  20           H2'       DA  20   1.187   9.919  -4.074
  222   H2''   DA  20          H2"        DA  20   2.640  10.323  -5.042
  223    H1'   DA  20           H1'       DA  20   1.104  10.852  -6.672
  224    H8    DA  20           8H        DA  20  -0.988   7.762  -6.248
  225    H61   DA  20           2H6       DA  20  -5.180   9.894  -5.110
  226    H62   DA  20           1H6       DA  20  -5.644  11.546  -4.766
  227    H2    DA  20           2H        DA  20  -1.871  13.980  -5.011
  228    H5'   DG  21           H5'       DG  21   6.980   7.898  -6.392
  229   H5''   DG  21          H5"        DG  21   6.349   6.907  -7.722
  230    H4'   DG  21           H4'       DG  21   8.112   5.859  -6.162
  231    H3'   DG  21           H3'       DG  21   5.726   4.629  -7.309
  232    H2'   DG  21           H2'       DG  21   4.922   3.685  -5.384
  233   H2''   DG  21          H2"        DG  21   6.383   2.648  -5.410
  234    H1'   DG  21           H1'       DG  21   7.534   4.002  -3.923
  235    H8    DG  21           8H        DG  21   7.057   4.094  -1.394
  236    H1    DG  21           1H        DG  21   0.812   5.117  -2.264
  237    H21   DG  21           1H2       DG  21   0.363   5.298  -4.449
  238    H22   DG  21           2H2       DG  21   1.606   5.174  -5.668
  239    H5'   DG  22           H5'       DG  22  10.196   1.475  -5.236
  240   H5''   DG  22          H5"        DG  22   8.478   1.138  -5.531
  241    H4'   DG  22           H4'       DG  22   9.819   1.785  -2.891
  242    H3'   DG  22           H3'       DG  22   8.829  -0.689  -4.138
  243    H2'   DG  22           H2'       DG  22   6.878  -0.818  -2.946
  244   H2''   DG  22          H2"        DG  22   7.871  -0.917  -1.460
  245    H1'   DG  22           H1'       DG  22   7.665   1.350  -1.024
  246    H8    DG  22           8H        DG  22   5.266   1.578  -4.043
  247    H1    DG  22           1H        DG  22   2.424   1.399   1.725
  248    H21   DG  22           1H2       DG  22   3.948   1.004   3.247
  249    H22   DG  22           2H2       DG  22   5.638   0.764   2.906
  250    H5'   DG  23           H5'       DG  23   8.125  -1.369   0.467
  251   H5''   DG  23          H5"        DG  23   8.771   0.214   0.946
  252    H4'   DG  23           H4'       DG  23  10.072  -0.816   2.732
  253    H3'   DG  23           H3'       DG  23  10.035  -3.205   1.359
  254    H2'   DG  23           H2'       DG  23   7.695  -3.612   1.705
  255   H2''   DG  23          H2"        DG  23   8.427  -4.503   3.082
  256    H1'   DG  23           H1'       DG  23   8.119  -2.689   4.551
  257    H8    DG  23           8H        DG  23   5.901  -2.839   5.801
  258    H1    DG  23           1H        DG  23   2.571  -2.198   0.433
  259    H21   DG  23           1H2       DG  23   3.877  -1.978  -1.319
  260    H22   DG  23           2H2       DG  23   5.608  -2.009  -1.189
  261    H5'   DG  24           H5'       DG  24  10.415  -6.517   5.940
  262   H5''   DG  24          H5"        DG  24   9.020  -6.741   4.866
  263    H4'   DG  24           H4'       DG  24   8.998  -5.438   7.613
  264    H3'   DG  24           H3'       DG  24   8.919  -8.115   7.189
  265   HO3'   DG  24          H3T        DG  24   8.577  -6.859   9.207
  266    H2'   DG  24           H2'       DG  24   7.158  -8.127   5.608
  267   H2''   DG  24          H2"        DG  24   6.234  -8.388   7.127
  268    H1'   DG  24           H1'       DG  24   5.569  -6.165   7.260
  269    H8    DG  24           8H        DG  24   7.077  -6.137   3.676
  270    H1    DG  24           1H        DG  24   0.690  -5.561   3.991
  271    H21   DG  24           1H2       DG  24   0.008  -5.832   6.131
  272    H22   DG  24           2H2       DG  24   1.140  -6.128   7.433
  Start of MODEL    4
    1    H5'   DG   1           H5'       DG   1  -4.626  -6.806  -5.390
    2   H5''   DG   1          H5"        DG   1  -4.693  -5.694  -6.770
    3    H4'   DG   1           H4'       DG   1  -6.676  -5.383  -5.405
    4    H3'   DG   1           H3'       DG   1  -5.122  -3.245  -6.184
    5    H2'   DG   1           H2'       DG   1  -3.908  -3.139  -4.131
    6   H2''   DG   1          H2"        DG   1  -5.208  -1.937  -3.832
    7    H1'   DG   1           H1'       DG   1  -6.546  -3.535  -2.703
    8    H8    DG   1           8H        DG   1  -6.242  -4.326  -0.256
    9    H1    DG   1           1H        DG   1   0.144  -4.325  -0.752
   10    H21   DG   1           1H2       DG   1   0.748  -3.750  -2.773
   11    H22   DG   1           2H2       DG   1  -0.393  -3.270  -3.970
   12   HO5'   DG   1          H5T        DG   1  -3.370  -4.966  -4.387
   13    H5'   DG   2           H5'       DG   2  -8.855  -3.022  -3.503
   14   H5''   DG   2          H5"        DG   2  -9.858  -1.579  -3.745
   15    H4'   DG   2           H4'       DG   2  -9.931  -2.537  -1.422
   16    H3'   DG   2           H3'       DG   2  -9.847   0.179  -2.109
   17    H2'   DG   2           H2'       DG   2  -7.680   0.668  -1.358
   18   H2''   DG   2          H2"        DG   2  -8.496   0.727   0.236
   19    H1'   DG   2           H1'       DG   2  -7.796  -1.405   0.822
   20    H8    DG   2           8H        DG   2  -5.721  -0.440  -2.334
   21    H1    DG   2           1H        DG   2  -2.254  -2.297   2.653
   22    H21   DG   2           1H2       DG   2  -3.613  -2.606   4.454
   23    H22   DG   2           2H2       DG   2  -5.344  -2.411   4.360
   24    H5'   DG   3           H5'       DG   3 -11.965   1.292   3.562
   25   H5''   DG   3          H5"        DG   3 -12.421   2.250   2.136
   26    H4'   DG   3           H4'       DG   3 -10.820   3.306   3.889
   27    H3'   DG   3           H3'       DG   3 -10.808   3.556   0.972
   28    H2'   DG   3           H2'       DG   3  -8.567   2.973   0.766
   29   H2''   DG   3          H2"        DG   3  -8.274   4.599   1.459
   30    H1'   DG   3           H1'       DG   3  -8.200   3.753   3.687
   31    H8    DG   3           8H        DG   3  -6.646   1.834   4.869
   32    H1    DG   3           1H        DG   3  -3.434   1.766  -0.616
   33    H21   DG   3           1H2       DG   3  -4.699   2.566  -2.221
   34    H22   DG   3           2H2       DG   3  -6.317   3.103  -1.996
   35    H5'   DG   4           H5'       DG   4  -8.465   9.064   1.954
   36   H5''   DG   4          H5"        DG   4  -8.068   7.509   1.194
   37    H4'   DG   4           H4'       DG   4  -8.225   7.950   4.193
   38    H3'   DG   4           H3'       DG   4  -5.778   7.881   2.391
   39    H2'   DG   4           H2'       DG   4  -4.660   7.054   4.423
   40   H2''   DG   4          H2"        DG   4  -6.155   7.325   5.394
   41    H1'   DG   4           H1'       DG   4  -6.366   5.024   4.612
   42    H8    DG   4           8H        DG   4  -6.801   5.760   0.992
   43    H1    DG   4           1H        DG   4  -0.796   4.009   2.233
   44    H21   DG   4           1H2       DG   4  -0.462   3.943   4.462
   45    H22   DG   4           2H2       DG   4  -1.736   4.331   5.596
   46    H5'   DT   5           H5'       DT   5  -3.382  11.680   1.656
   47   H5''   DT   5          H5"        DT   5  -3.331  10.217   0.662
   48    H4'   DT   5           H4'       DT   5  -1.527  10.609   3.056
   49    H3'   DT   5           H3'       DT   5  -1.356  12.056   0.569
   50    H2'   DT   5           H2'       DT   5   0.238  10.914  -0.629
   51   H2''   DT   5          H2"        DT   5   1.185  10.534   0.837
   52    H1'   DT   5           H1'       DT   5   0.332   8.402   0.495
   53    H3    DT   5           3H        DT   5  -1.948   9.379  -3.796
   54    H71   DT   5           1H5       DT   5  -5.278   8.183   0.035
   55    H72   DT   5           2H5       DT   5  -4.748   6.542  -0.396
   56    H73   DT   5           3H5       DT   5  -5.582   7.553  -1.601
   57    H6    DT   5           6H        DT   5  -2.677   7.844   0.666
   58    H5'   DT   6           H5'       DT   6   3.046  11.010   2.932
   59   H5''   DT   6          H5"        DT   6   2.772   9.548   1.957
   60    H4'   DT   6           H4'       DT   6   4.237   9.341   4.078
   61    H3'   DT   6           H3'       DT   6   2.141   7.507   3.100
   62    H2'   DT   6           H2'       DT   6   1.552   6.512   5.113
   63   H2''   DT   6          H2"        DT   6   3.177   6.760   5.807
   64    H1'   DT   6           H1'       DT   6   2.183   8.468   6.947
   65    H3    DT   6           3H        DT   6  -1.860  10.378   7.445
   66    H71   DT   6           1H5       DT   6  -2.659   6.784   3.906
   67    H72   DT   6           2H5       DT   6  -2.006   7.944   2.725
   68    H73   DT   6           3H5       DT   6  -3.482   8.337   3.638
   69    H6    DT   6           6H        DT   6   0.093   7.622   4.011
   70    H5'   DG   7           H5'       DG   7   5.789   7.632   7.113
   71   H5''   DG   7          H5"        DG   7   7.208   6.688   6.610
   72    H4'   DG   7           H4'       DG   7   6.062   6.082   8.876
   73    H3'   DG   7           H3'       DG   7   7.619   4.496   7.349
   74    H2'   DG   7           H2'       DG   7   5.925   3.790   5.834
   75   H2''   DG   7          H2"        DG   7   5.896   2.443   7.007
   76    H1'   DG   7           H1'       DG   7   4.022   3.264   8.112
   77    H8    DG   7           8H        DG   7   1.504   3.874   7.432
   78    H1    DG   7           1H        DG   7   3.252   4.496   1.306
   79    H21   DG   7           1H2       DG   7   5.490   4.418   1.124
   80    H22   DG   7           2H2       DG   7   6.538   4.257   2.517
   81    H5'   DG   8           H5'       DG   8   4.313   2.984  10.243
   82   H5''   DG   8          H5"        DG   8   4.753   1.486  11.084
   83    H4'   DG   8           H4'       DG   8   2.356   1.513  10.647
   84    H3'   DG   8           H3'       DG   8   3.901  -0.449   8.924
   85    H2'   DG   8           H2'       DG   8   1.856  -1.130   8.000
   86   H2''   DG   8          H2"        DG   8   0.920  -0.610   9.436
   87    H1'   DG   8           H1'       DG   8   0.515   1.362   8.358
   88    H8    DG   8           8H        DG   8   3.755   0.801   6.358
   89    H1    DG   8           1H        DG   8  -1.729   1.461   2.942
   90    H21   DG   8           1H2       DG   8  -3.424   1.589   4.420
   91    H22   DG   8           2H2       DG   8  -3.200   1.494   6.146
   92    H5'   DG   9           H5'       DG   9   0.821  -1.266  11.821
   93   H5''   DG   9          H5"        DG   9   0.932  -2.753  12.785
   94    H4'   DG   9           H4'       DG   9  -1.408  -2.147  12.254
   95    H3'   DG   9           H3'       DG   9  -0.278  -4.735  11.858
   96    H2'   DG   9           H2'       DG   9  -0.540  -4.732   9.509
   97   H2''   DG   9          H2"        DG   9  -2.213  -5.205   9.967
   98    H1'   DG   9           H1'       DG   9  -2.982  -2.978   9.911
   99    H8    DG   9           8H        DG   9  -3.976  -2.603   7.587
  100    H1    DG   9           1H        DG   9   1.715  -2.640   4.659
  101    H21   DG   9           1H2       DG   9   3.351  -3.021   6.134
  102    H22   DG   9           2H2       DG   9   3.040  -3.239   7.845
  103    H5'   DG  10           H5'       DG  10  -4.934  -4.314  11.497
  104   H5''   DG  10          H5"        DG  10  -5.755  -5.768  12.103
  105    H4'   DG  10           H4'       DG  10  -6.745  -4.999   9.983
  106    H3'   DG  10           H3'       DG  10  -6.035  -7.664  10.460
  107    H2'   DG  10           H2'       DG  10  -4.027  -7.498   9.135
  108   H2''   DG  10          H2"        DG  10  -5.222  -8.113   7.942
  109    H1'   DG  10           H1'       DG  10  -5.811  -5.887   7.275
  110    H8    DG  10           8H        DG  10  -2.075  -6.148   8.372
  111    H1    DG  10           1H        DG  10  -3.094  -4.796   2.226
  112    H21   DG  10           1H2       DG  10  -5.340  -4.599   1.877
  113    H22   DG  10           2H2       DG  10  -6.506  -4.793   3.159
  114    H5'   DT  11           H5'       DT  11  -7.081  -6.597   6.092
  115   H5''   DT  11          H5"        DT  11  -8.239  -7.762   5.432
  116    H4'   DT  11           H4'       DT  11  -6.422  -7.066   3.835
  117    H3'   DT  11           H3'       DT  11  -7.137  -9.848   4.420
  118    H2'   DT  11           H2'       DT  11  -4.990 -10.560   4.439
  119   H2''   DT  11          H2"        DT  11  -4.936 -10.146   2.708
  120    H1'   DT  11           H1'       DT  11  -4.055  -8.072   3.102
  121    H3    DT  11           3H        DT  11   0.226  -9.695   3.821
  122    H71   DT  11           1H5       DT  11  -0.598  -9.907   8.345
  123    H72   DT  11           2H5       DT  11  -2.297 -10.442   8.337
  124    H73   DT  11           3H5       DT  11  -1.907  -8.709   8.476
  125    H6    DT  11           6H        DT  11  -3.700  -9.144   6.463
