*HEADER   RIBONUCLEIC ACID                        12-DEC-96   1TOB    
*TITLE    SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE             
*TITLE   2 ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES          
*COMPND   MOL_ID: 1;                                                  
*COMPND  2 MOLECULE: RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3');      
*COMPND  3 CHAIN: NULL;                                               
*COMPND  4 ENGINEERED: YES                                            
*SOURCE   MOL_ID: 1;                                                  
*SOURCE  2 SYNTHETIC: YES                                             
*KEYWDS   RIBONUCLEIC ACID                                            
*EXPDTA   NMR, 7 STRUCTURES                                           
*AUTHOR   L.JIANG,A.K.SURI,R.FIALA,D.J.PATEL                          
*REVDAT  1   16-JUN-97 1TOB    0                                      

assi (resi   4 and name h8   and segi RNA1) (resi   3 and name h1'  and segi RNA1)  3.74  0.56  0.56 
assi (resi   4 and name h8   and segi RNA1) (resi   4 and name h1'  and segi RNA1)  3.55  0.53  0.53 
assi (resi   5 and name h6   and segi RNA1) (resi   4 and name h1'  and segi RNA1)  3.79  0.57  0.57 
assi (resi   4 and name h8   and segi RNA1) (resi   5 and name h5   and segi RNA1)  3.94  0.59  0.59 
assi (resi   4 and name h1'  and segi RNA1) (resi   5 and name h5   and segi RNA1)  4.50  0.67  0.67 
assi (resi   4 and name h1'  and segi RNA1) (resi   5 and name h1'  and segi RNA1)  4.34  0.65  0.65 
assi (resi   4 and name h8   and segi RNA1) (resi   5 and name h6   and segi RNA1)  4.63  0.69  0.69 
assi (resi   5 and name h6   and segi RNA1) (resi   5 and name h1'  and segi RNA1)  3.31  0.50  0.50 
assi (resi   5 and name h6   and segi RNA1) (resi   5 and name h5   and segi RNA1)  2.40  0.36  0.36 
assi (resi   6 and name h1'  and segi RNA1) (resi   5 and name h1'  and segi RNA1)  4.06  0.61  0.61 
assi (resi   6 and name h8   and segi RNA1) (resi   6 and name h1'  and segi RNA1)  3.52  0.53  0.53 
assi (resi   7 and name h8   and segi RNA1) (resi   7 and name h1'  and segi RNA1)  3.53  0.53  0.53 
assi (resi   8 and name h8   and segi RNA1) (resi   7 and name h1'  and segi RNA1)  3.84  0.58  0.58 
assi (resi   8 and name h8   and segi RNA1) (resi   8 and name h1'  and segi RNA1)  3.69  0.55  0.55 
assi (resi   9 and name h8   and segi RNA1) (resi   8 and name h1'  and segi RNA1)  3.87  1.55  1.55 
assi (resi   9 and name h8   and segi RNA1) (resi   9 and name h1'  and segi RNA1)  3.71  0.56  0.56 
assi (resi   9 and name h8   and segi RNA1) (resi  10 and name h5   and segi RNA1)  3.80  0.57  0.57 
assi (resi  10 and name h6   and segi RNA1) (resi   9 and name h8   and segi RNA1)  4.70  0.70  0.70 
assi (resi  10 and name h1'  and segi RNA1) (resi  10 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  10 and name h6   and segi RNA1) (resi  10 and name h5   and segi RNA1)  2.43  0.36  0.36 
assi (resi  11 and name h6   and segi RNA1) (resi  11 and name h2'' and segi RNA1)  3.35  0.50  0.50 
assi (resi  11 and name h6   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  3.38  0.51  0.51 
assi (resi  11 and name h1'  and segi RNA1) (resi  11 and name h2'' and segi RNA1)  2.65  0.40  0.40 
assi (resi  12 and name h6   and segi RNA1) (resi  11 and name h2'' and segi RNA1)  2.36  0.35  0.35 
assi (resi  12 and name h6   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  3.53  0.88  0.88 
assi (resi  11 and name h6   and segi RNA1) (resi  12 and name h5   and segi RNA1)  3.58  0.54  0.54 
assi (resi  12 and name h1'  and segi RNA1) (resi  11 and name h2'' and segi RNA1)  3.58  0.54  0.54 
assi (resi  12 and name h6   and segi RNA1) (resi  12 and name h1'  and segi RNA1)  3.35  0.50  0.50 
assi (resi  13 and name h8   and segi RNA1) (resi  12 and name h4'  and segi RNA1)  3.84  0.58  0.58 
assi (resi  13 and name h8   and segi RNA1) (resi  12 and name h3'  and segi RNA1)  3.49  0.52  0.52 
assi (resi  13 and name h8   and segi RNA1) (resi  13 and name h1'  and segi RNA1)  3.52  0.53  0.53 
assi (resi   1 and name h2'' and segi RNA1) (resi   1 and name h1'  and segi RNA1)  2.87  0.43  0.43 
assi (resi  14 and name h8   and segi RNA1) (resi  13 and name h1'  and segi RNA1)  3.76  0.56  0.56 
assi (resi  13 and name h8   and segi RNA1) (resi  14 and name h8   and segi RNA1)  4.59  0.69  0.69 
assi (resi  14 and name h1'  and segi RNA1) (resi  14 and name h3'  and segi RNA1)  3.35  0.50  0.50 
assi (resi  14 and name h8   and segi RNA1) (resi  14 and name h1'  and segi RNA1)  3.59  0.54  0.54 
assi (resi  14 and name h8   and segi RNA1) (resi  14 and name h2'' and segi RNA1)  3.12  0.47  0.47 
assi (resi  14 and name h8   and segi RNA1) (resi  14 and name h3'  and segi RNA1)  2.53  0.38  0.38 
assi (resi  16 and name h5   and segi RNA1) (resi  14 and name h3'  and segi RNA1)  3.91  0.59  0.59 
assi (resi  16 and name h6   and segi RNA1) (resi  14 and name h1'  and segi RNA1)  4.11  0.62  0.62 
assi (resi  15 and name h6   and segi RNA1) (resi  15 and name h5   and segi RNA1)  2.40  0.36  0.36 
assi (resi  15 and name h1'  and segi RNA1) (resi  15 and name h3'  and segi RNA1)  3.46  0.52  0.52 
assi (resi  15 and name h6   and segi RNA1) (resi  15 and name h1'  and segi RNA1)  2.59  0.39  0.39 
assi (resi  16 and name h6   and segi RNA1) (resi  15 and name h1'  and segi RNA1)  3.93  0.59  0.59 
assi (resi  15 and name h1'  and segi RNA1) (resi  16 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h6   and segi RNA1) (resi  16 and name h5   and segi RNA1)  2.45  0.37  0.37 
assi (resi  17 and name h8   and segi RNA1) (resi  17 and name h1'  and segi RNA1)  3.40  0.51  0.51 
assi (resi  18 and name h6   and segi RNA1) (resi  17 and name h1'  and segi RNA1)  3.82  0.57  0.57 
assi (resi  18 and name h6   and segi RNA1) (resi  18 and name h5   and segi RNA1)  2.67  0.40  0.40 
assi (resi  19 and name h1'  and segi RNA1) (resi  19 and name h4'  and segi RNA1)  3.16  0.47  0.47 
assi (resi  19 and name h1'  and segi RNA1) (resi  20 and name h1'  and segi RNA1)  3.97  0.60  0.60 
assi (resi  20 and name h6   and segi RNA1) (resi  19 and name h1'  and segi RNA1)  3.81  1.52  1.52 
assi (resi  20 and name h6   and segi RNA1) (resi  20 and name h5   and segi RNA1)  2.49  0.37  0.37 
assi (resi  23 and name h8   and segi RNA1) (resi  22 and name h1'  and segi RNA1)  3.46  0.52  0.52 
assi (resi  23 and name h8   and segi RNA1) (resi  23 and name h1'  and segi RNA1)  3.36  0.50  0.50 
assi (resi  23 and name h8   and segi RNA1) (resi  24 and name h5   and segi RNA1)  3.77  0.57  0.57 
assi (resi  23 and name h1'  and segi RNA1) (resi  24 and name h5   and segi RNA1)  4.15  0.62  0.62 
assi (resi  24 and name h1'  and segi RNA1) (resi  24 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  24 and name h6   and segi RNA1) (resi  24 and name h5   and segi RNA1)  2.47  0.37  0.37 
assi (resi   2 and name h1   and segi RNA1) (resi  25 and name h1   and segi RNA1)  4.92  1.23  1.23 
assi (resi  23 and name h1   and segi RNA1) (resi   4 and name h2   and segi RNA1)  4.45  1.11  1.11 
assi (resi  24 and name h3   and segi RNA1) (resi   4 and name h2   and segi RNA1)  2.93  0.73  0.73 
assi (resi  25 and name h1   and segi RNA1) (resi   4 and name h2   and segi RNA1)  4.93  1.23  1.23 
assi (resi  23 and name h1   and segi RNA1) (resi   5 and name h5   and segi RNA1)  4.46  1.11  1.11 
assi (resi   6 and name h1   and segi RNA1) (resi   7 and name h2   and segi RNA1)  4.31  1.08  1.08 