  126    H5'   DT  12           H5'       DT  12  -5.294  -9.102   1.171
  127   H5''   DT  12          H5"        DT  12  -5.826  -9.669  -0.387
  128    H4'   DT  12           H4'       DT  12  -3.443  -9.941  -0.332
  129    H3'   DT  12           H3'       DT  12  -4.990 -12.479  -0.129
  130    H2'   DT  12           H2'       DT  12  -3.368 -13.609   1.032
  131   H2''   DT  12          H2"        DT  12  -2.129 -13.083  -0.148
  132    H1'   DT  12           H1'       DT  12  -1.489 -11.292   1.206
  133    H3    DT  12           3H        DT  12  -0.124 -12.955   5.172
  134    H71   DT  12           1H5       DT  12  -4.754 -11.292   6.069
  135    H72   DT  12           2H5       DT  12  -4.598 -12.964   6.648
  136    H73   DT  12           3H5       DT  12  -5.502 -12.621   5.153
  137    H6    DT  12           6H        DT  12  -4.387 -12.103   3.168
  138    H5'   DT  13           H5'       DT  13  -2.666  -8.859  -4.509
  139   H5''   DT  13          H5"        DT  13  -1.839 -10.422  -4.640
  140    H4'   DT  13           H4'       DT  13  -0.190  -8.691  -4.802
  141    H3'   DT  13           H3'       DT  13   0.035 -10.656  -2.853
  142    H2'   DT  13           H2'       DT  13  -0.126  -9.508  -0.859
  143   H2''   DT  13          H2"        DT  13   1.397  -8.691  -1.301
  144    H1'   DT  13           H1'       DT  13   0.274  -6.766  -1.652
  145    H3    DT  13           3H        DT  13  -2.483  -7.130   2.108
  146    H71   DT  13           1H5       DT  13  -5.371  -8.429  -2.024
  147    H72   DT  13           2H5       DT  13  -5.365  -6.660  -2.227
  148    H73   DT  13           3H5       DT  13  -6.067  -7.387  -0.761
  149    H6    DT  13           6H        DT  13  -2.914  -7.614  -2.651
  150    H5'   DT  14           H5'       DT  14   3.522  -7.591  -0.374
  151   H5''   DT  14          H5"        DT  14   4.254  -6.926  -1.847
  152    H4'   DT  14           H4'       DT  14   5.908  -7.645  -0.095
  153    H3'   DT  14           H3'       DT  14   6.216  -7.883  -2.792
  154    H2'   DT  14           H2'       DT  14   5.526 -10.083  -3.155
  155   H2''   DT  14          H2"        DT  14   7.200 -10.458  -2.641
  156    H1'   DT  14           H1'       DT  14   6.509 -11.232  -0.606
  157    H3    DT  14           3H        DT  14   3.547 -13.925  -3.271
  158    H71   DT  14           1H5       DT  14   0.760 -10.963   0.059
  159    H72   DT  14           2H5       DT  14   1.309 -12.271   1.130
  160    H73   DT  14           3H5       DT  14   0.285 -12.643  -0.278
  161    H6    DT  14           6H        DT  14   3.390 -10.680   0.272
  162    H5'   DG  15           H5'       DG  15   9.709  -5.957  -4.255
  163   H5''   DG  15          H5"        DG  15   8.491  -5.484  -3.056
  164    H4'   DG  15           H4'       DG  15   8.035  -5.892  -6.033
  165    H3'   DG  15           H3'       DG  15   8.999  -3.599  -4.894
  166    H2'   DG  15           H2'       DG  15   7.202  -3.532  -3.269
  167   H2''   DG  15          H2"        DG  15   6.694  -2.343  -4.524
  168    H1'   DG  15           H1'       DG  15   5.477  -4.010  -5.719
  169    H8    DG  15           8H        DG  15   3.001  -3.953  -5.167
  170    H1    DG  15           1H        DG  15   3.953  -5.115   1.011
  171    H21   DG  15           1H2       DG  15   6.118  -5.367   1.418
  172    H22   DG  15           2H2       DG  15   7.340  -5.260   0.175
  173    H5'   DG  16           H5'       DG  16   5.118  -3.797  -7.752
  174   H5''   DG  16          H5"        DG  16   5.463  -2.522  -8.935
  175    H4'   DG  16           H4'       DG  16   3.022  -3.038  -8.634
  176    H3'   DG  16           H3'       DG  16   4.130  -0.503  -8.978
  177    H2'   DG  16           H2'       DG  16   3.935   0.141  -6.684
  178   H2''   DG  16          H2"        DG  16   2.341   0.679  -7.311
  179    H1'   DG  16           H1'       DG  16   1.273  -1.315  -6.618
  180    H8    DG  16           8H        DG  16   4.550  -1.112  -4.530
  181    H1    DG  16           1H        DG  16  -0.805  -0.796  -1.103
  182    H21   DG  16           1H2       DG  16  -2.563  -0.851  -2.402
  183    H22   DG  16           2H2       DG  16  -2.476  -1.011  -4.120
  184    H5'   DG  17           H5'       DG  17  -0.092   1.015  -7.095
  185   H5''   DG  17          H5"        DG  17  -0.188  -0.357  -8.219
  186    H4'   DG  17           H4'       DG  17  -1.769   0.715  -9.583
  187    H3'   DG  17           H3'       DG  17  -0.421   3.060  -9.215
  188    H2'   DG  17           H2'       DG  17  -1.133   3.602  -7.051
  189   H2''   DG  17          H2"        DG  17  -2.492   4.329  -7.961
  190    H1'   DG  17           H1'       DG  17  -3.908   2.600  -7.468
  191    H8    DG  17           8H        DG  17  -5.013   2.043  -5.284
  192    H1    DG  17           1H        DG  17   0.520   2.264  -2.198
  193    H21   DG  17           1H2       DG  17   2.213   2.500  -3.624
  194    H22   DG  17           2H2       DG  17   1.921   2.702  -5.329
  195    H5'   DG  18           H5'       DG  18  -6.622   3.469  -8.970
  196   H5''   DG  18          H5"        DG  18  -5.854   3.913 -10.507
  197    H4'   DG  18           H4'       DG  18  -6.352   5.868  -9.019
  198    H3'   DG  18           H3'       DG  18  -3.455   5.294  -9.726
  199    H2'   DG  18           H2'       DG  18  -2.831   7.168  -8.460
  200   H2''   DG  18          H2"        DG  18  -4.416   7.965  -8.691
  201    H1'   DG  18           H1'       DG  18  -5.098   7.111  -6.702
  202    H8    DG  18           8H        DG  18  -1.530   6.192  -7.373
  203    H1    DG  18           1H        DG  18  -3.268   4.954  -1.359
  204    H21   DG  18           1H2       DG  18  -5.538   5.068  -1.174
  205    H22   DG  18           2H2       DG  18  -6.566   5.454  -2.537
  206    H5'   DA  19           H5'       DA  19  -1.242   7.858 -13.071
  207   H5''   DA  19          H5"        DA  19  -0.935   6.468 -12.011
  208    H4'   DA  19           H4'       DA  19   0.786   8.091 -11.597
  209    H3'   DA  19           H3'       DA  19  -1.076   7.432  -9.508
  210    H2'   DA  19           H2"       DA  19  -1.612   9.621  -8.946
  211   H2''   DA  19          H2'        DA  19   0.072   9.682  -8.299
  212    H1'   DA  19           H1'       DA  19   0.953  10.580 -10.257
  213    H8    DA  19           8H        DA  19  -1.153  12.102  -8.211
  214    H61   DA  19           2H6       DA  19  -2.963  15.902 -10.602
  215    H62   DA  19           1H6       DA  19  -3.064  16.334 -12.295
  216    H2    DA  19           2H        DA  19  -1.150  12.966 -14.568
  217    H5'   DA  20           H5'       DA  20   3.405   7.040  -7.601
  218   H5''   DA  20          H5"        DA  20   3.195   6.562  -5.906
  219    H4'   DA  20           H4'       DA  20   3.635   9.084  -6.558
  220    H3'   DA  20           H3'       DA  20   1.567   8.157  -4.510
  221    H2'   DA  20           H2'       DA  20   1.068  10.459  -4.116
  222   H2''   DA  20          H2"        DA  20   2.552  11.015  -4.960
  223    H1'   DA  20           H1'       DA  20   1.096  11.183  -6.762
  224    H8    DA  20           8H        DA  20  -0.338   7.725  -6.247
  225    H61   DA  20           2H6       DA  20  -4.990   8.979  -5.826
  226    H62   DA  20           1H6       DA  20  -5.831  10.511  -5.738
  227    H2    DA  20           2H        DA  20  -2.649  13.687  -5.884
  228    H5'   DG  21           H5'       DG  21   7.304   8.658  -5.568
  229   H5''   DG  21          H5"        DG  21   6.759   7.886  -7.071
  230    H4'   DG  21           H4'       DG  21   8.298   6.533  -5.514
  231    H3'   DG  21           H3'       DG  21   5.892   5.616  -6.944
  232    H2'   DG  21           H2'       DG  21   5.051   4.327  -5.247
  233   H2''   DG  21          H2"        DG  21   6.548   3.350  -5.339
  234    H1'   DG  21           H1'       DG  21   7.570   4.506  -3.615
  235    H8    DG  21           8H        DG  21   6.970   4.339  -1.113
  236    H1    DG  21           1H        DG  21   0.741   5.177  -2.222
  237    H21   DG  21           1H2       DG  21   0.387   5.607  -4.383
  238    H22   DG  21           2H2       DG  21   1.689   5.722  -5.541
  239    H5'   DG  22           H5'       DG  22  10.168   2.137  -5.179
  240   H5''   DG  22          H5"        DG  22   8.423   1.847  -5.345
  241    H4'   DG  22           H4'       DG  22   9.917   2.492  -2.782
  242    H3'   DG  22           H3'       DG  22   9.488  -0.040  -3.981
  243    H2'   DG  22           H2'       DG  22   7.182  -0.155  -3.488
  244   H2''   DG  22          H2"        DG  22   7.821  -0.705  -1.903
  245    H1'   DG  22           H1'       DG  22   7.704   1.450  -0.973
  246    H8    DG  22           8H        DG  22   5.314   1.874  -4.033
  247    H1    DG  22           1H        DG  22   2.496   1.428   1.739
  248    H21   DG  22           1H2       DG  22   4.040   1.050   3.247
  249    H22   DG  22           2H2       DG  22   5.738   0.889   2.894
  250    H5'   DG  23           H5'       DG  23   8.616  -1.542   0.196
  251   H5''   DG  23          H5"        DG  23   9.220   0.061   0.663
  252    H4'   DG  23           H4'       DG  23  10.349  -0.904   2.609
  253    H3'   DG  23           H3'       DG  23  10.273  -3.376   1.317
  254    H2'   DG  23           H2'       DG  23   7.939  -3.731   1.691
  255   H2''   DG  23          H2"        DG  23   8.645  -4.489   3.156
  256    H1'   DG  23           H1'       DG  23   8.373  -2.519   4.428
  257    H8    DG  23           8H        DG  23   6.167  -2.759   5.697
  258    H1    DG  23           1H        DG  23   2.790  -2.213   0.342
  259    H21   DG  23           1H2       DG  23   4.087  -1.963  -1.407
  260    H22   DG  23           2H2       DG  23   5.815  -1.955  -1.280
  261    H5'   DG  24           H5'       DG  24  10.661  -6.485   6.005
  262   H5''   DG  24          H5"        DG  24   9.231  -6.715   4.978
  263    H4'   DG  24           H4'       DG  24   9.317  -5.325   7.680
  264    H3'   DG  24           H3'       DG  24   9.164  -8.012   7.342
  265   HO3'   DG  24          H3T        DG  24   7.526  -6.413   9.062
  266    H2'   DG  24           H2'       DG  24   7.347  -8.036   5.826
  267   H2''   DG  24          H2"        DG  24   6.471  -8.218   7.383
  268    H1'   DG  24           H1'       DG  24   5.858  -5.979   7.453
  269    H8    DG  24           8H        DG  24   7.276  -5.984   3.855
  270    H1    DG  24           1H        DG  24   0.891  -5.561   4.268
  271    H21   DG  24           1H2       DG  24   0.275  -5.825   6.430
  272    H22   DG  24           2H2       DG  24   1.435  -6.078   7.708
  Start of MODEL    5
    1    H5'   DG   1           H5'       DG   1  -5.481  -7.068  -5.460
    2   H5''   DG   1          H5"        DG   1  -5.271  -6.002  -6.861
    3    H4'   DG   1           H4'       DG   1  -7.076  -5.203  -5.394
    4    H3'   DG   1           H3'       DG   1  -4.957  -3.590  -6.348
    5    H2'   DG   1           H2'       DG   1  -3.930  -3.226  -4.292
    6   H2''   DG   1          H2"        DG   1  -5.192  -1.961  -4.150
    7    H1'   DG   1           H1'       DG   1  -6.600  -3.363  -2.891
    8    H8    DG   1           8H        DG   1  -6.372  -4.233  -0.446
    9    H1    DG   1           1H        DG   1   0.029  -4.354  -0.850
   10    H21   DG   1           1H2       DG   1   0.676  -3.809  -2.867
   11    H22   DG   1           2H2       DG   1  -0.446  -3.319  -4.084
   12   HO5'   DG   1          H5T        DG   1  -3.767  -5.482  -4.565
   13    H5'   DG   2           H5'       DG   2  -9.166  -4.240  -2.664
   14   H5''   DG   2          H5"        DG   2 -10.229  -2.963  -3.290
   15    H4'   DG   2           H4'       DG   2  -9.804  -2.947  -0.778
   16    H3'   DG   2           H3'       DG   2  -9.777  -0.664  -2.591
   17    H2'   DG   2           H2'       DG   2  -7.830   0.299  -1.808
   18   H2''   DG   2          H2"        DG   2  -8.686   0.536  -0.259
   19    H1'   DG   2           H1'       DG   2  -7.797  -1.377   0.692
   20    H8    DG   2           8H        DG   2  -5.707  -0.455  -2.488
   21    H1    DG   2           1H        DG   2  -2.266  -2.308   2.545
   22    H21   DG   2           1H2       DG   2  -3.635  -2.636   4.327
   23    H22   DG   2           2H2       DG   2  -5.368  -2.473   4.212
   24    H5'   DG   3           H5'       DG   3 -11.415   0.594   2.026
   25   H5''   DG   3          H5"        DG   3 -12.480   1.926   1.530
   26    H4'   DG   3           H4'       DG   3 -11.210   2.764   3.353
   27    H3'   DG   3           H3'       DG   3 -10.885   3.980   0.814
   28    H2'   DG   3           H2'       DG   3  -8.653   3.187   0.538
   29   H2''   DG   3          H2"        DG   3  -8.358   4.710   1.434
   30    H1'   DG   3           H1'       DG   3  -8.420   3.602   3.544
   31    H8    DG   3           8H        DG   3  -6.718   1.865   4.663
   32    H1    DG   3           1H        DG   3  -3.481   1.763  -0.799
   33    H21   DG   3           1H2       DG   3  -4.742   2.508  -2.427
   34    H22   DG   3           2H2       DG   3  -6.363   3.041  -2.233
   35    H5'   DG   4           H5'       DG   4  -8.858   8.679   1.773
   36   H5''   DG   4          H5"        DG   4  -7.546   7.793   0.970
   37    H4'   DG   4           H4'       DG   4  -8.352   7.806   3.854
   38    H3'   DG   4           H3'       DG   4  -5.730   7.751   2.339
   39    H2'   DG   4           H2'       DG   4  -4.758   6.895   4.426
   40   H2''   DG   4          H2"        DG   4  -6.316   7.142   5.298
   41    H1'   DG   4           H1'       DG   4  -6.421   4.841   4.481
   42    H8    DG   4           8H        DG   4  -6.755   5.617   0.881
   43    H1    DG   4           1H        DG   4  -0.734   4.007   2.202
   44    H21   DG   4           1H2       DG   4  -0.439   3.921   4.443
   45    H22   DG   4           2H2       DG   4  -1.746   4.252   5.557
   46    H5'   DT   5           H5'       DT   5  -3.242  11.486   1.872
   47   H5''   DT   5          H5"        DT   5  -3.213  10.031   0.868
   48    H4'   DT   5           H4'       DT   5  -1.485  10.320   3.340
   49    H3'   DT   5           H3'       DT   5  -1.161  11.765   0.858
   50    H2'   DT   5           H2'       DT   5   0.508  10.595  -0.211
   51   H2''   DT   5          H2"        DT   5   1.305  10.126   1.313
   52    H1'   DT   5           H1'       DT   5   0.383   8.070   0.813
   53    H3    DT   5           3H        DT   5  -1.702   9.369  -3.515
   54    H71   DT   5           1H5       DT   5  -5.163   8.000   0.140
   55    H72   DT   5           2H5       DT   5  -4.655   6.387  -0.407
   56    H73   DT   5           3H5       DT   5  -5.438   7.507  -1.546
   57    H6    DT   5           6H        DT   5  -2.615   7.595   0.822
   58    H5'   DT   6           H5'       DT   6   3.728  11.099   4.262
   59   H5''   DT   6          H5"        DT   6   3.973  10.027   2.866
   60    H4'   DT   6           H4'       DT   6   4.289   8.939   5.140
   61    H3'   DT   6           H3'       DT   6   2.209   7.881   3.194
   62    H2'   DT   6           H2'       DT   6   1.582   6.246   4.747
   63   H2''   DT   6          H2"        DT   6   3.162   6.298   5.581
   64    H1'   DT   6           H1'       DT   6   2.224   7.734   7.073
   65    H3    DT   6           3H        DT   6  -1.964   8.765   8.293
   66    H71   DT   6           1H5       DT   6  -3.514   8.238   3.934
   67    H72   DT   6           2H5       DT   6  -2.851   6.590   3.859
   68    H73   DT   6           3H5       DT   6  -2.036   7.916   3.003
   69    H6    DT   6           6H        DT   6   0.010   7.526   4.075
   70    H5'   DG   7           H5'       DG   7   7.557   6.116   5.785
   71   H5''   DG   7          H5"        DG   7   6.380   4.980   5.097
   72    H4'   DG   7           H4'       DG   7   6.581   5.956   7.964
   73    H3'   DG   7           H3'       DG   7   7.690   3.707   7.059
   74    H2'   DG   7           H2'       DG   7   5.804   3.014   5.729
   75   H2''   DG   7          H2"        DG   7   5.604   2.023   7.206
   76    H1'   DG   7           H1'       DG   7   3.959   3.421   8.080
   77    H8    DG   7           8H        DG   7   1.507   3.697   7.263
   78    H1    DG   7           1H        DG   7   3.345   4.284   1.162
   79    H21   DG   7           1H2       DG   7   5.580   4.261   1.019
   80    H22   DG   7           2H2       DG   7   6.608   4.137   2.432
   81    H5'   DG   8           H5'       DG   8   4.006   3.113  10.123
   82   H5''   DG   8          H5"        DG   8   4.395   1.732  11.166
   83    H4'   DG   8           H4'       DG   8   2.070   1.562  10.573
   84    H3'   DG   8           H3'       DG   8   3.793  -0.374   8.997
   85    H2'   DG   8           H2'       DG   8   1.850  -1.165   7.959
   86   H2''   DG   8          H2"        DG   8   0.807  -0.700   9.341
   87    H1'   DG   8           H1'       DG   8   0.343   1.256   8.263
   88    H8    DG   8           8H        DG   8   3.618   0.655   6.317
   89    H1    DG   8           1H        DG   8  -1.783   1.457   2.799
   90    H21   DG   8           1H2       DG   8  -3.502   1.626   4.245
   91    H22   DG   8           2H2       DG   8  -3.313   1.534   5.975
   92    H5'   DG   9           H5'       DG   9   0.570  -1.395  11.801
   93   H5''   DG   9          H5"        DG   9   0.809  -2.881  12.743
   94    H4'   DG   9           H4'       DG   9  -1.554  -2.573  12.150
   95    H3'   DG   9           H3'       DG   9  -0.025  -4.941  11.432
   96    H2'   DG   9           H2'       DG   9  -0.673  -5.008   9.214
   97   H2''   DG   9          H2"        DG   9  -2.290  -5.448   9.855
   98    H1'   DG   9           H1'       DG   9  -3.059  -3.245   9.789
   99    H8    DG   9           8H        DG   9  -4.039  -2.785   7.461
  100    H1    DG   9           1H        DG   9   1.697  -2.691   4.627
  101    H21   DG   9           1H2       DG   9   3.308  -3.105   6.124
  102    H22   DG   9           2H2       DG   9   2.966  -3.372   7.820
  103    H5'   DG  10           H5'       DG  10  -5.540  -3.196  10.676
  104   H5''   DG  10          H5"        DG  10  -6.104  -4.519  11.714
  105    H4'   DG  10           H4'       DG  10  -7.124  -4.562   9.451
  106    H3'   DG  10           H3'       DG  10  -6.038  -6.812  10.772
  107    H2'   DG  10           H2'       DG  10  -4.171  -7.001   9.300
  108   H2''   DG  10          H2"        DG  10  -5.377  -7.968   8.392
  109    H1'   DG  10           H1'       DG  10  -6.065  -6.083   7.113
  110    H8    DG  10           8H        DG  10  -2.365  -6.304   8.192
  111    H1    DG  10           1H        DG  10  -3.269  -4.834   2.076
  112    H21   DG  10           1H2       DG  10  -5.507  -4.579   1.696
  113    H22   DG  10           2H2       DG  10  -6.694  -4.764   2.958
  114    H5'   DT  11           H5'       DT  11  -8.230  -8.876   5.619
  115   H5''   DT  11          H5"        DT  11  -6.837  -9.764   6.267
  116    H4'   DT  11           H4'       DT  11  -6.741  -7.404   4.357
  117    H3'   DT  11           H3'       DT  11  -7.055 -10.157   3.800
  118    H2'   DT  11           H2'       DT  11  -4.877 -10.746   4.325
  119   H2''   DT  11          H2"        DT  11  -4.574 -10.190   2.647
  120    H1'   DT  11           H1'       DT  11  -3.942  -8.053   3.373
  121    H3    DT  11           3H        DT  11   0.329  -9.550   4.303
  122    H71   DT  11           1H5       DT  11  -2.155  -8.674   8.786
  123    H72   DT  11           2H5       DT  11  -0.770  -9.793   8.761
  124    H73   DT  11           3H5       DT  11  -2.431 -10.426   8.659
  125    H6    DT  11           6H        DT  11  -3.790  -9.264   6.705
  126    H5'   DT  12           H5'       DT  12  -4.765 -10.657  -1.229
  127   H5''   DT  12          H5"        DT  12  -5.080 -11.664   0.200
  128    H4'   DT  12           H4'       DT  12  -2.549 -10.094  -0.425
  129    H3'   DT  12           H3'       DT  12  -3.259 -13.008  -0.346
  130    H2'   DT  12           H2'       DT  12  -1.588 -13.516   1.148
  131   H2''   DT  12          H2"        DT  12  -0.416 -12.501   0.246
  132    H1'   DT  12           H1'       DT  12  -0.795 -10.696   1.635
  133    H3    DT  12           3H        DT  12   0.271 -12.764   5.601
  134    H71   DT  12           1H5       DT  12  -4.325 -13.342   6.324
  135    H72   DT  12           2H5       DT  12  -5.013 -12.963   4.726
  136    H73   DT  12           3H5       DT  12  -4.639 -11.652   5.872
  137    H6    DT  12           6H        DT  12  -3.711 -11.975   3.071
  138    H5'   DT  13           H5'       DT  13  -1.999  -9.413  -2.206
  139   H5''   DT  13          H5"        DT  13  -2.423  -8.861  -3.837
  140    H4'   DT  13           H4'       DT  13  -0.047  -8.678  -4.412
  141    H3'   DT  13           H3'       DT  13   0.616 -10.453  -2.489
  142    H2'   DT  13           H2'       DT  13   0.224  -9.308  -0.494
  143   H2''   DT  13          H2"        DT  13   1.748  -8.452  -0.876
  144    H1'   DT  13           H1'       DT  13   0.599  -6.541  -1.262
  145    H3    DT  13           3H        DT  13  -2.319  -7.080   2.385
  146    H71   DT  13           1H5       DT  13  -5.000  -6.730  -2.128
  147    H72   DT  13           2H5       DT  13  -5.748  -7.443  -0.677
  148    H73   DT  13           3H5       DT  13  -4.921  -8.486  -1.859
  149    H6    DT  13           6H        DT  13  -2.514  -7.414  -2.396
  150    H5'   DT  14           H5'       DT  14   3.954  -7.009  -0.891
  151   H5''   DT  14          H5"        DT  14   4.132  -7.284  -2.635
  152    H4'   DT  14           H4'       DT  14   6.307  -6.752  -1.900
  153    H3'   DT  14           H3'       DT  14   5.938  -9.170  -3.010
  154    H2'   DT  14           H2'       DT  14   5.807 -10.618  -1.173
  155   H2''   DT  14          H2"        DT  14   7.586 -10.449  -1.140
  156    H1'   DT  14           H1'       DT  14   7.509  -9.161   0.732
  157    H3    DT  14           3H        DT  14   4.745  -9.306   4.333
  158    H71   DT  14           1H5       DT  14   1.336 -11.200   1.841
  159    H72   DT  14           2H5       DT  14   2.295 -12.040   0.599
  160    H73   DT  14           3H5       DT  14   1.629 -10.426   0.269
  161    H6    DT  14           6H        DT  14   4.233 -10.405  -0.311
  162    H5'   DG  15           H5'       DG  15   9.355  -6.468  -5.320
  163   H5''   DG  15          H5"        DG  15   8.377  -6.182  -3.868
  164    H4'   DG  15           H4'       DG  15   7.603  -5.643  -6.750
  165    H3'   DG  15           H3'       DG  15   8.867  -3.969  -4.907
  166    H2'   DG  15           H2'       DG  15   7.076  -3.890  -3.391
  167   H2''   DG  15          H2"        DG  15   6.683  -2.487  -4.443
  168    H1'   DG  15           H1'       DG  15   5.280  -3.791  -5.829
  169    H8    DG  15           8H        DG  15   2.829  -4.358  -5.339
  170    H1    DG  15           1H        DG  15   3.895  -5.009   0.889
  171    H21   DG  15           1H2       DG  15   6.071  -5.050   1.263
  172    H22   DG  15           2H2       DG  15   7.275  -4.947   0.007
  173    H5'   DG  16           H5'       DG  16   4.124  -4.630  -7.958
  174   H5''   DG  16          H5"        DG  16   4.689  -3.617  -9.300
  175    H4'   DG  16           H4'       DG  16   2.329  -3.174  -8.696
  176    H3'   DG  16           H3'       DG  16   4.322  -1.134  -9.006
  177    H2'   DG  16           H2'       DG  16   4.104  -0.266  -6.829
  178   H2''   DG  16          H2"        DG  16   2.630   0.487  -7.523
  179    H1'   DG  16           H1'       DG  16   1.239  -1.251  -6.760
  180    H8    DG  16           8H        DG  16   4.541  -1.158  -4.693
  181    H1    DG  16           1H        DG  16  -0.821  -0.805  -1.246
  182    H21   DG  16           1H2       DG  16  -2.573  -0.938  -2.547
  183    H22   DG  16           2H2       DG  16  -2.480  -1.150  -4.258
  184    H5'   DG  17           H5'       DG  17   0.545   1.050  -8.053
  185   H5''   DG  17          H5"        DG  17   0.028  -0.480  -8.792
  186    H4'   DG  17           H4'       DG  17  -1.929   0.552  -9.738
  187    H3'   DG  17           H3'       DG  17  -0.550   3.005  -9.674
  188    H2'   DG  17           H2'       DG  17  -1.027   3.493  -7.400
  189   H2''   DG  17          H2"        DG  17  -2.527   4.125  -8.153
  190    H1'   DG  17           H1'       DG  17  -3.703   2.133  -7.732
  191    H8    DG  17           8H        DG  17  -4.910   2.090  -5.548
  192    H1    DG  17           1H        DG  17   0.494   2.376  -2.280
  193    H21   DG  17           1H2       DG  17   2.256   2.422  -3.649
  194    H22   DG  17           2H2       DG  17   2.032   2.501  -5.372
  195    H5'   DG  18           H5'       DG  18  -4.885   3.991 -10.498
  196   H5''   DG  18          H5"        DG  18  -5.109   5.392 -11.566
  197    H4'   DG  18           H4'       DG  18  -6.145   5.918  -9.460
  198    H3'   DG  18           H3'       DG  18  -3.527   7.294  -9.997
  199    H2'   DG  18           H2'       DG  18  -3.317   8.007  -7.828
  200   H2''   DG  18          H2"        DG  18  -5.065   8.351  -7.701
  201    H1'   DG  18           H1'       DG  18  -5.464   6.338  -6.726
  202    H8    DG  18           8H        DG  18  -1.670   6.148  -7.605
  203    H1    DG  18           1H        DG  18  -3.145   4.936  -1.482
  204    H21   DG  18           1H2       DG  18  -5.441   5.025  -1.251
  205    H22   DG  18           2H2       DG  18  -6.501   5.378  -2.589
  206    H5'   DA  19           H5'       DA  19  -2.373   9.107 -12.704