assi (resi   6 and name h1   and segi RNA1) (resi  21 and name h3   and segi RNA1)  5.39  1.35  1.11 
assi (resi   6 and name h1   and segi RNA1) (resi  23 and name h1   and segi RNA1)  5.26  1.31  1.24 
assi (resi  21 and name h3   and segi RNA1) (resi   7 and name h2   and segi RNA1)  3.03  0.76  0.76 
assi (resi   8 and name h1   and segi RNA1) (resi  21 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  21 and name h3   and segi RNA1) (resi   8 and name h1   and segi RNA1)  4.68  1.17  1.17 
assi (resi   9 and name h1   and segi RNA1) (resi  10 and name h6   and segi RNA1)  4.12  1.03  1.03 
assi (resi  10 and name h3   and segi RNA1) (resi   9 and name h1   and segi RNA1)  4.03  1.01  1.01 
assi (resi   9 and name h1   and segi RNA1) (resi  17 and name h2   and segi RNA1)  3.76  0.94  0.94 
assi (resi   9 and name h1   and segi RNA1) (resi  18 and name h5   and segi RNA1)  5.30  1.32  1.20 
assi (resi  10 and name h3   and segi RNA1) (resi  10 and name h6   and segi RNA1)  5.45  1.36  1.05 
assi (resi  10 and name h3   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  4.06  1.01  1.01 
assi (resi  11 and name h3   and segi RNA1) (resi  10 and name h5   and segi RNA1)  5.48  1.37  1.37 
assi (resi  10 and name h3   and segi RNA1) (resi  11 and name h3   and segi RNA1)  4.72  1.18  1.18 
assi (resi  10 and name h3   and segi RNA1) (resi  17 and name h2   and segi RNA1)  3.16  0.79  0.79 
assi (resi  11 and name h3   and segi RNA1) (resi  11 and name h5   and segi RNA1)  5.14  1.28  1.28 
assi (resi  11 and name h3   and segi RNA1) (resi  12 and name h3   and segi RNA1)  4.45  1.11  1.11 
assi (resi  11 and name h3   and segi RNA1) (resi  16 and name h3   and segi RNA1)  3.00  0.75  0.75 
assi (resi  11 and name h3   and segi RNA1) (resi  17 and name h2   and segi RNA1)  5.38  1.34  1.12 
assi (resi  12 and name h3   and segi RNA1) (resi  12 and name h1'  and segi RNA1)  5.04  1.26  1.26 
assi (resi  12 and name h3   and segi RNA1) (resi  13 and name h3'  and segi RNA1)  4.13  1.03  1.03 
assi (resi  12 and name h3   and segi RNA1) (resi  12 and name h5   and segi RNA1)  4.78  1.20  1.20 
assi (resi  12 and name h2'  and segi RNA1) (resi  12 and name h2'' and segi RNA1)  2.93  0.73  0.73 
assi (resi  12 and name h2'  and segi RNA1) (resi  12 and name h1'  and segi RNA1)  3.21  0.80  0.80 
assi (resi  12 and name h2'  and segi RNA1) (resi  12 and name h4'  and segi RNA1)  4.22  1.05  1.05 
assi (resi  12 and name h2'  and segi RNA1) (resi  12 and name h3'  and segi RNA1)  3.74  0.94  0.94 
assi (resi  12 and name h2'  and segi RNA1) (resi  13 and name h8   and segi RNA1)  4.36  1.09  1.09 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h3'  and segi RNA1)  3.11  0.78  0.78 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h8   and segi RNA1)  3.91  0.98  0.98 
assi (resi  12 and name h2'  and segi RNA1) (resi  14 and name h8   and segi RNA1)  3.80  0.95  0.95 
assi (resi  12 and name h3   and segi RNA1) (resi  16 and name h5   and segi RNA1)  4.14  1.03  1.03 
assi (resi  16 and name h3   and segi RNA1) (resi  16 and name h5   and segi RNA1)  5.09  1.27  1.27 
assi (resi  11 and name h3   and segi RNA1) (resi  16 and name h5   and segi RNA1)  5.42  1.35  1.08 
assi (resi  16 and name h3   and segi RNA1) (resi  12 and name h1'  and segi RNA1)  4.10  1.02  1.02 
assi (resi  12 and name h3   and segi RNA1) (resi  16 and name h3   and segi RNA1)  5.11  1.28  1.28 
assi (resi  16 and name h3   and segi RNA1) (resi  16 and name h1'  and segi RNA1)  4.54  1.14  1.14 
assi (resi  21 and name h3   and segi RNA1) (resi  21 and name h5   and segi RNA1)  4.04  1.01  1.01 
assi (resi  24 and name h3   and segi RNA1) (resi  23 and name h1   and segi RNA1)  3.91  0.98  0.98 
assi (resi   6 and name h1   and segi RNA1) (resi   6 and name h22  and segi RNA1)  2.96  1.04  1.04 
assi (resi   6 and name h1   and segi RNA1) (resi   6 and name h21  and segi RNA1)  3.04  1.06  1.06 
assi (resi  25 and name h1   and segi RNA1) (resi  25 and name h22  and segi RNA1)  2.89  1.01  1.01 
assi (resi  25 and name h1   and segi RNA1) (resi  25 and name h21  and segi RNA1)  2.94  1.03  1.03 
assi (resi  23 and name h1   and segi RNA1) (resi  23 and name h22  and segi RNA1)  2.87  1.00  1.00 
assi (resi  25 and name h1   and segi RNA1) (resi   3 and name h42  and segi RNA1)  3.23  1.13  1.13 
assi (resi  25 and name h1   and segi RNA1) (resi   3 and name h41  and segi RNA1)  2.98  1.04  1.04 
assi (resi  23 and name h1   and segi RNA1) (resi   5 and name h41  and segi RNA1)  2.70  0.95  0.95 
assi (resi  23 and name h1   and segi RNA1) (resi   5 and name h42  and segi RNA1)  3.24  1.13  1.13 
assi (resi  24 and name h3   and segi RNA1) (resi   5 and name h41  and segi RNA1)  3.89  1.36  1.36 
assi (resi   6 and name h1   and segi RNA1) (resi  22 and name h41  and segi RNA1)  3.06  1.07  1.07 
assi (resi   6 and name h1   and segi RNA1) (resi  22 and name h42  and segi RNA1)  3.34  1.17  1.17 
assi (resi   8 and name h1   and segi RNA1) (resi  20 and name h41  and segi RNA1)  3.08  1.08  1.08 
assi (resi   8 and name h1   and segi RNA1) (resi  20 and name h42  and segi RNA1)  3.14  1.10  1.10 
assi (resi   9 and name h1   and segi RNA1) (resi  18 and name h42  and segi RNA1)  3.17  1.11  1.11 
assi (resi   9 and name h1   and segi RNA1) (resi  18 and name h41  and segi RNA1)  3.08  1.08  1.08 
assi (resi  10 and name h3   and segi RNA1) (resi  18 and name h42  and segi RNA1)  5.09  1.78  1.78 
assi (resi  10 and name h3   and segi RNA1) (resi  18 and name h41  and segi RNA1)  4.76  1.66  1.66 
assi (resi  18 and name h41  and segi RNA1) (resi  18 and name h5   and segi RNA1)  3.54  1.24  1.24 
assi (resi  20 and name h41  and segi RNA1) (resi  19 and name h1'  and segi RNA1)  5.30  1.86  1.86 
assi (resi  20 and name h41  and segi RNA1) (resi  20 and name h5   and segi RNA1)  3.93  1.38  1.38 
assi (resi  21 and name h3   and segi RNA1) (resi  22 and name h42  and segi RNA1)  4.65  1.63  1.63 
assi (resi  21 and name h3   and segi RNA1) (resi  22 and name h41  and segi RNA1)  4.54  1.59  1.59 
assi (resi  15 and name h42  and segi RNA1) (resi  15 and name h5   and segi RNA1)  3.46  1.21  1.21 
assi (resi  15 and name h41  and segi RNA1) (resi  15 and name h5   and segi RNA1)  3.12  1.09  1.09 
assi (resi  16 and name h3   and segi RNA1) (resi  17 and name h61  and segi RNA1)  5.79  2.03  2.03 
assi (resi  23 and name h1   and segi RNA1) (resi   4 and name h62  and segi RNA1)  4.02  1.41  1.41 
assi (resi  24 and name h3   and segi RNA1) (resi   4 and name h62  and segi RNA1)  3.31  1.16  1.16 
assi (resi  24 and name h3   and segi RNA1) (resi   4 and name h61  and segi RNA1)  3.30  1.15  1.15 
assi (resi  25 and name h1   and segi RNA1) (resi   4 and name h62  and segi RNA1)  3.79  1.33  1.33 
assi (resi  10 and name h3   and segi RNA1) (resi  17 and name h61  and segi RNA1)  3.45  1.21  1.21 
assi (resi  10 and name h3   and segi RNA1) (resi  17 and name h62  and segi RNA1)  3.56  1.25  1.25 
assi (resi  11 and name h3   and segi RNA1) (resi  17 and name h61  and segi RNA1)  4.00  1.40  1.40 
assi (resi  11 and name h3   and segi RNA1) (resi  17 and name h62  and segi RNA1)  3.97  1.39  1.39 
assi (resi  13 and name h6%  and segi RNA1) (resi  14 and name h1   and segi RNA1)  5.26  1.31  1.24 
assi (resi  10 and name h1'  and segi RNA1) (resi  11 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h5   and segi RNA1) (resi  15 and name h4'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  11 and name h5   and segi RNA1) (resi  10 and name h5   and segi RNA1)  3.40  1.60  1.60 