  207   H5''   DA  19          H5"        DA  19  -2.435   7.747 -11.569
  208    H4'   DA  19           H4'       DA  19  -0.216   8.886 -11.638
  209    H3'   DA  19           H3'       DA  19  -1.561   8.144  -9.281
  210    H2'   DA  19           H2"       DA  19  -1.975  10.332  -8.517
  211   H2''   DA  19          H2'        DA  19  -0.261  10.169  -7.974
  212    H1'   DA  19           H1'       DA  19   0.600  11.219  -9.872
  213    H8    DA  19           8H        DA  19  -1.104  12.615  -7.442
  214    H61   DA  19           2H6       DA  19  -2.665  16.908  -9.058
  215    H62   DA  19           1H6       DA  19  -2.873  17.600 -10.652
  216    H2    DA  19           2H        DA  19  -1.598  14.435 -13.574
  217    H5'   DA  20           H5'       DA  20   2.795   6.058  -6.640
  218   H5''   DA  20          H5"        DA  20   1.048   6.362  -6.759
  219    H4'   DA  20           H4'       DA  20   3.225   8.482  -6.783
  220    H3'   DA  20           H3'       DA  20   1.240   7.629  -4.636
  221    H2'   DA  20           H2'       DA  20   1.127   9.896  -3.933
  222   H2''   DA  20          H2"        DA  20   2.609  10.347  -4.836
  223    H1'   DA  20           H1'       DA  20   1.101  10.959  -6.472
  224    H8    DA  20           8H        DA  20  -0.902   7.794  -6.290
  225    H61   DA  20           2H6       DA  20  -5.200   9.721  -5.192
  226    H62   DA  20           1H6       DA  20  -5.732  11.336  -4.778
  227    H2    DA  20           2H        DA  20  -2.039  13.902  -4.767
  228    H5'   DG  21           H5'       DG  21   6.943   8.086  -6.218
  229   H5''   DG  21          H5"        DG  21   6.386   7.010  -7.512
  230    H4'   DG  21           H4'       DG  21   8.274   6.205  -5.898
  231    H3'   DG  21           H3'       DG  21   6.327   4.674  -7.290
  232    H2'   DG  21           H2'       DG  21   5.068   4.071  -5.400
  233   H2''   DG  21          H2"        DG  21   6.363   2.842  -5.253
  234    H1'   DG  21           H1'       DG  21   7.589   4.128  -3.722
  235    H8    DG  21           8H        DG  21   7.021   4.226  -1.207
  236    H1    DG  21           1H        DG  21   0.804   5.181  -2.304
  237    H21   DG  21           1H2       DG  21   0.429   5.373  -4.505
  238    H22   DG  21           2H2       DG  21   1.718   5.280  -5.679
  239    H5'   DG  22           H5'       DG  22   9.557   3.159  -4.718
  240   H5''   DG  22          H5"        DG  22  10.367   1.608  -5.016
  241    H4'   DG  22           H4'       DG  22   9.946   2.111  -2.593
  242    H3'   DG  22           H3'       DG  22   9.429  -0.388  -3.917
  243    H2'   DG  22           H2'       DG  22   7.135  -0.438  -3.413
  244   H2''   DG  22          H2"        DG  22   7.734  -0.939  -1.795
  245    H1'   DG  22           H1'       DG  22   7.695   1.264  -0.970
  246    H8    DG  22           8H        DG  22   5.336   1.687  -4.051
  247    H1    DG  22           1H        DG  22   2.459   1.420   1.694
  248    H21   DG  22           1H2       DG  22   3.974   1.010   3.223
  249    H22   DG  22           2H2       DG  22   5.668   0.781   2.888
  250    H5'   DG  23           H5'       DG  23   8.422  -1.983   0.267
  251   H5''   DG  23          H5"        DG  23   9.045  -0.349   0.563
  252    H4'   DG  23           H4'       DG  23  10.147  -1.108   2.612
  253    H3'   DG  23           H3'       DG  23  10.121  -3.696   1.615
  254    H2'   DG  23           H2'       DG  23   7.747  -3.959   1.859
  255   H2''   DG  23          H2"        DG  23   8.359  -4.637   3.404
  256    H1'   DG  23           H1'       DG  23   8.093  -2.574   4.525
  257    H8    DG  23           8H        DG  23   5.863  -2.921   5.715
  258    H1    DG  23           1H        DG  23   2.623  -2.251   0.296
  259    H21   DG  23           1H2       DG  23   3.950  -1.933  -1.422
  260    H22   DG  23           2H2       DG  23   5.679  -1.927  -1.259
  261    H5'   DG  24           H5'       DG  24   9.144  -3.625   6.402
  262   H5''   DG  24          H5"        DG  24  10.312  -4.825   6.989
  263    H4'   DG  24           H4'       DG  24   8.187  -5.053   8.172
  264    H3'   DG  24           H3'       DG  24   9.472  -7.212   6.937
  265   HO3'   DG  24          H3T        DG  24   7.228  -7.169   8.712
  266    H2'   DG  24           H2'       DG  24   7.939  -7.462   5.172
  267   H2''   DG  24          H2"        DG  24   7.104  -8.455   6.415
  268    H1'   DG  24           H1'       DG  24   5.696  -6.680   7.060
  269    H8    DG  24           8H        DG  24   7.083  -6.376   3.446
  270    H1    DG  24           1H        DG  24   0.743  -5.593   3.960
  271    H21   DG  24           1H2       DG  24   0.117  -5.824   6.122
  272    H22   DG  24           2H2       DG  24   1.277  -6.130   7.395
  Start of MODEL    6
    1    H5'   DG   1           H5'       DG   1  -4.747  -6.963  -5.344
    2   H5''   DG   1          H5"        DG   1  -4.761  -5.868  -6.739
    3    H4'   DG   1           H4'       DG   1  -6.771  -5.521  -5.408
    4    H3'   DG   1           H3'       DG   1  -5.197  -3.427  -6.236
    5    H2'   DG   1           H2'       DG   1  -3.993  -3.232  -4.191
    6   H2''   DG   1          H2"        DG   1  -5.306  -2.038  -3.925
    7    H1'   DG   1           H1'       DG   1  -6.627  -3.592  -2.736
    8    H8    DG   1           8H        DG   1  -6.316  -4.372  -0.285
    9    H1    DG   1           1H        DG   1   0.070  -4.467  -0.846
   10    H21   DG   1           1H2       DG   1   0.653  -3.891  -2.877
   11    H22   DG   1           2H2       DG   1  -0.505  -3.396  -4.057
   12   HO5'   DG   1          H5T        DG   1  -3.490  -5.119  -4.338
   13    H5'   DG   2           H5'       DG   2  -8.871  -3.197  -3.452
   14   H5''   DG   2          H5"        DG   2  -9.884  -1.769  -3.743
   15    H4'   DG   2           H4'       DG   2  -9.952  -2.641  -1.390
   16    H3'   DG   2           H3'       DG   2  -9.872   0.049  -2.168
   17    H2'   DG   2           H2'       DG   2  -7.707   0.570  -1.437
   18   H2''   DG   2          H2"        DG   2  -8.516   0.677   0.155
   19    H1'   DG   2           H1'       DG   2  -7.803  -1.428   0.812
   20    H8    DG   2           8H        DG   2  -5.756  -0.527  -2.387
   21    H1    DG   2           1H        DG   2  -2.238  -2.382   2.587
   22    H21   DG   2           1H2       DG   2  -3.569  -2.647   4.415
   23    H22   DG   2           2H2       DG   2  -5.301  -2.435   4.340
   24    H5'   DG   3           H5'       DG   3 -11.788   1.233   3.575
   25   H5''   DG   3          H5"        DG   3 -12.319   2.185   2.173
   26    H4'   DG   3           H4'       DG   3 -10.673   3.284   3.835
   27    H3'   DG   3           H3'       DG   3 -10.697   3.445   0.903
   28    H2'   DG   3           H2'       DG   3  -8.441   2.966   0.694
   29   H2''   DG   3          H2"        DG   3  -8.191   4.598   1.392
   30    H1'   DG   3           H1'       DG   3  -8.076   3.741   3.616
   31    H8    DG   3           8H        DG   3  -6.464   1.876   4.790
   32    H1    DG   3           1H        DG   3  -3.408   1.649  -0.773
   33    H21   DG   3           1H2       DG   3  -4.696   2.420  -2.369
   34    H22   DG   3           2H2       DG   3  -6.303   2.983  -2.118
   35    H5'   DG   4           H5'       DG   4  -8.522   9.004   1.816
   36   H5''   DG   4          H5"        DG   4  -8.116   7.462   1.032
   37    H4'   DG   4           H4'       DG   4  -8.367   7.794   4.036
   38    H3'   DG   4           H3'       DG   4  -5.868   7.906   2.328
   39    H2'   DG   4           H2'       DG   4  -4.792   7.050   4.375
   40   H2''   DG   4          H2"        DG   4  -6.328   7.236   5.296
   41    H1'   DG   4           H1'       DG   4  -6.445   4.957   4.462
   42    H8    DG   4           8H        DG   4  -6.697   5.734   0.833
   43    H1    DG   4           1H        DG   4  -0.734   3.989   2.341
   44    H21   DG   4           1H2       DG   4  -0.518   3.891   4.588
   45    H22   DG   4           2H2       DG   4  -1.851   4.255   5.662
   46    H5'   DT   5           H5'       DT   5  -3.648  10.648   1.024
   47   H5''   DT   5          H5"        DT   5  -3.806   9.089   1.850
   48    H4'   DT   5           H4'       DT   5  -2.057  10.188   3.525
   49    H3'   DT   5           H3'       DT   5  -2.023  12.142   1.416
   50    H2'   DT   5           H2'       DT   5  -0.150  11.571   0.190
   51   H2''   DT   5          H2"        DT   5   0.740  10.999   1.629
   52    H1'   DT   5           H1'       DT   5   0.268   8.930   0.656
   53    H3    DT   5           3H        DT   5  -2.431  10.712  -3.188
   54    H71   DT   5           1H5       DT   5  -4.355   6.487  -0.654
   55    H72   DT   5           2H5       DT   5  -5.393   7.502  -1.686
   56    H73   DT   5           3H5       DT   5  -5.232   7.863   0.049
   57    H6    DT   5           6H        DT   5  -2.492   7.743   0.563
   58    H5'   DT   6           H5'       DT   6   0.238  10.288   4.778
   59   H5''   DT   6          H5"        DT   6   0.894  11.631   5.727
   60    H4'   DT   6           H4'       DT   6   3.136  10.593   5.634
   61    H3'   DT   6           H3'       DT   6   2.039   8.858   3.626
   62    H2'   DT   6           H2"       DT   6   1.656   6.855   4.760
   63   H2''   DT   6          H2'        DT   6   3.111   7.076   5.765
   64    H1'   DT   6           H1'       DT   6   1.554   7.513   7.400
   65    H3    DT   6           3H        DT   6  -2.714   9.257   7.913
   66    H71   DT   6           1H5       DT   6  -2.009   7.904   2.802
   67    H72   DT   6           2H5       DT   6  -3.619   8.174   3.509
   68    H73   DT   6           3H5       DT   6  -2.854   6.578   3.622
   69    H6    DT   6           6H        DT   6  -0.137   7.479   4.249
   70    H5'   DG   7           H5'       DG   7   7.206   6.254   5.431
   71   H5''   DG   7          H5"        DG   7   5.950   5.123   4.889
   72    H4'   DG   7           H4'       DG   7   6.623   5.948   7.728
   73    H3'   DG   7           H3'       DG   7   7.547   3.781   6.437
   74    H2'   DG   7           H2'       DG   7   5.574   2.831   5.653
   75   H2''   DG   7          H2"        DG   7   5.567   2.068   7.269
   76    H1'   DG   7           H1'       DG   7   3.865   3.410   7.995
   77    H8    DG   7           8H        DG   7   1.456   4.067   7.202
   78    H1    DG   7           1H        DG   7   3.340   4.251   1.089
   79    H21   DG   7           1H2       DG   7   5.565   4.015   0.957
   80    H22   DG   7           2H2       DG   7   6.573   3.836   2.376
   81    H5'   DG   8           H5'       DG   8   3.318   3.562  10.347
   82   H5''   DG   8          H5"        DG   8   4.101   2.242  11.238
   83    H4'   DG   8           H4'       DG   8   1.894   1.565  10.382
   84    H3'   DG   8           H3'       DG   8   4.352   0.122   9.704
   85    H2'   DG   8           H2"       DG   8   3.849  -0.063   7.454
   86   H2''   DG   8          H2'        DG   8   2.547  -1.175   7.953
   87    H1'   DG   8           H1'       DG   8   0.932   0.522   7.994
   88    H8    DG   8           8H        DG   8   4.041   1.188   5.893
   89    H1    DG   8           1H        DG   8  -1.608   1.376   2.732
   90    H21   DG   8           1H2       DG   8  -3.251   1.348   4.273
   91    H22   DG   8           2H2       DG   8  -2.944   1.253   5.987
   92    H5'   DG   9           H5'       DG   9   0.907  -1.344  11.842
   93   H5''   DG   9          H5"        DG   9   0.971  -2.789  12.872
   94    H4'   DG   9           H4'       DG   9  -1.320  -2.337  12.137
   95    H3'   DG   9           H3'       DG   9   0.014  -4.861  11.654
   96    H2'   DG   9           H2'       DG   9  -0.417  -4.877   9.349
   97   H2''   DG   9          H2"        DG   9  -2.082  -5.295   9.871
   98    H1'   DG   9           H1'       DG   9  -2.776  -3.043   9.863
   99    H8    DG   9           8H        DG   9  -3.833  -2.716   7.553
  100    H1    DG   9           1H        DG   9   1.803  -2.730   4.520
  101    H21   DG   9           1H2       DG   9   3.469  -3.088   5.976
  102    H22   DG   9           2H2       DG   9   3.182  -3.288   7.693
  103    H5'   DG  10           H5'       DG  10  -4.317  -4.167  11.265
  104   H5''   DG  10          H5"        DG  10  -5.331  -5.334  12.138
  105    H4'   DG  10           H4'       DG  10  -6.496  -4.674  10.134
  106    H3'   DG  10           H3'       DG  10  -6.019  -7.355  10.669
  107    H2'   DG  10           H2'       DG  10  -4.168  -7.493   9.134
  108   H2''   DG  10          H2"        DG  10  -5.536  -8.046   8.108
  109    H1'   DG  10           H1'       DG  10  -5.914  -5.833   7.283
  110    H8    DG  10           8H        DG  10  -2.196  -6.389   8.249