assi (resi  11 and name h5   and segi RNA1) (resi  12 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  17 and name h2   and segi RNA1) (resi  17 and name h3'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   4 and name h2   and segi RNA1) (resi   4 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi  19 and name h3'  and segi RNA1) (resi  19 and name h4'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h5   and segi RNA1) (resi  11 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  12 and name h5   and segi RNA1) (resi  11 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi  19 and name h2'' and segi RNA1) (resi  19 and name h4'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   5 and name h5   and segi RNA1) (resi   4 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h5   and segi RNA1) (resi   5 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  14 and name h3'  and segi RNA1) (resi  14 and name h4'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  11 and name h3'  and segi RNA1) (resi  11 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  16 and name h1'  and segi RNA1) (resi  16 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi  13 and name h1'  and segi RNA1) (resi  13 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h1'  and segi RNA1) (resi  12 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h1'  and segi RNA1) (resi  12 and name h4'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h1'  and segi RNA1) (resi  16 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h1'  and segi RNA1) (resi  12 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h6   and segi RNA1) (resi  12 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h6   and segi RNA1) (resi  12 and name h5   and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h6   and segi RNA1) (resi  15 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   5 and name h1'  and segi RNA1) (resi   4 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  20 and name h6   and segi RNA1) (resi  19 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi   9 and name h1'  and segi RNA1) (resi   9 and name h4'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   9 and name h1'  and segi RNA1) (resi   9 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   9 and name h1'  and segi RNA1) (resi   9 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  21 and name h6   and segi RNA1) (resi  21 and name h5   and segi RNA1)  2.65  0.85  0.85 
assi (resi  21 and name h6   and segi RNA1) (resi  21 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  21 and name h6   and segi RNA1) (resi  20 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  18 and name h6   and segi RNA1) (resi  17 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  16 and name h6   and segi RNA1) (resi  14 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h1'  and segi RNA1) (resi  16 and name h5'  and segi RNA1)  3.40  3.38  3.38 
assi (resi  10 and name h6   and segi RNA1) (resi   9 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   5 and name h6   and segi RNA1) (resi   4 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h6   and segi RNA1) (resi   5 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  19 and name h1'  and segi RNA1) (resi  19 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi  14 and name h8   and segi RNA1) (resi  12 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   1 and name h8   and segi RNA1) (resi   1 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   6 and name h8   and segi RNA1) (resi   5 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   6 and name h8   and segi RNA1) (resi   5 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   8 and name h8   and segi RNA1) (resi   7 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi   9 and name h8   and segi RNA1) (resi   8 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi   9 and name h8   and segi RNA1) (resi   9 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   9 and name h8   and segi RNA1) (resi   9 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi  21 and name h5   and segi RNA1) (resi  20 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi  12 and name h4'  and segi RNA1) (resi  12 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  20 and name h5   and segi RNA1) (resi  21 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h4'  and segi RNA1) (resi  16 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi   5 and name h4'  and segi RNA1) (resi   5 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h4'  and segi RNA1) (resi   5 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  11 and name h5   and segi RNA1) (resi  11 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  14 and name h2'' and segi RNA1) (resi  14 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  14 and name h2'' and segi RNA1) (resi  14 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  18 and name h2'' and segi RNA1) (resi  18 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  18 and name h2'' and segi RNA1) (resi  18 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h2'' and segi RNA1) (resi  15 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h2'' and segi RNA1) (resi  15 and name h5   and segi RNA1)  3.40  1.60  1.60 
assi (resi  15 and name h2'' and segi RNA1) (resi  15 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi   6 and name h2'' and segi RNA1) (resi   7 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h2'' and segi RNA1) (resi   6 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h2'' and segi RNA1) (resi   5 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   4 and name h2'' and segi RNA1) (resi   4 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  16 and name h3'  and segi RNA1) (resi  16 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  17 and name h3'  and segi RNA1) (resi  18 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  16 and name h3'  and segi RNA1) (resi  17 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h2'' and segi RNA1) (resi  12 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h2'' and segi RNA1) (resi  14 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  12 and name h2'' and segi RNA1) (resi  13 and name h8   and segi RNA1)  3.40  1.60  1.60 
assi (resi  23 and name h3'  and segi RNA1) (resi  23 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  20 and name h3'  and segi RNA1) (resi  20 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi   6 and name h3'  and segi RNA1) (resi   6 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   6 and name h3'  and segi RNA1) (resi   6 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  22 and name h5   and segi RNA1) (resi  22 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h3'  and segi RNA1) (resi   5 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi   3 and name h5   and segi RNA1) (resi   3 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi   5 and name h3'  and segi RNA1) (resi   5 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  11 and name h3'  and segi RNA1) (resi  11 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  13 and name h3'  and segi RNA1) (resi  13 and name h8   and segi RNA1)  3.40  1.60  1.60 
assi (resi  13 and name h3'  and segi RNA1) (resi  14 and name h8   and segi RNA1)  3.40  1.60  1.60 
assi (resi  16 and name h1'  and segi RNA1) (resi  16 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  18 and name h3'  and segi RNA1) (resi  18 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  21 and name h1'  and segi RNA1) (resi  22 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  22 and name h1'  and segi RNA1) (resi  22 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi  23 and name h1'  and segi RNA1) (resi  24 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h4'  and segi RNA1) (resi  15 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h4'  and segi RNA1) (resi  16 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h4'  and segi RNA1) (resi  15 and name h3'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h4'  and segi RNA1) (resi  15 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  14 and name h4'  and segi RNA1) (resi  14 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  18 and name h4'  and segi RNA1) (resi  18 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  17 and name h4'  and segi RNA1) (resi  17 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  13 and name h4'  and segi RNA1) (resi  13 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  11 and name h4'  and segi RNA1) (resi  11 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  15 and name h1'  and segi RNA1) (resi  15 and name h5'  and segi RNA1)  3.88  0.88  0.88 
assi (resi  15 and name h1'  and segi RNA1) (resi  15 and name h5'' and segi RNA1)  3.88  0.88  0.88 
assi (resi  15 and name h5   and segi RNA1) (resi  15 and name h5'  and segi RNA1)  3.97  0.91  0.91 
assi (resi  15 and name h5   and segi RNA1) (resi  15 and name h5'' and segi RNA1)  3.97  0.91  0.91 
assi (resi   9 and name O6   and segi RNA1) (resi  18 and name H41  and segi RNA1)  2.00  0.20  0.20 
assi (resi   9 and name H1   and segi RNA1) (resi  18 and name N3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   9 and name H21  and segi RNA1) (resi  18 and name O2   and segi RNA1)  2.00  0.20  0.20 
assi (resi   9 and name O6   and segi RNA1) (resi  18 and name N4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   9 and name N1   and segi RNA1) (resi  18 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   9 and name N2   and segi RNA1) (resi  18 and name O2   and segi RNA1)  2.91  0.17  0.17 
assi (resi  10 and name O4   and segi RNA1) (resi  17 and name H61  and segi RNA1)  2.00  0.20  0.20 
assi (resi  10 and name H3   and segi RNA1) (resi  17 and name N1   and segi RNA1)  2.00  0.20  0.20 
assi (resi  10 and name O4   and segi RNA1) (resi  17 and name N6   and segi RNA1)  2.91  0.17  0.17 
assi (resi  10 and name N3   and segi RNA1) (resi  17 and name N1   and segi RNA1)  2.95  0.20  0.20 
assi (resi  17 and name h2   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  2.65  0.80  0.80 
assi (resi   4 and name h2   and segi RNA1) (resi   5 and name h1'  and segi RNA1)  3.04  0.91  0.91 
assi (resi   4 and name h2   and segi RNA1) (resi  24 and name h1'  and segi RNA1)  4.57  1.37  1.37 
assi (resi   4 and name h2   and segi RNA1) (resi  25 and name h1'  and segi RNA1)  3.04  0.91  0.91 
assi (resi   7 and name h2   and segi RNA1) (resi   7 and name h1'  and segi RNA1)  4.47  1.34  1.34 
assi (resi   7 and name h2   and segi RNA1) (resi   7 and name h2'' and segi RNA1)  3.76  1.13  1.13 
assi (resi   7 and name h2   and segi RNA1) (resi   8 and name h1'  and segi RNA1)  3.57  1.07  1.07 
assi (resi   7 and name h2   and segi RNA1) (resi  21 and name h1'  and segi RNA1)  4.18  1.25  1.25 
assi (resi   7 and name h2   and segi RNA1) (resi  22 and name h1'  and segi RNA1)  3.25  0.98  0.98 
assi (resi   1 and name h8   and segi RNA1) (resi   1 and name h2'' and segi RNA1)  3.22  0.97  0.97 
assi (resi  13 and name h2   and segi RNA1) (resi  14 and name h1'  and segi RNA1)  3.36  1.01  1.01 
assi (resi  16 and name h3   and segi RNA1) (resi  17 and name h1'  and segi RNA1)  4.48  1.12  1.12 
assi (resi  15 and name h5   and segi RNA1) (resi  15 and name h3'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  17 and name h8   and segi RNA1) (resi  16 and name h1'  and segi RNA1)  3.15  1.35  1.35 
assi (resi   5 and name h6   and segi RNA1) (resi   6 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi   8 and name h8   and segi RNA1) (resi   9 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  10 and name h6   and segi RNA1) (resi  11 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi  16 and name h6   and segi RNA1) (resi  17 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  17 and name h8   and segi RNA1) (resi  18 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi  20 and name h6   and segi RNA1) (resi  21 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi  23 and name h8   and segi RNA1) (resi  24 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi  14 and name h8   and segi RNA1) (resi  16 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi   7 and name h8   and segi RNA1) (resi   6 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  10 and name h6   and segi RNA1) (resi  11 and name h5   and segi RNA1)  4.75  1.75  1.75 
assi (resi  22 and name h5   and segi RNA1) (resi  23 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  12 and name h6   and segi RNA1) (resi  14 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  17 and name h8   and segi RNA1) (resi  16 and name h5   and segi RNA1)  4.75  1.75  1.75 
assi (resi  16 and name h5   and segi RNA1) (resi  15 and name h6   and segi RNA1)  5.25  2.25  2.25 
assi (resi  16 and name h6   and segi RNA1) (resi  15 and name h6   and segi RNA1)  5.25  2.25  2.25 
assi (resi  21 and name h5   and segi RNA1) (resi  22 and name h6   and segi RNA1)  5.25  2.25  2.25 
assi (resi  12 and name h6   and segi RNA1) (resi  13 and name h8   and segi RNA1)  5.25  2.25  2.25 
assi (resi  17 and name h2   and segi RNA1) (resi  18 and name h6   and segi RNA1)  5.25  2.25  2.25 
assi (resi  21 and name h6   and segi RNA1) (resi  22 and name h6   and segi RNA1)  5.25  2.25  2.25 
assi (resi   4 and name h8   and segi RNA1) (resi   3 and name h6   and segi RNA1)  4.75  1.75  1.75 
assi (resi  22 and name h6   and segi RNA1) (resi  23 and name h8   and segi RNA1)  4.75  1.75  1.75 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h2'' and segi RNA1)  4.22  1.06  1.06 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h5'  and segi RNA1)  4.22  2.84  2.84 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h5'' and segi RNA1)  4.22  2.84  2.84 
assi (resi  13 and name h6+  and segi RNA1) (resi  14 and name h2+  and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h6   and segi RNA1) (resi  16 and name h5'  and segi RNA1)  2.65  2.63  2.63 
assi (resi  14 and name h1   and segi RNA1) (resi  16 and name h4'  and segi RNA1)  4.76  1.19  1.19 
assi (resi  12 and name h3   and segi RNA1) (resi  14 and name h4'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  12 and name h3   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  12 and name h3   and segi RNA1) (resi  13 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  12 and name h3   and segi RNA1) (resi  16 and name h6   and segi RNA1)  4.89  1.22  1.22 
assi (resi  16 and name h3   and segi RNA1) (resi  12 and name h5   and segi RNA1)  5.10  1.27  1.27 
assi (resi  12 and name h2'  and segi RNA1) (resi  16 and name h1'  and segi RNA1)  3.84  0.96  0.96 
assi (resi  21 and name h3   and segi RNA1) (resi  22 and name h6   and segi RNA1)  5.30  1.32  1.32 