  111    H1    DG  10           1H        DG  10  -3.180  -4.901   2.151
  112    H21   DG  10           1H2       DG  10  -5.432  -4.618   1.818
  113    H22   DG  10           2H2       DG  10  -6.594  -4.792   3.103
  114    H5'   DT  11           H5'       DT  11  -8.318  -8.672   5.524
  115   H5''   DT  11          H5"        DT  11  -6.957  -9.502   6.301
  116    H4'   DT  11           H4'       DT  11  -6.702  -7.216   4.320
  117    H3'   DT  11           H3'       DT  11  -7.214  -9.949   3.802
  118    H2'   DT  11           H2'       DT  11  -5.078 -10.683   4.282
  119   H2''   DT  11          H2"        DT  11  -4.755 -10.131   2.607
  120    H1'   DT  11           H1'       DT  11  -4.004  -8.035   3.352
  121    H3    DT  11           3H        DT  11   0.187  -9.804   4.197
  122    H71   DT  11           1H5       DT  11  -2.569 -10.501   8.598
  123    H72   DT  11           2H5       DT  11  -2.178  -8.767   8.712
  124    H73   DT  11           3H5       DT  11  -0.871  -9.976   8.680
  125    H6    DT  11           6H        DT  11  -3.870  -9.277   6.658
  126    H5'   DT  12           H5'       DT  12  -5.129 -10.810  -1.138
  127   H5''   DT  12          H5"        DT  12  -5.413 -11.672   0.388
  128    H4'   DT  12           H4'       DT  12  -2.840 -10.298  -0.480
  129    H3'   DT  12           H3'       DT  12  -3.713 -13.160  -0.250
  130    H2'   DT  12           H2'       DT  12  -1.988 -13.729   1.156
  131   H2''   DT  12          H2"        DT  12  -0.813 -12.792   0.173
  132    H1'   DT  12           H1'       DT  12  -1.006 -10.973   1.584
  133    H3    DT  12           3H        DT  12  -0.023 -13.026   5.566
  134    H71   DT  12           1H5       DT  12  -4.842 -11.541   5.863
  135    H72   DT  12           2H5       DT  12  -4.614 -13.212   6.426
  136    H73   DT  12           3H5       DT  12  -5.322 -12.902   4.821
  137    H6    DT  12           6H        DT  12  -3.986 -12.029   3.079
  138    H5'   DT  13           H5'       DT  13  -1.928  -9.013  -4.468
  139   H5''   DT  13          H5"        DT  13  -1.184 -10.622  -4.497
  140    H4'   DT  13           H4'       DT  13   0.568  -9.020  -4.255
  141    H3'   DT  13           H3'       DT  13   0.129 -10.971  -2.238
  142    H2'   DT  13           H2'       DT  13   0.085  -9.744  -0.298
  143   H2''   DT  13          H2"        DT  13   1.676  -9.054  -0.722
  144    H1'   DT  13           H1'       DT  13   0.680  -7.084  -1.181
  145    H3    DT  13           3H        DT  13  -2.360  -7.141   2.337
  146    H71   DT  13           1H5       DT  13  -4.998  -8.611  -1.894
  147    H72   DT  13           2H5       DT  13  -4.906  -6.869  -2.250
  148    H73   DT  13           3H5       DT  13  -5.742  -7.437  -0.785
  149    H6    DT  13           6H        DT  13  -2.459  -7.837  -2.417
  150    H5'   DT  14           H5'       DT  14   4.100  -7.530  -0.083
  151   H5''   DT  14          H5"        DT  14   4.085  -6.962  -1.765
  152    H4'   DT  14           H4'       DT  14   6.353  -7.009  -1.499
  153    H3'   DT  14           H3'       DT  14   5.626  -9.113  -2.957
  154    H2'   DT  14           H2'       DT  14   5.346 -10.849  -1.414
  155   H2''   DT  14          H2"        DT  14   7.131 -10.932  -1.416
  156    H1'   DT  14           H1'       DT  14   7.190 -10.112   0.711
  157    H3    DT  14           3H        DT  14   3.965  -9.047   3.966
  158    H71   DT  14           1H5       DT  14   2.094 -12.732   0.808
  159    H72   DT  14           2H5       DT  14   1.425 -11.322  -0.044
  160    H73   DT  14           3H5       DT  14   0.953 -11.651   1.640
  161    H6    DT  14           6H        DT  14   4.061 -11.207  -0.324
  162    H5'   DG  15           H5'       DG  15   9.174  -6.783  -5.167
  163   H5''   DG  15          H5"        DG  15   8.117  -6.383  -3.799
  164    H4'   DG  15           H4'       DG  15   7.562  -5.921  -6.745
  165    H3'   DG  15           H3'       DG  15   8.847  -4.239  -4.942
  166    H2'   DG  15           H2'       DG  15   7.047  -3.974  -3.486
  167   H2''   DG  15          H2"        DG  15   6.757  -2.604  -4.616
  168    H1'   DG  15           H1'       DG  15   5.258  -3.862  -5.927
  169    H8    DG  15           8H        DG  15   2.790  -4.239  -5.376
  170    H1    DG  15           1H        DG  15   3.964  -5.160   0.810
  171    H21   DG  15           1H2       DG  15   6.142  -5.301   1.136
  172    H22   DG  15           2H2       DG  15   7.322  -5.192  -0.142
  173    H5'   DG  16           H5'       DG  16   5.549  -1.825  -8.952
  174   H5''   DG  16          H5"        DG  16   5.309  -1.334  -7.263
  175    H4'   DG  16           H4'       DG  16   3.323  -2.894  -8.954
  176    H3'   DG  16           H3'       DG  16   3.687  -0.194  -9.167
  177    H2'   DG  16           H2'       DG  16   3.391   0.312  -6.851
  178   H2''   DG  16          H2"        DG  16   1.712   0.514  -7.461
  179    H1'   DG  16           H1'       DG  16   1.067  -1.618  -6.754
  180    H8    DG  16           8H        DG  16   4.441  -1.391  -4.834
  181    H1    DG  16           1H        DG  16  -0.814  -0.956  -1.221
  182    H21   DG  16           1H2       DG  16  -2.604  -0.956  -2.476
  183    H22   DG  16           2H2       DG  16  -2.566  -1.104  -4.194
  184    H5'   DG  17           H5'       DG  17  -0.509  -0.113  -8.265
  185   H5''   DG  17          H5"        DG  17  -1.646  -1.274  -8.978
  186    H4'   DG  17           H4'       DG  17  -2.995   0.530  -9.889
  187    H3'   DG  17           H3'       DG  17  -0.756   2.192  -9.774
  188    H2'   DG  17           H2'       DG  17  -0.849   2.602  -7.445
  189   H2''   DG  17          H2"        DG  17  -1.957   3.886  -8.018
  190    H1'   DG  17           H1'       DG  17  -3.869   2.602  -7.598
  191    H8    DG  17           8H        DG  17  -5.024   1.820  -5.415
  192    H1    DG  17           1H        DG  17   0.530   2.114  -2.360
  193    H21   DG  17           1H2       DG  17   2.214   2.315  -3.817
  194    H22   DG  17           2H2       DG  17   1.906   2.473  -5.521
  195    H5'   DG  18           H5'       DG  18  -4.856   3.624 -10.112
  196   H5''   DG  18          H5"        DG  18  -5.777   4.722 -11.159
  197    H4'   DG  18           H4'       DG  18  -6.017   5.944  -9.238
  198    H3'   DG  18           H3'       DG  18  -3.183   6.628 -10.059
  199    H2'   DG  18           H2'       DG  18  -2.839   7.633  -8.011
  200   H2''   DG  18          H2"        DG  18  -4.528   8.223  -7.922
  201    H1'   DG  18           H1'       DG  18  -5.178   6.394  -6.732
  202    H8    DG  18           8H        DG  18  -1.397   5.806  -7.502
  203    H1    DG  18           1H        DG  18  -3.107   4.850  -1.401
  204    H21   DG  18           1H2       DG  18  -5.400   5.039  -1.235
  205    H22   DG  18           2H2       DG  18  -6.411   5.411  -2.607
  206    H5'   DA  19           H5'       DA  19  -1.484   8.342 -12.574
  207   H5''   DA  19          H5"        DA  19  -1.622   7.164 -11.257
  208    H4'   DA  19           H4'       DA  19   0.605   8.319 -11.371
  209    H3'   DA  19           H3'       DA  19  -0.763   7.744  -9.037
  210    H2'   DA  19           H2"       DA  19  -1.600   9.943  -8.699
  211   H2''   DA  19          H2'        DA  19  -0.014  10.044  -7.832
  212    H1'   DA  19           H1'       DA  19   1.084  10.982  -9.674
  213    H8    DA  19           8H        DA  19  -1.299  12.331  -7.755
  214    H61   DA  19           2H6       DA  19  -2.775  16.330 -10.067
  215    H62   DA  19           1H6       DA  19  -2.644  16.895 -11.718
  216    H2    DA  19           2H        DA  19  -0.424  13.695 -13.965
  217    H5'   DA  20           H5'       DA  20   3.882   7.287  -7.272
  218   H5''   DA  20          H5"        DA  20   3.290   6.557  -5.768
  219    H4'   DA  20           H4'       DA  20   3.211   9.305  -6.578
  220    H3'   DA  20           H3'       DA  20   2.283   7.800  -4.113
  221    H2'   DA  20           H2'       DA  20   0.753   9.470  -3.634
  222   H2''   DA  20          H2"        DA  20   1.883  10.757  -4.168
  223    H1'   DA  20           H1'       DA  20   0.983  10.778  -6.261
  224    H8    DA  20           8H        DA  20  -0.970   7.623  -6.161
  225    H61   DA  20           2H6       DA  20  -5.406   9.512  -5.722
  226    H62   DA  20           1H6       DA  20  -6.008  11.123  -5.402
  227    H2    DA  20           2H        DA  20  -2.385  13.737  -4.901
  228    H5'   DG  21           H5'       DG  21   6.950   8.387  -5.377
  229   H5''   DG  21          H5"        DG  21   6.244   7.558  -6.777
  230    H4'   DG  21           H4'       DG  21   8.407   6.600  -5.621
  231    H3'   DG  21           H3'       DG  21   6.570   5.283  -7.217
  232    H2'   DG  21           H2'       DG  21   5.181   4.484  -5.480
  233   H2''   DG  21          H2"        DG  21   6.349   3.131  -5.581
  234    H1'   DG  21           H1'       DG  21   7.601   3.893  -3.768
  235    H8    DG  21           8H        DG  21   7.029   3.976  -1.228
  236    H1    DG  21           1H        DG  21   0.860   5.083  -2.440
  237    H21   DG  21           1H2       DG  21   0.556   5.468  -4.628
  238    H22   DG  21           2H2       DG  21   1.881   5.504  -5.765
  239    H5'   DG  22           H5'       DG  22   9.787   3.275  -4.909
  240   H5''   DG  22          H5"        DG  22  10.465   1.678  -5.288
  241    H4'   DG  22           H4'       DG  22   9.956   2.181  -2.829
  242    H3'   DG  22           H3'       DG  22   9.610  -0.296  -4.250
  243    H2'   DG  22           H2'       DG  22   7.273  -0.380  -3.906
  244   H2''   DG  22          H2"        DG  22   7.786  -0.975  -2.290
  245    H1'   DG  22           H1'       DG  22   7.747   1.201  -1.362
  246    H8    DG  22           8H        DG  22   5.318   1.699  -4.389
  247    H1    DG  22           1H        DG  22   2.598   1.074   1.412
  248    H21   DG  22           1H2       DG  22   4.173   0.608   2.850
  249    H22   DG  22           2H2       DG  22   5.862   0.464   2.464
  250    H5'   DG  23           H5'       DG  23   8.639  -1.816   0.058
  251   H5''   DG  23          H5"        DG  23   9.364  -0.260   0.509
  252    H4'   DG  23           H4'       DG  23  10.524  -1.318   2.393
  253    H3'   DG  23           H3'       DG  23  10.339  -3.758   1.126
  254    H2'   DG  23           H2'       DG  23   7.927  -3.840   1.341
  255   H2''   DG  23          H2"        DG  23   8.495  -4.826   2.729
  256    H1'   DG  23           H1'       DG  23   8.447  -2.948   4.189
  257    H8    DG  23           8H        DG  23   6.284  -2.940   5.514
  258    H1    DG  23           1H        DG  23   2.784  -2.274   0.261
  259    H21   DG  23           1H2       DG  23   4.027  -2.078  -1.538
  260    H22   DG  23           2H2       DG  23   5.760  -2.156  -1.471
  261    H5'   DG  24           H5'       DG  24   9.359  -3.687   6.077
  262   H5''   DG  24          H5"        DG  24  10.518  -4.961   6.503
  263    H4'   DG  24           H4'       DG  24   8.520  -4.980   7.963
  264    H3'   DG  24           H3'       DG  24   9.645  -7.245   6.829
  265   HO3'   DG  24          H3T        DG  24   8.871  -6.835   9.047
  266    H2'   DG  24           H2'       DG  24   8.040  -7.534   5.125
  267   H2''   DG  24          H2"        DG  24   7.253  -8.471   6.443
  268    H1'   DG  24           H1'       DG  24   5.854  -6.679   7.046
  269    H8    DG  24           8H        DG  24   7.209  -6.390   3.428
  270    H1    DG  24           1H        DG  24   0.861  -5.669   3.972
  271    H21   DG  24           1H2       DG  24   0.251  -5.897   6.139
  272    H22   DG  24           2H2       DG  24   1.423  -6.189   7.405
  Start of MODEL    7
    1    H5'   DG   1           H5'       DG   1  -5.427  -6.337  -6.515
    2   H5''   DG   1          H5"        DG   1  -4.146  -5.921  -5.359
    3    H4'   DG   1           H4'       DG   1  -7.117  -5.428  -5.048
    4    H3'   DG   1           H3'       DG   1  -5.104  -3.771  -6.117
    5    H2'   DG   1           H2'       DG   1  -3.999  -3.335  -4.118
    6   H2''   DG   1          H2"        DG   1  -5.280  -2.091  -3.958
    7    H1'   DG   1           H1'       DG   1  -6.603  -3.481  -2.597
    8    H8    DG   1           8H        DG   1  -6.253  -4.262  -0.137
    9    H1    DG   1           1H        DG   1   0.122  -4.380  -0.821
   10    H21   DG   1           1H2       DG   1   0.691  -3.871  -2.866
   11    H22   DG   1           2H2       DG   1  -0.477  -3.393  -4.041
   12   HO5'   DG   1          H5T        DG   1  -5.295  -7.357  -3.874
   13    H5'   DG   2           H5'       DG   2  -9.728  -3.812  -2.333
   14   H5''   DG   2          H5"        DG   2 -10.336  -2.338  -3.116