assi (resi  10 and name h3   and segi RNA1) (resi  11 and name h5   and segi RNA1)  5.32  1.33  1.33 
assi (resi  10 and name h3   and segi RNA1) (resi  10 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  21 and name h3   and segi RNA1) (resi  22 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi  24 and name h3   and segi RNA1) (resi  25 and name h8   and segi RNA1)  4.15  2.35  2.35 
assi (resi  24 and name h3   and segi RNA1) (resi  24 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi   9 and name h1   and segi RNA1) (resi  10 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  11 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  12 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  11 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  10 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  12 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi  11 and name h3   and segi RNA1) (resi  12 and name h5   and segi RNA1)  5.15  1.29  1.29 
assi (resi  11 and name h3   and segi RNA1) (resi  11 and name h1'  and segi RNA1)  5.15  1.29  1.29 
assi (resi  23 and name h1   and segi RNA1) (resi  24 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h3   and segi RNA1) (resi  10 and name h3   and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h3   and segi RNA1) (resi  17 and name h2   and segi RNA1)  4.15  2.35  2.35 
assi (resi  16 and name h3   and segi RNA1) (resi  17 and name h8   and segi RNA1)  4.92  1.23  1.23 
assi (resi  10 and name h1'  and segi RNA1) (resi  10 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi  10 and name h1'  and segi RNA1) (resi  11 and name h6   and segi RNA1)  4.15  2.35  2.35 
assi (resi   1 and name h8   and segi RNA1) (resi   1 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   1 and name h8   and segi RNA1) (resi   1 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   1 and name h8   and segi RNA1) (resi   1 and name h2'' and segi RNA1)  4.15  2.35  2.35 
assi (resi   1 and name h1'  and segi RNA1) (resi   1 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi   1 and name h1'  and segi RNA1) (resi   1 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   1 and name h1'  and segi RNA1) (resi   1 and name h4'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   1 and name h1'  and segi RNA1) (resi   1 and name h5'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   1 and name h1'  and segi RNA1) (resi   1 and name h5'' and segi RNA1)  4.15  2.35  2.35 
assi (resi   2 and name h8   and segi RNA1) (resi   1 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi   2 and name h8   and segi RNA1) (resi   1 and name h3'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   3 and name h6   and segi RNA1) (resi   2 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   3 and name h6   and segi RNA1) (resi   3 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi   9 and name h8   and segi RNA1) (resi  29 and name h21  and segi DRG1)  4.14  0.62  0.62 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h21  and segi DRG1)  3.57  0.54  0.54 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h5   and segi DRG1)  3.70  0.56  0.56 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h4   and segi DRG1)  4.56  0.68  0.68 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h1   and segi DRG1)  3.65  0.55  0.55 
assi (resi  29 and name h3   and segi DRG1) (resi  29 and name h21  and segi DRG1)  2.69  0.40  0.40 
assi (resi  29 and name h4   and segi DRG1) (resi  29 and name h21  and segi DRG1)  2.50  0.38  0.38 
assi (resi  29 and name h5   and segi DRG1) (resi  29 and name h21  and segi DRG1)  3.44  0.52  0.52 
assi (resi  30 and name h1   and segi DRG1) (resi  29 and name h21  and segi DRG1)  4.41  0.66  0.66 
assi (resi  30 and name h1   and segi DRG1) (resi  29 and name h4   and segi DRG1)  2.51  0.38  0.38 
assi (resi  28 and name h1   and segi DRG1) (resi  29 and name h21  and segi DRG1)  3.72  0.56  0.56 
assi (resi  28 and name h1   and segi DRG1) (resi  29 and name h5   and segi DRG1)  3.19  0.48  0.48 
assi (resi  30 and name h4   and segi DRG1) (resi  30 and name h31  and segi DRG1)  2.54  0.38  0.38 
assi (resi  30 and name h5   and segi DRG1) (resi  30 and name h31  and segi DRG1)  2.42  0.36  0.36 
assi (resi  30 and name h2   and segi DRG1) (resi  30 and name h31  and segi DRG1)  2.53  0.38  0.38 
assi (resi  30 and name h1   and segi DRG1) (resi  30 and name h31  and segi DRG1)  3.49  0.52  0.52 
assi (resi  28 and name h1   and segi DRG1) (resi  28 and name h3   and segi DRG1)  3.15  0.47  0.47 
assi (resi  28 and name h1   and segi DRG1) (resi  28 and name h4   and segi DRG1)  3.51  0.53  0.53 
assi (resi  10 and name h3   and segi RNA1) (resi  29 and name h5   and segi DRG1)  5.46  1.36  1.04 
assi (resi  11 and name h3   and segi RNA1) (resi  29 and name h5   and segi DRG1)  4.91  1.23  1.23 
assi (resi  12 and name h3   and segi RNA1) (resi  30 and name h31  and segi DRG1)  4.98  1.25  1.25 
assi (resi  12 and name h3   and segi RNA1) (resi  30 and name h2   and segi DRG1)  4.61  1.15  1.15 
assi (resi  29 and name h1%  and segi DRG1) (resi  29 and name h21  and segi DRG1)  4.28  2.48  1.07 
assi (resi  29 and name h1%  and segi DRG1) (resi  29 and name h5   and segi DRG1)  5.18  3.38  1.29 
assi (resi  30 and name h2%  and segi DRG1) (resi  29 and name h5   and segi DRG1)  4.63  2.83  1.16 
assi (resi  30 and name h2%  and segi DRG1) (resi  30 and name h1   and segi DRG1)  4.38  2.58  1.09 
assi (resi  30 and name h2%  and segi DRG1) (resi  30 and name h31  and segi DRG1)  4.14  2.34  1.03 
assi (resi  30 and name h2%  and segi DRG1) (resi  30 and name h2   and segi DRG1)  3.67  1.87  0.92 
assi (resi  11 and name h3   and segi RNA1) (resi  30 and name h2%  and segi DRG1)  4.40  2.60  1.10 
assi (resi  12 and name h3   and segi RNA1) (resi  30 and name h2%  and segi DRG1)  4.24  2.44  1.06 
assi (resi  17 and name h61  and segi RNA1) (resi  29 and name h5   and segi DRG1)  3.83  1.34  1.34 
assi (resi  17 and name h62  and segi RNA1) (resi  29 and name h5   and segi DRG1)  3.86  1.35  1.35 
assi (resi  30 and name h61  and segi DRG1) (resi  30 and name h31  and segi DRG1)  3.64  1.84  2.33 
assi (resi  30 and name h62  and segi DRG1) (resi  30 and name h31  and segi DRG1)  4.33  2.53  2.43 
assi (resi  29 and name h4   and segi DRG1) (resi  30 and name h62  and segi DRG1)  3.41  1.61  2.29 
assi (resi  30 and name h5   and segi DRG1) (resi  30 and name h62  and segi DRG1)  2.60  0.80  2.17 
assi (resi  30 and name h4   and segi DRG1) (resi  30 and name h62  and segi DRG1)  2.48  0.68  2.15 
assi (resi  30 and name h1   and segi DRG1) (resi  30 and name h62  and segi DRG1)  3.94  2.14  2.37 
assi (resi  28 and name h1   and segi DRG1) (resi  28 and name h62  and segi DRG1)  4.88  2.51  2.51 
assi (resi  28 and name h4   and segi DRG1) (resi  28 and name h62  and segi DRG1)  2.56  0.76  2.16 
assi (resi  15 and name h6   and segi RNA1) (resi  28 and name h62  and segi DRG1)  4.20  2.40  2.41 
assi (resi  15 and name h1'  and segi RNA1) (resi  28 and name h62  and segi DRG1)  3.82  2.02  2.35 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h62  and segi DRG1)  4.39  2.59  2.44 
assi (resi  28 and name h5   and segi DRG1) (resi  28 and name h62  and segi DRG1)  2.13  0.33  2.10 
assi (resi  28 and name h61  and segi DRG1) (resi  28 and name h4   and segi DRG1)  2.56  1.02  1.02 
assi (resi  28 and name h2   and segi DRG1) (resi  28 and name h4   and segi DRG1)  2.31  0.92  0.92 