   15    H4'   DG   2           H4'       DG   2  -9.961  -2.329  -0.539
   16    H3'   DG   2           H3'       DG   2  -9.210  -0.183  -2.488
   17    H2'   DG   2           H2"       DG   2  -7.613   0.753  -1.114
   18   H2''   DG   2          H2'        DG   2  -8.689   0.609   0.302
   19    H1'   DG   2           H1'       DG   2  -7.703  -1.323   0.976
   20    H8    DG   2           8H        DG   2  -5.750  -0.557  -2.338
   21    H1    DG   2           1H        DG   2  -2.148  -2.304   2.622
   22    H21   DG   2           1H2       DG   2  -3.457  -2.529   4.473
   23    H22   DG   2           2H2       DG   2  -5.188  -2.315   4.423
   24    H5'   DG   3           H5'       DG   3 -10.481   0.530   1.183
   25   H5''   DG   3          H5"        DG   3 -12.010   0.796   2.040
   26    H4'   DG   3           H4'       DG   3 -11.216   2.610   3.126
   27    H3'   DG   3           H3'       DG   3 -10.805   3.675   0.551
   28    H2'   DG   3           H2'       DG   3  -8.543   2.954   0.418
   29   H2''   DG   3          H2"        DG   3  -8.334   4.556   1.193
   30    H1'   DG   3           H1'       DG   3  -8.374   3.607   3.389
   31    H8    DG   3           8H        DG   3  -6.669   1.884   4.609
   32    H1    DG   3           1H        DG   3  -3.420   1.737  -0.838
   33    H21   DG   3           1H2       DG   3  -4.694   2.443  -2.476
   34    H22   DG   3           2H2       DG   3  -6.326   2.941  -2.284
   35    H5'   DG   4           H5'       DG   4  -9.000   8.518   1.410
   36   H5''   DG   4          H5"        DG   4  -7.613   7.656   0.715
   37    H4'   DG   4           H4'       DG   4  -8.644   7.641   3.528
   38    H3'   DG   4           H3'       DG   4  -5.922   7.851   2.246
   39    H2'   DG   4           H2'       DG   4  -5.040   6.932   4.334
   40   H2''   DG   4          H2"        DG   4  -6.643   7.058   5.129
   41    H1'   DG   4           H1'       DG   4  -6.580   4.780   4.264
   42    H8    DG   4           8H        DG   4  -6.790   5.639   0.666
   43    H1    DG   4           1H        DG   4  -0.803   4.023   2.163
   44    H21   DG   4           1H2       DG   4  -0.589   3.871   4.407
   45    H22   DG   4           2H2       DG   4  -1.931   4.177   5.486
   46    H5'   DT   5           H5'       DT   5  -3.733  10.115   1.015
   47   H5''   DT   5          H5"        DT   5  -4.141   8.735   2.049
   48    H4'   DT   5           H4'       DT   5  -2.539   9.735   3.776
   49    H3'   DT   5           H3'       DT   5  -2.295  11.862   1.901
   50    H2'   DT   5           H2'       DT   5  -0.378  11.372   0.701
   51   H2''   DT   5          H2"        DT   5   0.461  10.755   2.153
   52    H1'   DT   5           H1'       DT   5   0.128   8.711   1.092
   53    H3    DT   5           3H        DT   5  -2.114  10.506  -2.982
   54    H71   DT   5           1H5       DT   5  -4.466   6.339  -0.724
   55    H72   DT   5           2H5       DT   5  -5.360   7.424  -1.817
   56    H73   DT   5           3H5       DT   5  -5.346   7.734  -0.066
   57    H6    DT   5           6H        DT   5  -2.691   7.537   0.735
   58    H5'   DT   6           H5'       DT   6  -0.020   9.908   5.212
   59   H5''   DT   6          H5"        DT   6   0.690  11.106   6.295
   60    H4'   DT   6           H4'       DT   6   2.896  10.132   6.004
   61    H3'   DT   6           H3'       DT   6   1.772   8.732   3.752
   62    H2'   DT   6           H2'       DT   6   1.593   6.544   4.533
   63   H2''   DT   6          H2"        DT   6   3.087   6.705   5.466
   64    H1'   DT   6           H1'       DT   6   1.727   6.748   7.271
   65    H3    DT   6           3H        DT   6  -2.630   7.168   8.473
   66    H71   DT   6           1H5       DT   6  -2.153   7.386   3.093
   67    H72   DT   6           2H5       DT   6  -3.584   8.077   3.895
   68    H73   DT   6           3H5       DT   6  -3.396   6.324   3.771
   69    H6    DT   6           6H        DT   6  -0.293   7.274   4.257
   70    H5'   DG   7           H5'       DG   7   7.091   6.101   5.263
   71   H5''   DG   7          H5"        DG   7   5.738   5.069   4.760
   72    H4'   DG   7           H4'       DG   7   6.527   5.829   7.591
   73    H3'   DG   7           H3'       DG   7   7.445   3.688   6.240
   74    H2'   DG   7           H2'       DG   7   5.476   2.682   5.536
   75   H2''   DG   7          H2"        DG   7   5.522   1.948   7.164
   76    H1'   DG   7           H1'       DG   7   3.801   3.260   7.895
   77    H8    DG   7           8H        DG   7   1.367   3.821   7.105
   78    H1    DG   7           1H        DG   7   3.275   4.237   1.015
   79    H21   DG   7           1H2       DG   7   5.504   4.067   0.885
   80    H22   DG   7           2H2       DG   7   6.512   3.876   2.304
   81    H5'   DG   8           H5'       DG   8   3.380   3.633  10.302
   82   H5''   DG   8          H5"        DG   8   4.154   2.308  11.190
   83    H4'   DG   8           H4'       DG   8   1.901   1.666  10.483
   84    H3'   DG   8           H3'       DG   8   4.122   0.223   9.000
   85    H2'   DG   8           H2'       DG   8   2.474  -0.969   7.848
   86   H2''   DG   8          H2"        DG   8   1.292  -0.819   9.187
   87    H1'   DG   8           H1'       DG   8   0.411   1.019   8.165
   88    H8    DG   8           8H        DG   8   3.739   0.770   6.220
   89    H1    DG   8           1H        DG   8  -1.704   1.470   2.755
   90    H21   DG   8           1H2       DG   8  -3.423   1.570   4.207
   91    H22   DG   8           2H2       DG   8  -3.215   1.467   5.936
   92    H5'   DG   9           H5'       DG   9   1.060  -0.970  11.785
   93   H5''   DG   9          H5"        DG   9   1.224  -2.435  12.772
   94    H4'   DG   9           H4'       DG   9  -1.130  -1.947  12.186
   95    H3'   DG   9           H3'       DG   9   0.142  -4.492  11.808
   96    H2'   DG   9           H2'       DG   9  -0.220  -4.564   9.480
   97   H2''   DG   9          H2"        DG   9  -1.870  -5.048   9.996
   98    H1'   DG   9           H1'       DG   9  -2.668  -2.828   9.919
   99    H8    DG   9           8H        DG   9  -3.726  -2.513   7.610
  100    H1    DG   9           1H        DG   9   1.897  -2.597   4.558
  101    H21   DG   9           1H2       DG   9   3.566  -2.935   6.011
  102    H22   DG   9           2H2       DG   9   3.289  -3.104   7.732
  103    H5'   DG  10           H5'       DG  10  -4.443  -4.159  11.508
  104   H5''   DG  10          H5"        DG  10  -5.265  -5.544  12.257
  105    H4'   DG  10           H4'       DG  10  -6.367  -4.961  10.159
  106    H3'   DG  10           H3'       DG  10  -5.535  -7.573  10.721
  107    H2'   DG  10           H2'       DG  10  -3.615  -7.420   9.280
  108   H2''   DG  10          H2"        DG  10  -4.858  -8.115   8.183
  109    H1'   DG  10           H1'       DG  10  -5.521  -5.944   7.429
  110    H8    DG  10           8H        DG  10  -1.750  -6.164   8.358
  111    H1    DG  10           1H        DG  10  -3.008  -4.743   2.286
  112    H21   DG  10           1H2       DG  10  -5.245  -4.543   2.009
  113    H22   DG  10           2H2       DG  10  -6.374  -4.756   3.324
  114    H5'   DT  11           H5'       DT  11  -6.989  -6.660   6.539
  115   H5''   DT  11          H5"        DT  11  -8.050  -7.885   5.824
  116    H4'   DT  11           H4'       DT  11  -6.201  -6.856   4.346
  117    H3'   DT  11           H3'       DT  11  -7.101  -9.629   4.459
  118    H2'   DT  11           H2'       DT  11  -4.966 -10.470   4.491
  119   H2''   DT  11          H2"        DT  11  -4.843  -9.901   2.797
  120    H1'   DT  11           H1'       DT  11  -3.930  -7.850   3.446
  121    H3    DT  11           3H        DT  11   0.271  -9.732   3.744
  122    H71   DT  11           1H5       DT  11  -1.457  -8.665   8.527
  123    H72   DT  11           2H5       DT  11  -0.195  -9.905   8.322
  124    H73   DT  11           3H5       DT  11  -1.904 -10.385   8.460
  125    H6    DT  11           6H        DT  11  -3.406  -9.118   6.714
  126    H5'   DT  12           H5'       DT  12  -5.640 -10.729  -0.882
  127   H5''   DT  12          H5"        DT  12  -5.715 -11.626   0.648
  128    H4'   DT  12           H4'       DT  12  -3.302 -10.181  -0.518
  129    H3'   DT  12           H3'       DT  12  -4.101 -13.051  -0.186
  130    H2'   DT  12           H2'       DT  12  -2.255 -13.611   1.043
  131   H2''   DT  12          H2"        DT  12  -1.179 -12.696  -0.067
  132    H1'   DT  12           H1'       DT  12  -1.196 -10.876   1.348
  133    H3    DT  12           3H        DT  12   0.134 -13.058   5.171
  134    H71   DT  12           1H5       DT  12  -5.201 -12.567   5.021
  135    H72   DT  12           2H5       DT  12  -4.507 -11.282   6.040
  136    H73   DT  12           3H5       DT  12  -4.351 -12.985   6.527
  137    H6    DT  12           6H        DT  12  -4.013 -11.792   3.152
  138    H5'   DT  13           H5'       DT  13  -2.911  -8.705  -4.328
  139   H5''   DT  13          H5"        DT  13  -2.017 -10.182  -4.728
  140    H4'   DT  13           H4'       DT  13  -0.436  -8.431  -4.795
  141    H3'   DT  13           H3'       DT  13   0.011 -10.483  -3.052
  142    H2'   DT  13           H2'       DT  13  -0.365  -9.511  -0.979
  143   H2''   DT  13          H2"        DT  13   1.197  -8.684  -1.263
  144    H1'   DT  13           H1'       DT  13   0.165  -6.706  -1.596
  145    H3    DT  13           3H        DT  13  -2.406  -6.958   2.239
  146    H71   DT  13           1H5       DT  13  -6.137  -7.396  -0.484
  147    H72   DT  13           2H5       DT  13  -5.458  -8.475  -1.727
  148    H73   DT  13           3H5       DT  13  -5.491  -6.715  -1.995
  149    H6    DT  13           6H        DT  13  -3.069  -7.616  -2.469
  150    H5'   DT  14           H5'       DT  14   3.406  -8.281  -1.374
  151   H5''   DT  14          H5"        DT  14   3.596  -7.011  -2.591
  152    H4'   DT  14           H4'       DT  14   5.791  -6.759  -2.143
  153    H3'   DT  14           H3'       DT  14   6.002  -9.235  -3.123
  154    H2'   DT  14           H2'       DT  14   5.540 -10.561  -1.240
  155   H2''   DT  14          H2"        DT  14   7.278 -10.289  -0.913
  156    H1'   DT  14           H1'       DT  14   6.844  -8.802   0.767
  157    H3    DT  14           3H        DT  14   3.886  -9.368   4.114
  158    H71   DT  14           1H5       DT  14   1.840 -12.077   0.103
  159    H72   DT  14           2H5       DT  14   1.112 -10.481  -0.169
  160    H73   DT  14           3H5       DT  14   0.775 -11.365   1.335
  161    H6    DT  14           6H        DT  14   3.798 -10.393  -0.575
  162    H5'   DG  15           H5'       DG  15   9.448  -6.352  -5.232
  163   H5''   DG  15          H5"        DG  15   8.460  -5.959  -3.812
  164    H4'   DG  15           H4'       DG  15   7.669  -5.755  -6.732
  165    H3'   DG  15           H3'       DG  15   8.827  -3.854  -5.066
  166    H2'   DG  15           H2'       DG  15   7.052  -3.798  -3.523
  167   H2''   DG  15          H2"        DG  15   6.574  -2.479  -4.650
  168    H1'   DG  15           H1'       DG  15   5.236  -3.940  -5.946
  169    H8    DG  15           8H        DG  15   2.798  -4.442  -5.380
  170    H1    DG  15           1H        DG  15   3.986  -5.019   0.827
  171    H21   DG  15           1H2       DG  15   6.159  -5.030   1.162
  172    H22   DG  15           2H2       DG  15   7.343  -4.926  -0.112
  173    H5'   DG  16           H5'       DG  16   3.901  -4.629  -8.073
  174   H5''   DG  16          H5"        DG  16   4.481  -3.618  -9.408
  175    H4'   DG  16           H4'       DG  16   2.159  -3.080  -8.755
  176    H3'   DG  16           H3'       DG  16   4.246  -1.115  -9.016
  177    H2'   DG  16           H2'       DG  16   4.025  -0.253  -6.846
  178   H2''   DG  16          H2"        DG  16   2.560   0.525  -7.532
  179    H1'   DG  16           H1'       DG  16   1.147  -1.193  -6.773
  180    H8    DG  16           8H        DG  16   4.474  -1.133  -4.758
  181    H1    DG  16           1H        DG  16  -0.812  -0.898  -1.205
  182    H21   DG  16           1H2       DG  16  -2.596  -1.011  -2.467
  183    H22   DG  16           2H2       DG  16  -2.537  -1.192  -4.183
  184    H5'   DG  17           H5'       DG  17   0.561   1.252  -8.087
  185   H5''   DG  17          H5"        DG  17   0.028  -0.263  -8.844
  186    H4'   DG  17           H4'       DG  17  -1.865   0.864  -9.869
  187    H3'   DG  17           H3'       DG  17  -0.489   3.284  -9.617
  188    H2'   DG  17           H2'       DG  17  -0.986   3.615  -7.314
  189   H2''   DG  17          H2"        DG  17  -2.465   4.322  -8.046
  190    H1'   DG  17           H1'       DG  17  -3.687   2.345  -7.754
  191    H8    DG  17           8H        DG  17  -4.880   2.081  -5.586