assi (resi  28 and name h5   and segi DRG1) (resi  28 and name h4   and segi DRG1)  2.35  0.94  0.94 
assi (resi  28 and name h3   and segi DRG1) (resi  28 and name h4   and segi DRG1)  2.45  0.98  0.98 
assi (resi  29 and name h4   and segi DRG1) (resi  29 and name h5   and segi DRG1)  2.62  1.05  1.05 
assi (resi  29 and name h3   and segi DRG1) (resi  29 and name h5   and segi DRG1)  2.33  0.93  0.93 
assi (resi  30 and name h5   and segi DRG1) (resi  30 and name h61  and segi DRG1)  2.31  2.70  2.70 
assi (resi  30 and name h4   and segi DRG1) (resi  30 and name h61  and segi DRG1)  1.99  2.58  2.58 
assi (resi  30 and name h2   and segi DRG1) (resi  30 and name h62  and segi DRG1)  2.92  2.95  2.95 
assi (resi  28 and name h1   and segi DRG1) (resi  29 and name h4   and segi DRG1)  2.94  1.18  1.18 
assi (resi  29 and name h6   and segi DRG1) (resi  29 and name h21  and segi DRG1)  2.62  1.05  1.05 
assi (resi  29 and name h1   and segi DRG1) (resi  29 and name h21  and segi DRG1)  2.70  1.08  1.08 
assi (resi  30 and name h1   and segi DRG1) (resi  29 and name h3   and segi DRG1)  3.26  1.30  1.30 
assi (resi  30 and name h1   and segi DRG1) (resi  29 and name h5   and segi DRG1)  3.13  1.25  1.25 
assi (resi  30 and name h1   and segi DRG1) (resi  30 and name h5   and segi DRG1)  2.88  1.15  1.15 
assi (resi  30 and name h1   and segi DRG1) (resi  30 and name h4   and segi DRG1)  2.87  1.14  1.14 
assi (resi  30 and name h1   and segi DRG1) (resi  30 and name h61  and segi DRG1)  3.79  3.30  3.30 
assi (resi  18 and name h6   and segi RNA1) (resi  18 and name h1'  and segi RNA1)  3.79  1.52  1.52 
assi (resi   4 and name h2   and segi RNA1) (resi   4 and name h1'  and segi RNA1)  3.71  1.48  1.48 
assi (resi  20 and name h6   and segi RNA1) (resi  20 and name h1'  and segi RNA1)  4.15  2.35  2.35 
assi (resi   7 and name h8   and segi RNA1) (resi   6 and name h1'  and segi RNA1)  3.43  1.37  1.37 
assi (resi  17 and name h2   and segi RNA1) (resi  18 and name h1'  and segi RNA1)  3.20  1.28  1.28 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h2   and segi DRG1)  3.74  1.50  1.50 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h5   and segi DRG1)  4.30  1.72  1.72 
assi (resi  15 and name h5   and segi RNA1) (resi  28 and name h61  and segi DRG1)  3.94  3.36  3.36 
assi (resi  15 and name h1'  and segi RNA1) (resi  28 and name h2   and segi DRG1)  4.32  1.73  1.73 
assi (resi  15 and name h1'  and segi RNA1) (resi  28 and name h61  and segi DRG1)  3.02  2.99  2.99 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h3   and segi DRG1)  2.73  1.09  1.09 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h1   and segi DRG1)  3.33  1.33  1.33 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h4   and segi DRG1)  3.39  1.36  1.36 
assi (resi  10 and name h5   and segi RNA1) (resi  29 and name h6   and segi DRG1)  3.47  1.39  1.39 
assi (resi  19 and name h4'  and segi RNA1) (resi  20 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi  19 and name h3'  and segi RNA1) (resi  19 and name h1'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  19 and name h4'  and segi RNA1) (resi  20 and name h5   and segi RNA1)  3.40  1.60  1.60 
assi (resi  19 and name h1'  and segi RNA1) (resi  20 and name h5   and segi RNA1)  2.65  0.85  0.85 
assi (resi  20 and name h6   and segi RNA1) (resi  20 and name h5'  and segi RNA1)  3.40  3.38  3.38 
assi (resi  18 and name h42  and segi RNA1) (resi  28 and name h4   and segi DRG1)  4.14  1.03  1.03 
assi (resi  18 and name h42  and segi RNA1) (resi  28 and name h3   and segi DRG1)  3.47  0.87  0.87 
assi (resi  18 and name h41  and segi RNA1) (resi  28 and name h3   and segi DRG1)  3.78  0.94  0.94 
assi (resi  18 and name h41  and segi RNA1) (resi  17 and name h61  and segi RNA1)  4.15  2.35  2.35 
assi (resi  18 and name h42  and segi RNA1) (resi  17 and name h62  and segi RNA1)  4.15  2.35  2.35 
assi (resi  18 and name h41  and segi RNA1) (resi  17 and name h62  and segi RNA1)  4.15  2.35  2.35 
assi (resi  20 and name h41  and segi RNA1) (resi  21 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  21 and name h3   and segi RNA1) (resi  20 and name h41  and segi RNA1)  4.15  2.35  2.35 
assi (resi  12 and name h1'  and segi RNA1) (resi  13 and name h8   and segi RNA1)  4.15  2.35  2.35 
assi (resi  20 and name h6   and segi RNA1) (resi  21 and name h5   and segi RNA1)  4.15  2.35  2.35 
assi (resi  23 and name h8   and segi RNA1) (resi  22 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi  23 and name h3'  and segi RNA1) (resi  24 and name h5   and segi RNA1)  2.65  0.85  0.85 
assi (resi  23 and name h3'  and segi RNA1) (resi  24 and name h6   and segi RNA1)  2.65  0.85  0.85 
assi (resi  23 and name h3'  and segi RNA1) (resi  23 and name h1'  and segi RNA1)  2.65  0.85  0.85 
assi (resi  11 and name h4'  and segi RNA1) (resi  11 and name h6   and segi RNA1)  3.40  1.60  1.60 
assi (resi   1 and name h1'  and segi RNA1) (resi   2 and name h8   and segi RNA1)  3.40  1.60  1.60 
assi (resi  10 and name h5   and segi RNA1) (resi   9 and name h3'  and segi RNA1)  3.40  1.60  1.60 
assi (resi  15 and name h6   and segi RNA1) (resi  28 and name h4   and segi DRG1)  4.15  2.35  2.35 
assi (resi  20 and name h1'  and segi RNA1) (resi  20 and name h2'' and segi RNA1)  2.65  0.85  0.85 
assi (resi   8 and name h1'  and segi RNA1) (resi   7 and name h2   and segi RNA1)  4.15  2.35  2.35 
assi (resi  18 and name h41  and segi RNA1) (resi  28 and name ho4  and segi DRG1)  4.15  2.35  2.35 
assi (resi  18 and name h42  and segi RNA1) (resi  28 and name ho4  and segi DRG1)  4.15  2.35  2.35 
assi (resi  17 and name h61  and segi RNA1) (resi  28 and name ho6  and segi DRG1)  4.15  2.35  2.35 
assi (resi  17 and name h62  and segi RNA1) (resi  28 and name ho6  and segi DRG1)  4.15  2.35  2.35 
assi (resi  19 and name h2   and segi RNA1) (resi  20 and name h41  and segi RNA1)  5.25  0.75  0.75 
assi (resi  19 and name h2   and segi RNA1) (resi  20 and name h42  and segi RNA1)  5.25  0.75  0.75 
assi (resi  19 and name h2   and segi RNA1) (resi  28 and name h3   and segi DRG1)  5.75  0.75  0.75 
assi (resi  19 and name h2   and segi RNA1) (resi   8 and name h1   and segi RNA1)  5.50  1.00  1.00 
assi (resi  19 and name h2   and segi RNA1) (resi   9 and name h1   and segi RNA1)  5.00  0.50  0.50 
assi (resi  19 and name h2   and segi RNA1) (resi  18 and name h5   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  18 and name h6   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  20 and name h5   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  20 and name h6   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  21 and name h5   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  21 and name h6   and segi RNA1) 54.50 50.00 50.00 
assi (resi  19 and name h2   and segi RNA1) (resi  19 and name h1'  and segi RNA1)  4.87  1.46  1.46 
assi (resi  19 and name h2   and segi RNA1) (resi  20 and name h1'  and segi RNA1)  3.89  1.17  1.17 
assi (resi  19 and name h8   and segi RNA1) (resi  18 and name h2'' and segi RNA1)  3.40  1.60  1.60 
assi (resi  19 and name h8   and segi RNA1) (resi  19 and name h1'  and segi RNA1)  3.85  0.58  0.58 
assi (resi  19 and name h8   and segi RNA1) (resi  19 and name h4'  and segi RNA1)  4.48  0.67  0.67 
assi (resi  19 and name h2'' and segi RNA1) (resi  19 and name h8   and segi RNA1)  2.65  0.85  0.85 
assi (resi  19 and name h3'  and segi RNA1) (resi  19 and name h8   and segi RNA1)  3.40  1.60  1.60 
assi (resi  18 and name h6   and segi RNA1) (resi  19 and name h8   and segi RNA1)  5.50  1.00  1.00 
assi (resi  19 and name h8   and segi RNA1) (resi  20 and name h6   and segi RNA1)  5.50  1.00  1.00 
assi (resi  19 and name h8   and segi RNA1) (resi  18 and name h1'  and segi RNA1)  5.50  1.00  1.00 
assi (resi  19 and name h8   and segi RNA1) (resi  20 and name h5   and segi RNA1)  5.50  1.00  1.00 
assi (resi   1 and name O6   and segi RNA1) (resi  27 and name H41  and segi RNA1)  2.00  0.20  0.20 
assi (resi   1 and name H1   and segi RNA1) (resi  27 and name N3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   1 and name H21  and segi RNA1) (resi  27 and name O2   and segi RNA1)  2.00  0.20  0.20 
assi (resi   2 and name O6   and segi RNA1) (resi  26 and name H41  and segi RNA1)  2.00  0.20  0.20 
assi (resi   2 and name H1   and segi RNA1) (resi  26 and name N3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   2 and name H21  and segi RNA1) (resi  26 and name O2   and segi RNA1)  2.00  0.20  0.20 
assi (resi   3 and name H41  and segi RNA1) (resi  25 and name O6   and segi RNA1)  2.00  0.20  0.20 
assi (resi   3 and name N3   and segi RNA1) (resi  25 and name H1   and segi RNA1)  2.00  0.20  0.20 
assi (resi   3 and name O2   and segi RNA1) (resi  25 and name H21  and segi RNA1)  2.00  0.20  0.20 
assi (resi   4 and name H61  and segi RNA1) (resi  24 and name O4   and segi RNA1)  2.00  0.20  0.20 
assi (resi   4 and name N1   and segi RNA1) (resi  24 and name H3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   5 and name H41  and segi RNA1) (resi  23 and name O6   and segi RNA1)  2.00  0.20  0.20 
assi (resi   5 and name N3   and segi RNA1) (resi  23 and name H1   and segi RNA1)  2.00  0.20  0.20 
assi (resi   5 and name O2   and segi RNA1) (resi  23 and name H21  and segi RNA1)  2.00  0.20  0.20 
assi (resi   6 and name O6   and segi RNA1) (resi  22 and name H41  and segi RNA1)  2.00  0.20  0.20 
assi (resi   6 and name H1   and segi RNA1) (resi  22 and name N3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   6 and name H21  and segi RNA1) (resi  22 and name O2   and segi RNA1)  2.00  0.20  0.20 
assi (resi   7 and name H61  and segi RNA1) (resi  21 and name O4   and segi RNA1)  2.00  0.20  0.20 
assi (resi   7 and name N1   and segi RNA1) (resi  21 and name H3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   8 and name O6   and segi RNA1) (resi  20 and name H41  and segi RNA1)  2.00  0.20  0.20 
assi (resi   8 and name H1   and segi RNA1) (resi  20 and name N3   and segi RNA1)  2.00  0.20  0.20 
assi (resi   8 and name H21  and segi RNA1) (resi  20 and name O2   and segi RNA1)  2.00  0.20  0.20 
assi (resi   1 and name O6   and segi RNA1) (resi  27 and name N4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   1 and name N1   and segi RNA1) (resi  27 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   1 and name N2   and segi RNA1) (resi  27 and name O2   and segi RNA1)  2.91  0.17  0.17 
assi (resi   2 and name O6   and segi RNA1) (resi  26 and name N4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   2 and name N1   and segi RNA1) (resi  26 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   2 and name N2   and segi RNA1) (resi  26 and name O2   and segi RNA1)  2.91  0.17  0.17 
assi (resi   3 and name N4   and segi RNA1) (resi  25 and name O6   and segi RNA1)  2.91  0.17  0.17 
assi (resi   3 and name N3   and segi RNA1) (resi  25 and name N1   and segi RNA1)  2.95  0.20  0.20 
assi (resi   3 and name O2   and segi RNA1) (resi  25 and name N2   and segi RNA1)  2.91  0.17  0.17 
assi (resi   4 and name N6   and segi RNA1) (resi  24 and name O4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   4 and name N1   and segi RNA1) (resi  24 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   5 and name N4   and segi RNA1) (resi  23 and name O6   and segi RNA1)  2.91  0.17  0.17 
assi (resi   5 and name N3   and segi RNA1) (resi  23 and name N1   and segi RNA1)  2.95  0.20  0.20 
assi (resi   5 and name O2   and segi RNA1) (resi  23 and name N2   and segi RNA1)  2.91  0.17  0.17 
assi (resi   6 and name O6   and segi RNA1) (resi  22 and name N4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   6 and name N1   and segi RNA1) (resi  22 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   6 and name N2   and segi RNA1) (resi  22 and name O2   and segi RNA1)  2.91  0.17  0.17 
assi (resi   7 and name N6   and segi RNA1) (resi  21 and name O4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   7 and name N1   and segi RNA1) (resi  21 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   8 and name O6   and segi RNA1) (resi  20 and name N4   and segi RNA1)  2.91  0.17  0.17 
assi (resi   8 and name N1   and segi RNA1) (resi  20 and name N3   and segi RNA1)  2.95  0.20  0.20 
assi (resi   8 and name N2   and segi RNA1) (resi  20 and name O2   and segi RNA1)  2.91  0.17  0.17 


  Entry H atom name         Submitted Coord H atom name
  Start of MODEL    1
    1   1H5*    G   1          1H5*        G   1   5.209 -18.680  -8.335
    2   2H5*    G   1          2H5*        G   1   6.266 -18.728  -6.879
    3    H4*    G   1           H4*        G   1   7.436 -18.333  -9.083
    4    H3*    G   1           H3*        G   1   7.269 -16.017  -7.239
    5   1H2*    G   1          1H2*        G   1   7.516 -14.561  -8.615
    6   2HO*    G   1          2HO*        G   1   9.306 -14.607 -10.135
    7    H1*    G   1           H1*        G   1   8.004 -16.543 -10.853
    8    H8     G   1           H8         G   1   4.632 -15.020 -10.869
    9    H1     G   1           H1         G   1   8.879 -10.932 -13.367
   10   1H2     G   1          1H2         G   1  10.968 -11.621 -12.914
   11   2H2     G   1          2H2         G   1  11.306 -13.095 -12.026
   12    H5T    G   1           H5T        G   1   5.714 -16.554  -6.498
   13   1H5*    G   2          1H5*        G   2  11.335 -15.507  -8.471
   14   2H5*    G   2          2H5*        G   2  12.346 -15.353  -6.989
   15    H4*    G   2           H4*        G   2  12.665 -13.603  -8.823
   16    H3*    G   2           H3*        G   2  11.223 -12.582  -6.382
   17   1H2*    G   2          1H2*        G   2  10.708 -10.806  -7.278
   18   2HO*    G   2          2HO*        G   2  12.980 -10.064  -7.089
   19    H1*    G   2           H1*        G   2  11.994 -11.683  -9.874
   20    H8     G   2           H8         G   2   8.249 -12.044  -9.303
   21    H1     G   2           H1         G   2   9.800  -6.412 -11.908
   22   1H2     G   2          1H2         G   2  12.031  -6.090 -11.742
   23   2H2     G   2          2H2         G   2  13.116  -7.335 -11.152
   24   1H5*    C   3          1H5*        C   3  15.097 -10.032  -6.998
   25   2H5*    C   3          2H5*        C   3  15.634  -9.666  -5.318
   26    H4*    C   3           H4*        C   3  15.691  -7.673  -6.838
   27    H3*    C   3           H3*        C   3  13.218  -7.646  -5.085
   28   1H2*    C   3          1H2*        C   3  12.845  -5.487  -5.736
   29   2HO*    C   3          2HO*        C   3  14.453  -4.226  -6.147
   30    H1*    C   3           H1*        C   3  13.654  -5.935  -8.260
   31   1H4     C   3          1H4         C   3   7.354  -5.771  -8.870
   32   2H4     C   3          2H4         C   3   7.126  -7.309  -8.058
   33    H5     C   3           H5         C   3   9.045  -8.606  -7.202