  192    H1    DG  17           1H        DG  17   0.530   2.132  -2.317
  193    H21   DG  17           1H2       DG  17   2.284   2.346  -3.699
  194    H22   DG  17           2H2       DG  17   2.045   2.557  -5.408
  195    H5'   DG  18           H5'       DG  18  -4.735   4.217 -10.457
  196   H5''   DG  18          H5"        DG  18  -5.079   5.554 -11.575
  197    H4'   DG  18           H4'       DG  18  -6.039   6.255  -9.534
  198    H3'   DG  18           H3'       DG  18  -3.292   7.415  -9.929
  199    H2'   DG  18           H2'       DG  18  -3.245   8.264  -7.788
  200   H2''   DG  18          H2"        DG  18  -5.002   8.584  -7.786
  201    H1'   DG  18           H1'       DG  18  -5.393   6.616  -6.739
  202    H8    DG  18           8H        DG  18  -1.581   6.473  -7.542
  203    H1    DG  18           1H        DG  18  -3.204   4.866  -1.547
  204    H21   DG  18           1H2       DG  18  -5.514   4.901  -1.380
  205    H22   DG  18           2H2       DG  18  -6.542   5.329  -2.721
  206    H5'   DA  19           H5'       DA  19  -1.833   8.326 -12.925
  207   H5''   DA  19          H5"        DA  19  -2.487   7.238 -11.687
  208    H4'   DA  19           H4'       DA  19  -0.097   7.706 -11.295
  209    H3'   DA  19           H3'       DA  19  -2.067   8.742  -9.286
  210    H2'   DA  19           H2"       DA  19  -0.503  10.057  -8.259
  211   H2''   DA  19          H2'        DA  19   0.780   8.807  -8.488
  212    H1'   DA  19           H1'       DA  19   1.529   9.803 -10.361
  213    H8    DA  19           8H        DA  19   0.078  11.984  -7.999
  214    H61   DA  19           2H6       DA  19   0.329  16.278 -10.245
  215    H62   DA  19           1H6       DA  19   0.585  16.759 -11.908
  216    H2    DA  19           2H        DA  19   1.068  12.945 -14.249
  217    H5'   DA  20           H5'       DA  20   2.849   7.530  -8.035
  218   H5''   DA  20          H5"        DA  20   2.845   6.488  -6.605
  219    H4'   DA  20           H4'       DA  20   3.346   8.978  -6.232
  220    H3'   DA  20           H3'       DA  20   1.112   7.579  -4.715
  221    H2'   DA  20           H2'       DA  20   0.764   9.606  -3.512
  222   H2''   DA  20          H2"        DA  20   2.334  10.291  -4.060
  223    H1'   DA  20           H1'       DA  20   0.997  11.225  -5.721
  224    H8    DA  20           8H        DA  20  -0.775   7.805  -5.868
  225    H61   DA  20           2H6       DA  20  -5.302   9.477  -5.703
  226    H62   DA  20           1H6       DA  20  -6.004  11.075  -5.566
  227    H2    DA  20           2H        DA  20  -2.543  13.936  -5.306
  228    H5'   DG  21           H5'       DG  21   6.578   8.227  -6.062
  229   H5''   DG  21          H5"        DG  21   5.949   7.166  -7.334
  230    H4'   DG  21           H4'       DG  21   8.115   6.487  -6.018
  231    H3'   DG  21           H3'       DG  21   6.326   4.855  -7.386
  232    H2'   DG  21           H2'       DG  21   5.028   4.222  -5.510
  233   H2''   DG  21          H2"        DG  21   6.294   2.956  -5.449
  234    H1'   DG  21           H1'       DG  21   7.533   4.083  -3.819
  235    H8    DG  21           8H        DG  21   6.972   4.223  -1.297
  236    H1    DG  21           1H        DG  21   0.762   5.205  -2.437
  237    H21   DG  21           1H2       DG  21   0.417   5.450  -4.658
  238    H22   DG  21           2H2       DG  21   1.723   5.395  -5.816
  239    H5'   DG  22           H5'       DG  22   9.598   3.302  -4.752
  240   H5''   DG  22          H5"        DG  22  10.413   1.776  -5.150
  241    H4'   DG  22           H4'       DG  22  10.004   2.111  -2.702
  242    H3'   DG  22           H3'       DG  22   9.436  -0.290  -4.192
  243    H2'   DG  22           H2'       DG  22   7.166  -0.383  -3.618
  244   H2''   DG  22          H2"        DG  22   7.806  -0.954  -2.040
  245    H1'   DG  22           H1'       DG  22   7.764   1.201  -1.108
  246    H8    DG  22           8H        DG  22   5.382   1.695  -4.164
  247    H1    DG  22           1H        DG  22   2.534   1.375   1.594
  248    H21   DG  22           1H2       DG  22   4.061   0.965   3.112
  249    H22   DG  22           2H2       DG  22   5.756   0.756   2.771
  250    H5'   DG  23           H5'       DG  23   8.514  -2.187  -0.021
  251   H5''   DG  23          H5"        DG  23   9.104  -0.519   0.121
  252    H4'   DG  23           H4'       DG  23  10.331  -1.099   2.160
  253    H3'   DG  23           H3'       DG  23  10.282  -3.762   1.377
  254    H2'   DG  23           H2'       DG  23   7.940  -4.051   1.787
  255   H2''   DG  23          H2"        DG  23   8.644  -4.554   3.359
  256    H1'   DG  23           H1'       DG  23   8.359  -2.409   4.291
  257    H8    DG  23           8H        DG  23   6.175  -2.807   5.556
  258    H1    DG  23           1H        DG  23   2.763  -2.238   0.226
  259    H21   DG  23           1H2       DG  23   4.034  -1.990  -1.545
  260    H22   DG  23           2H2       DG  23   5.767  -2.027  -1.444
  261    H5'   DG  24           H5'       DG  24   9.616  -3.502   6.130
  262   H5''   DG  24          H5"        DG  24  10.785  -4.679   6.759
  263    H4'   DG  24           H4'       DG  24   8.672  -4.900   7.946
  264    H3'   DG  24           H3'       DG  24   9.918  -7.086   6.682
  265   HO3'   DG  24          H3T        DG  24   7.762  -7.001   8.560
  266    H2'   DG  24           H2'       DG  24   8.305  -7.366   5.000
  267   H2''   DG  24          H2"        DG  24   7.506  -8.309   6.305
  268    H1'   DG  24           H1'       DG  24   6.172  -6.480   6.971
  269    H8    DG  24           8H        DG  24   7.361  -6.295   3.271
  270    H1    DG  24           1H        DG  24   1.056  -5.496   4.134
  271    H21   DG  24           1H2       DG  24   0.555  -5.685   6.329
  272    H22   DG  24           2H2       DG  24   1.788  -5.964   7.540
  Start of MODEL    8
    1    H5'   DG   1           H5'       DG   1  -5.172  -6.997  -5.187
    2   H5''   DG   1          H5"        DG   1  -5.066  -6.000  -6.650
    3    H4'   DG   1           H4'       DG   1  -6.950  -5.275  -5.286
    4    H3'   DG   1           H3'       DG   1  -4.997  -3.521  -6.245
    5    H2'   DG   1           H2'       DG   1  -3.923  -3.137  -4.205
    6   H2''   DG   1          H2"        DG   1  -5.208  -1.894  -4.064
    7    H1'   DG   1           H1'       DG   1  -6.564  -3.290  -2.748
    8    H8    DG   1           8H        DG   1  -6.281  -4.106  -0.292
    9    H1    DG   1           1H        DG   1   0.104  -4.273  -0.831
   10    H21   DG   1           1H2       DG   1   0.705  -3.747  -2.868
   11    H22   DG   1           2H2       DG   1  -0.439  -3.262  -4.061
   12   HO5'   DG   1          H5T        DG   1  -3.626  -5.248  -4.361
   13    H5'   DG   2           H5'       DG   2  -9.495  -3.812  -2.276
   14   H5''   DG   2          H5"        DG   2 -10.219  -2.494  -3.219
   15    H4'   DG   2           H4'       DG   2  -9.964  -2.032  -0.743
   16    H3'   DG   2           H3'       DG   2  -8.785  -0.260  -2.866
   17    H2'   DG   2           H2'       DG   2  -7.445   0.886  -1.385
   18   H2''   DG   2          H2"        DG   2  -8.686   0.840  -0.108
   19    H1'   DG   2           H1'       DG   2  -7.704  -0.963   0.857
   20    H8    DG   2           8H        DG   2  -5.655  -0.361  -2.405
   21    H1    DG   2           1H        DG   2  -2.205  -2.265   2.595
   22    H21   DG   2           1H2       DG   2  -3.563  -2.534   4.404
   23    H22   DG   2           2H2       DG   2  -5.290  -2.293   4.317
   24    H5'   DG   3           H5'       DG   3 -11.328   0.569   2.494
   25   H5''   DG   3          H5"        DG   3 -12.254   1.873   1.719
   26    H4'   DG   3           H4'       DG   3 -10.949   2.776   3.566
   27    H3'   DG   3           H3'       DG   3 -10.746   3.814   0.924
   28    H2'   DG   3           H2'       DG   3  -8.493   3.104   0.639
   29   H2''   DG   3          H2"        DG   3  -8.221   4.679   1.455
   30    H1'   DG   3           H1'       DG   3  -8.193   3.655   3.618
   31    H8    DG   3           8H        DG   3  -6.476   1.909   4.744
   32    H1    DG   3           1H        DG   3  -3.324   1.799  -0.760
   33    H21   DG   3           1H2       DG   3  -4.590   2.545  -2.380
   34    H22   DG   3           2H2       DG   3  -6.208   3.080  -2.164
   35    H5'   DG   4           H5'       DG   4  -8.992   8.686   1.824
   36   H5''   DG   4          H5"        DG   4  -7.606   7.914   1.028
   37    H4'   DG   4           H4'       DG   4  -8.458   7.805   3.889
   38    H3'   DG   4           H3'       DG   4  -5.833   7.918   2.423
   39    H2'   DG   4           H2'       DG   4  -4.847   7.076   4.517
   40   H2''   DG   4          H2"        DG   4  -6.425   7.244   5.368
   41    H1'   DG   4           H1'       DG   4  -6.438   4.950   4.554
   42    H8    DG   4           8H        DG   4  -6.652   5.742   0.929
   43    H1    DG   4           1H        DG   4  -0.687   4.105   2.507
   44    H21   DG   4           1H2       DG   4  -0.520   3.960   4.755
   45    H22   DG   4           2H2       DG   4  -1.872   4.281   5.812
   46    H5'   DT   5           H5'       DT   5  -3.649  11.636   1.803
   47   H5''   DT   5          H5"        DT   5  -3.492  10.124   0.899
   48    H4'   DT   5           H4'       DT   5  -1.823  10.618   3.364
   49    H3'   DT   5           H3'       DT   5  -1.619  12.152   0.909
   50    H2'   DT   5           H2'       DT   5   0.251  11.226  -0.081
   51   H2''   DT   5          H2"        DT   5   0.991  10.770   1.479
   52    H1'   DT   5           H1'       DT   5   0.298   8.664   0.766
   53    H3    DT   5           3H        DT   5  -2.121  10.227  -3.386
   54    H71   DT   5           1H5       DT   5  -5.385   7.495  -1.580
   55    H72   DT   5           2H5       DT   5  -5.181   8.002   0.114
   56    H73   DT   5           3H5       DT   5  -4.434   6.493  -0.458
   57    H6    DT   5           6H        DT   5  -2.506   7.745   0.679
   58    H5'   DT   6           H5'       DT   6   0.336  10.607   4.494
   59   H5''   DT   6          H5"        DT   6   1.035  12.014   5.307
   60    H4'   DT   6           H4'       DT   6   3.189  10.828   5.499
   61    H3'   DT   6           H3'       DT   6   2.035   8.877   3.716
   62    H2'   DT   6           H2'       DT   6   1.547   7.086   5.140
   63   H2''   DT   6          H2"        DT   6   2.959   7.445   6.156
   64    H1'   DT   6           H1'       DT   6   1.362   8.180   7.625
   65    H3    DT   6           3H        DT   6  -2.885   9.960   7.753
   66    H71   DT   6           1H5       DT   6  -3.692   8.234   3.546
   67    H72   DT   6           2H5       DT   6  -2.819   6.716   3.856
   68    H73   DT   6           3H5       DT   6  -2.061   7.995   2.880
   69    H6    DT   6           6H        DT   6  -0.204   7.771   4.400
   70    H5'   DG   7           H5'       DG   7   7.104   6.399   5.705
   71   H5''   DG   7          H5"        DG   7   5.971   5.172   5.103
   72    H4'   DG   7           H4'       DG   7   6.514   5.982   7.969
   73    H3'   DG   7           H3'       DG   7   7.534   3.869   6.669
   74    H2'   DG   7           H2'       DG   7   5.608   2.897   5.791
   75   H2''   DG   7          H2"        DG   7   5.577   2.081   7.381
   76    H1'   DG   7           H1'       DG   7   3.823   3.352   8.105
   77    H8    DG   7           8H        DG   7   1.433   4.049   7.297
   78    H1    DG   7           1H        DG   7   3.381   4.340   1.211
   79    H21   DG   7           1H2       DG   7   5.604   4.107   1.087
   80    H22   DG   7           2H2       DG   7   6.604   3.902   2.510
   81    H5'   DG   8           H5'       DG   8   3.196   3.579  10.489
   82   H5''   DG   8          H5"        DG   8   3.974   2.262  11.386
   83    H4'   DG   8           H4'       DG   8   1.771   1.590  10.508
   84    H3'   DG   8           H3'       DG   8   4.224   0.123   9.908
   85    H2'   DG   8           H2"       DG   8   3.807  -0.026   7.633
   86   H2''   DG   8          H2'        DG   8   2.509  -1.167   8.078
   87    H1'   DG   8           H1'       DG   8   0.864   0.510   8.098
   88    H8    DG   8           8H        DG   8   4.010   1.166   6.062
   89    H1    DG   8           1H        DG   8  -1.571   1.483   2.782
   90    H21   DG   8           1H2       DG   8  -3.249   1.440   4.282
   91    H22   DG   8           2H2       DG   8  -2.981   1.314   6.002
   92    H5'   DG   9           H5'       DG   9   0.668  -1.337  11.932
   93   H5''   DG   9          H5"        DG   9   0.738  -2.785  12.959
   94    H4'   DG   9           H4'       DG   9  -1.548  -2.358  12.194
   95    H3'   DG   9           H3'       DG   9  -0.141  -4.851  11.651
   96    H2'   DG   9           H2'       DG   9  -0.675  -4.936   9.400
   97   H2''   DG   9          H2"        DG   9  -2.344  -5.280   9.967
   98    H1'   DG   9           H1'       DG   9  -2.975  -3.031   9.871
   99    H8    DG   9           8H        DG   9  -3.944  -2.667   7.530
  100    H1    DG   9           1H        DG   9   1.765  -2.725   4.648
  101    H21   DG   9           1H2       DG   9   3.390  -3.137   6.123
  102    H22   DG   9           2H2       DG   9   3.071  -3.367   7.831
  103    H5'   DG  10           H5'       DG  10  -5.611  -5.694  12.035
  104   H5''   DG  10          H5"        DG  10  -4.153  -6.308  11.226
  105    H4'   DG  10           H4'       DG  10  -6.681  -5.208   9.986
  106    H3'   DG  10           H3'       DG  10  -5.885  -7.842  10.369
  107    H2'   DG  10           H2'       DG  10  -3.909  -7.587   9.012
  108   H2''   DG  10          H2"        DG  10  -5.102  -8.250   7.844
  109    H1'   DG  10           H1'       DG  10  -5.776  -6.062   7.163
  110    H8    DG  10           8H        DG  10  -2.036  -6.221   8.256
  111    H1    DG  10           1H        DG  10  -3.111  -4.725   2.165
  112    H21   DG  10           1H2       DG  10  -5.356  -4.512   1.836
  113    H22   DG  10           2H2       DG  10  -6.512  -4.745   3.119
  114    H5'   DT  11           H5'       DT  11  -7.125  -6.889   5.994
  115   H5''   DT  11          H5"        DT  11  -8.163  -8.172   5.348
  116    H4'   DT  11           H4'       DT  11  -6.362  -7.342   3.779
  117    H3'   DT  11           H3'       DT  11  -6.865 -10.177   4.368
  118    H2'   DT  11           H2'       DT  11  -4.666 -10.717   4.371
  119   H2''   DT  11          H2"        DT  11  -4.635 -10.253   2.652
  120    H1'   DT  11           H1'       DT  11  -3.945  -8.134   3.101
  121    H3    DT  11           3H        DT  11   0.469  -9.267   3.864
  122    H71   DT  11           1H5       DT  11  -1.848  -8.745   8.504
  123    H72   DT  11           2H5       DT  11  -0.407  -9.780   8.354
  124    H73   DT  11           3H5       DT  11  -2.034 -10.501   8.282
  125    H6    DT  11           6H        DT  11  -3.539  -9.288   6.440
  126    H5'   DT  12           H5'       DT  12  -5.095  -9.176   1.141
  127   H5''   DT  12          H5"        DT  12  -5.576  -9.735  -0.436
  128    H4'   DT  12           H4'       DT  12  -3.173  -9.726  -0.416
  129    H3'   DT  12           H3'       DT  12  -4.403 -12.444  -0.332
  130    H2'   DT  12           H2'       DT  12  -2.688 -13.402   0.872
  131   H2''   DT  12          H2"        DT  12  -1.497 -12.717  -0.277
  132    H1'   DT  12           H1'       DT  12  -1.064 -10.912   1.118
  133    H3    DT  12           3H        DT  12   0.408 -12.505   5.075
  134    H71   DT  12           1H5       DT  12  -4.393 -11.514   5.963
  135    H72   DT  12           2H5       DT  12  -4.075 -13.209   6.396
  136    H73   DT  12           3H5       DT  12  -4.977 -12.824   4.908
  137    H6    DT  12           6H        DT  12  -3.888 -12.118   2.994
  138    H5'   DT  13           H5'       DT  13  -2.495  -8.501  -4.562
  139   H5''   DT  13          H5"        DT  13  -1.571 -10.014  -4.587
  140    H4'   DT  13           H4'       DT  13  -0.077  -8.095  -4.740
  141    H3'   DT  13           H3'       DT  13   0.348 -10.158  -2.983
  142    H2'   DT  13           H2'       DT  13  -0.142  -9.232  -0.913
  143   H2''   DT  13          H2"        DT  13   1.388  -8.327  -1.121
  144    H1'   DT  13           H1'       DT  13   0.279  -6.404  -1.452
  145    H3    DT  13           3H        DT  13  -2.526  -6.962   2.199
  146    H71   DT  13           1H5       DT  13  -5.359  -6.590  -2.179
  147    H72   DT  13           2H5       DT  13  -6.039  -7.391  -0.741
  148    H73   DT  13           3H5       DT  13  -5.237  -8.355  -2.004
  149    H6    DT  13           6H        DT  13  -2.860  -7.348  -2.565
  150    H5'   DT  14           H5'       DT  14   3.622  -7.716  -0.350
  151   H5''   DT  14          H5"        DT  14   4.098  -7.470  -2.044
  152    H4'   DT  14           H4'       DT  14   6.042  -7.590  -0.503
  153    H3'   DT  14           H3'       DT  14   5.911  -8.775  -2.960
  154    H2'   DT  14           H2'       DT  14   5.420 -10.993  -2.342
  155   H2''   DT  14          H2"        DT  14   7.197 -11.065  -2.113
  156    H1'   DT  14           H1'       DT  14   7.028 -10.950   0.176
  157    H3    DT  14           3H        DT  14   4.879 -14.612   1.632
  158    H71   DT  14           1H5       DT  14   1.279 -12.173  -1.300
  159    H72   DT  14           2H5       DT  14   1.044 -11.321   0.244
  160    H73   DT  14           3H5       DT  14   0.767 -13.077   0.145
  161    H6    DT  14           6H        DT  14   3.459 -10.709  -0.756
  162    H5'   DG  15           H5'       DG  15   9.453  -6.373  -4.659
  163   H5''   DG  15          H5"        DG  15   8.282  -5.898  -3.415
  164    H4'   DG  15           H4'       DG  15   7.788  -6.054  -6.410
  165    H3'   DG  15           H3'       DG  15   8.901  -3.917  -5.128
  166    H2'   DG  15           H2'       DG  15   7.150  -3.874  -3.452
  167   H2''   DG  15          H2"        DG  15   6.696  -2.554  -4.590
  168    H1'   DG  15           H1'       DG  15   5.336  -4.021  -5.877
  169    H8    DG  15           8H        DG  15   2.877  -4.086  -5.306
  170    H1    DG  15           1H        DG  15   3.928  -5.212   0.860
  171    H21   DG  15           1H2       DG  15   6.093  -5.486   1.221
  172    H22   DG  15           2H2       DG  15   7.296  -5.398  -0.040
  173    H5'   DG  16           H5'       DG  16   5.148  -3.585  -8.107
  174   H5''   DG  16          H5"        DG  16   5.500  -2.181  -9.132
  175    H4'   DG  16           H4'       DG  16   3.050  -2.745  -8.861
  176    H3'   DG  16           H3'       DG  16   4.174  -0.180  -8.984
  177    H2'   DG  16           H2'       DG  16   3.914   0.311  -6.670
  178   H2''   DG  16          H2"        DG  16   2.301   0.824  -7.274
  179    H1'   DG  16           H1'       DG  16   1.305  -1.233  -6.709
  180    H8    DG  16           8H        DG  16   4.593  -1.190  -4.636
  181    H1    DG  16           1H        DG  16  -0.750  -0.876  -1.183
  182    H21   DG  16           1H2       DG  16  -2.511  -0.873  -2.480
  183    H22   DG  16           2H2       DG  16  -2.426  -0.981  -4.198
  184    H5'   DG  17           H5'       DG  17  -0.171  -0.107  -8.517
  185   H5''   DG  17          H5"        DG  17  -1.320  -0.693  -9.735
  186    H4'   DG  17           H4'       DG  17  -2.454   1.357  -9.846
  187    H3'   DG  17           H3'       DG  17   0.073   2.585  -8.809
  188    H2'   DG  17           H2'       DG  17  -0.926   3.611  -7.032
  189   H2''   DG  17          H2"        DG  17  -2.179   4.285  -8.111
  190    H1'   DG  17           H1'       DG  17  -3.655   2.618  -7.620
  191    H8    DG  17           8H        DG  17  -4.839   2.015  -5.443
  192    H1    DG  17           1H        DG  17   0.636   2.216  -2.255
  193    H21   DG  17           1H2       DG  17   2.349   2.466  -3.661
  194    H22   DG  17           2H2       DG  17   2.075   2.685  -5.362
  195    H5'   DG  18           H5'       DG  18  -5.761   3.305  -9.633
  196   H5''   DG  18          H5"        DG  18  -5.134   4.307 -10.959
  197    H4'   DG  18           H4'       DG  18  -6.197   5.558  -9.002
  198    H3'   DG  18           H3'       DG  18  -3.422   6.134 -10.029
  199    H2'   DG  18           H2'       DG  18  -2.908   7.433  -8.188
  200   H2''   DG  18          H2"        DG  18  -4.562   8.115  -8.127
  201    H1'   DG  18           H1'       DG  18  -5.189   6.607  -6.553
  202    H8    DG  18           8H        DG  18  -1.448   6.100  -7.374
  203    H1    DG  18           1H        DG  18  -3.024   4.967  -1.260
  204    H21   DG  18           1H2       DG  18  -5.349   5.031  -1.095
  205    H22   DG  18           2H2       DG  18  -6.372   5.366  -2.462
  206    H5'   DA  19           H5'       DA  19  -1.906   8.457 -12.772
  207   H5''   DA  19          H5"        DA  19  -1.785   7.074 -11.666
  208    H4'   DA  19           H4'       DA  19   0.231   8.463 -11.554
  209    H3'   DA  19           H3'       DA  19  -1.357   7.864  -9.242
  210    H2'   DA  19           H2"       DA  19  -1.640  10.069  -8.557
  211   H2''   DA  19          H2'        DA  19   0.099   9.943  -8.095
  212    H1'   DA  19           H1'       DA  19   0.856  10.845 -10.103
  213    H8    DA  19           8H        DA  19  -0.871  12.394  -7.735
  214    H61   DA  19           2H6       DA  19  -2.454  16.551  -9.662
  215    H62   DA  19           1H6       DA  19  -2.658  17.125 -11.303
  216    H2    DA  19           2H        DA  19  -1.340  13.768 -13.983
  217    H5'   DA  20           H5'       DA  20   3.212   7.060  -7.975
  218   H5''   DA  20          H5"        DA  20   3.170   6.288  -6.380
  219    H4'   DA  20           H4'       DA  20   3.564   8.863  -6.538
  220    H3'   DA  20           H3'       DA  20   1.472   7.652  -4.678
  221    H2'   DA  20           H2'       DA  20   1.109   9.858  -3.848
  222   H2''   DA  20          H2"        DA  20   2.621  10.478  -4.592
  223    H1'   DA  20           H1'       DA  20   1.218  11.045  -6.337
  224    H8    DA  20           8H        DA  20  -0.512   7.700  -6.182
  225    H61   DA  20           2H6       DA  20  -5.057   9.295  -5.746
  226    H62   DA  20           1H6       DA  20  -5.766  10.881  -5.536
  227    H2    DA  20           2H        DA  20  -2.325  13.771  -5.375
  228    H5'   DG  21           H5'       DG  21   7.074   8.211  -6.063
  229   H5''   DG  21          H5"        DG  21   6.427   7.236  -7.393
  230    H4'   DG  21           H4'       DG  21   8.396   6.300  -5.952
  231    H3'   DG  21           H3'       DG  21   6.391   4.891  -7.360
  232    H2'   DG  21           H2'       DG  21   5.146   4.227  -5.484
  233   H2''   DG  21          H2"        DG  21   6.390   2.941  -5.444
  234    H1'   DG  21           H1'       DG  21   7.683   4.054  -3.841
  235    H8    DG  21           8H        DG  21   7.158   4.131  -1.309
  236    H1    DG  21           1H        DG  21   0.953   5.235  -2.335
  237    H21   DG  21           1H2       DG  21   0.571   5.511  -4.533
  238    H22   DG  21           2H2       DG  21   1.854   5.465  -5.716
  239    H5'   DG  22           H5'       DG  22   9.695   3.148  -4.973
  240   H5''   DG  22          H5"        DG  22  10.402   1.559  -5.321
  241    H4'   DG  22           H4'       DG  22  10.066   2.096  -2.869
  242    H3'   DG  22           H3'       DG  22   9.512  -0.398  -4.191
  243    H2'   DG  22           H2'       DG  22   7.227  -0.429  -3.650
  244   H2''   DG  22          H2"        DG  22   7.848  -0.947  -2.047
  245    H1'   DG  22           H1'       DG  22   7.849   1.250  -1.207
  246    H8    DG  22           8H        DG  22   5.421   1.766  -4.216
  247    H1    DG  22           1H        DG  22   2.668   1.152   1.564
  248    H21   DG  22           1H2       DG  22   4.225   0.676   3.013
  249    H22   DG  22           2H2       DG  22   5.914   0.518   2.644
  250    H5'   DG  23           H5'       DG  23   8.557  -2.123   0.045
  251   H5''   DG  23          H5"        DG  23   9.082  -0.452   0.339
  252    H4'   DG  23           H4'       DG  23  10.311  -1.178   2.341
  253    H3'   DG  23           H3'       DG  23  10.297  -3.763   1.324
  254    H2'   DG  23           H2'       DG  23   7.966  -4.139   1.740
  255   H2''   DG  23          H2"        DG  23   8.699  -4.746   3.264
  256    H1'   DG  23           H1'       DG  23   8.379  -2.681   4.358
  257    H8    DG  23           8H        DG  23   6.186  -3.062   5.625
  258    H1    DG  23           1H        DG  23   2.783  -2.372   0.295
  259    H21   DG  23           1H2       DG  23   4.071  -2.113  -1.460
  260    H22   DG  23           2H2       DG  23   5.802  -2.141  -1.344
  261    H5'   DG  24           H5'       DG  24  10.678  -6.701   5.911
  262   H5''   DG  24          H5"        DG  24   9.315  -6.863   4.790
  263    H4'   DG  24           H4'       DG  24   9.216  -5.631   7.567
  264    H3'   DG  24           H3'       DG  24   9.180  -8.309   7.081
  265   HO3'   DG  24          H3T        DG  24   8.837  -7.131   9.127
  266    H2'   DG  24           H2'       DG  24   7.425  -8.303   5.493
  267   H2''   DG  24          H2"        DG  24   6.498  -8.602   7.002
  268    H1'   DG  24           H1'       DG  24   5.840  -6.376   7.196
  269    H8    DG  24           8H        DG  24   7.253  -6.369   3.565
  270    H1    DG  24           1H        DG  24   0.896  -5.641   4.076
  271    H21   DG  24           1H2       DG  24   0.295  -5.895   6.244
  272    H22   DG  24           2H2       DG  24   1.459  -6.216   7.504