   34    H6     C   3           H6         C   3  11.463  -8.561  -6.841
   35   1H5*    A   4          1H5*        A   4  15.589  -4.052  -4.503
   36   2H5*    A   4          2H5*        A   4  15.478  -3.628  -2.757
   37    H4*    A   4           H4*        A   4  15.084  -1.692  -4.280
   38    H3*    A   4           H3*        A   4  12.483  -2.801  -3.169
   39   1H2*    A   4          1H2*        A   4  11.492  -0.834  -4.074
   40   2HO*    A   4          2HO*        A   4  12.642   0.861  -4.102
   41    H1*    A   4           H1*        A   4  12.555  -0.983  -6.272
   42    H8     A   4           H8         A   4  11.769  -4.323  -4.702
   43   1H6     A   4          1H6         A   4   6.155  -3.824  -7.276
   44   2H6     A   4          2H6         A   4   7.228  -4.868  -6.370
   45    H2     A   4           H2         A   4   8.401   0.001  -7.981
   46   1H5*    C   5          1H5*        C   5  13.013   1.426  -2.009
   47   2H5*    C   5          2H5*        C   5  12.256   1.725  -0.402
   48    H4*    C   5           H4*        C   5  11.539   3.185  -2.336
   49    H3*    C   5           H3*        C   5   9.375   1.285  -1.487
   50   1H2*    C   5          1H2*        C   5   7.940   2.278  -2.870
   51   2HO*    C   5          2HO*        C   5   8.154   4.257  -3.357
   52    H1*    C   5           H1*        C   5   9.561   2.010  -4.945
   53   1H4     C   5          1H4         C   5   6.484  -3.560  -4.022
   54   2H4     C   5          2H4         C   5   7.811  -4.110  -3.013
   55    H5     C   5           H5         C   5   9.611  -2.556  -2.266
   56    H6     C   5           H6         C   5  10.437  -0.214  -2.511
   57   1H5*    G   6          1H5*        G   6   7.596   5.148  -1.404
   58   2H5*    G   6          2H5*        G   6   6.402   5.370  -0.078
   59    H4*    G   6           H4*        G   6   5.718   5.718  -2.611
   60    H3*    G   6           H3*        G   6   4.419   3.392  -1.205
   61   1H2*    G   6          1H2*        G   6   2.914   3.276  -3.106
   62   2HO*    G   6          2HO*        G   6   3.216   5.590  -3.750
   63    H1*    G   6           H1*        G   6   5.035   2.874  -4.548
   64    H8     G   6           H8         G   6   6.783   1.292  -1.745
   65    H1     G   6           H1         G   6   1.248  -1.736  -2.716
   66   1H2     G   6          1H2         G   6  -0.094  -0.461  -4.040
   67   2H2     G   6          2H2         G   6   0.359   1.148  -4.551
   68   1H5*    A   7          1H5*        A   7  -0.234   6.968  -1.825
   69   2H5*    A   7          2H5*        A   7  -0.329   6.282  -0.172
   70    H4*    A   7           H4*        A   7   0.831   4.961  -2.713
   71    H3*    A   7           H3*        A   7  -1.717   4.564  -1.151
   72   1H2*    A   7          1H2*        A   7  -1.477   2.552  -0.992
   73   2HO*    A   7          2HO*        A   7  -1.243   1.150  -2.728
   74    H1*    A   7           H1*        A   7   0.984   2.709  -2.699
   75    H8     A   7           H8         A   7   2.916   2.314  -0.246
   76   1H6     A   7          1H6         A   7   1.170  -3.202   1.878
   77   2H6     A   7          2H6         A   7   2.483  -2.052   1.733
   78    H2     A   7           H2         A   7  -2.082  -1.727  -0.812
   79   1H5*    G   8          1H5*        G   8  -2.962   2.951  -5.804
   80   2H5*    G   8          2H5*        G   8  -4.550   3.806  -5.762
   81    H4*    G   8           H4*        G   8  -4.551   1.372  -6.583
   82    H3*    G   8           H3*        G   8  -5.818   1.870  -3.856
   83   1H2*    G   8          1H2*        G   8  -6.561  -0.357  -3.843
   84   2HO*    G   8          2HO*        G   8  -5.773  -1.625  -5.793
   85    H1*    G   8           H1*        G   8  -4.119  -1.274  -4.407
   86    H8     G   8           H8         G   8  -3.375   1.915  -2.479
   87    H1     G   8           H1         G   8  -5.157  -2.963   1.250
   88   1H2     G   8          1H2         G   8  -6.008  -4.612  -0.024
   89   2H2     G   8          2H2         G   8  -5.962  -4.581  -1.771
   90   1H5*    G   9          1H5*        G   9  -9.966   3.303  -2.915
   91   2H5*    G   9          2H5*        G   9  -8.411   2.799  -2.180
   92    H4*    G   9           H4*        G   9 -11.069   1.237  -2.405
   93    H3*    G   9           H3*        G   9  -9.674   2.641  -0.111
   94   1H2*    G   9          1H2*        G   9 -10.805   1.150   1.347
   95   2HO*    G   9          2HO*        G   9 -12.726   0.989   0.082
   96    H1*    G   9           H1*        G   9  -9.840  -0.971   0.037
   97    H8     G   9           H8         G   9  -7.242   1.516  -0.948
   98    H1     G   9           H1         G   9  -6.453  -0.107   5.160
   99   1H2     G   9          1H2         G   9  -8.211  -1.321   5.899
  100   2H2     G   9          2H2         G   9  -9.667  -1.542   4.948
  101   1H5*    U  10          1H5*        U  10 -13.413   4.419   3.180
  102   2H5*    U  10          2H5*        U  10 -11.631   4.193   3.103
  103    H4*    U  10           H4*        U  10 -13.869   2.137   3.692
  104    H3*    U  10           H3*        U  10 -11.874   3.596   5.439
  105   1H2*    U  10          1H2*        U  10 -11.511   1.727   6.769
  106   2HO*    U  10          2HO*        U  10 -13.538   0.923   6.828
  107    H1*    U  10           H1*        U  10 -10.995   0.118   4.746
  108    H3     U  10           H3         U  10  -7.222   2.410   6.604
  109    H5     U  10           H5         U  10  -7.976   3.850   2.701
  110    H6     U  10           H6         U  10 -10.042   2.730   2.762
  111   1H5*    U  11          1H5*        U  11 -12.887   0.914   9.761
  112   2H5*    U  11          2H5*        U  11 -14.011   2.212  10.258
  113    H4*    U  11           H4*        U  11 -11.590   2.130  11.180
  114    H3*    U  11           H3*        U  11 -11.988   4.593   9.453
  115   1H2*    U  11          1H2*        U  11  -9.965   5.303  10.572
  116   2HO*    U  11          2HO*        U  11  -9.578   4.523  12.452
  117    H1*    U  11           H1*        U  11  -8.833   3.027  10.146
  118    H3     U  11           H3         U  11  -6.661   5.778   7.437
  119    H5     U  11           H5         U  11 -10.429   5.495   5.563
  120    H6     U  11           H6         U  11 -11.167   4.156   7.440
  121   1H5*    U  12          1H5*        U  12 -10.961   5.276  13.871
  122   2H5*    U  12          2H5*        U  12 -11.760   6.820  14.347
  123    H4*    U  12           H4*        U  12  -9.259   6.586  14.957
  124    H3*    U  12           H3*        U  12  -9.753   8.424  12.656
  125   1H2*    U  12          1H2*        U  12  -7.606   9.205  12.941
  126   2HO*    U  12          2HO*        U  12  -6.298   8.496  14.553
  127    H1*    U  12           H1*        U  12  -6.712   6.684  12.748
  128    H3     U  12           H3         U  12  -6.061   8.773   8.742
  129    H5     U  12           H5         U  12 -10.186   7.902   8.803
  130    H6     U  12           H6         U  12  -9.895   7.213  11.118
  131   1H5*    A  13          1H5*        A  13 -11.309  12.602  12.435
  132   2H5*    A  13          2H5*        A  13 -11.421  11.354  11.146
  133    H4*    A  13           H4*        A  13 -10.074  13.565  10.763
  134    H3*    A  13           H3*        A  13  -9.202  11.196   9.736
  135   1H2*    A  13          1H2*        A  13  -8.337  10.650  11.819
  136   2HO*    A  13          2HO*        A  13  -6.249  11.481  10.055
  137    H1*    A  13           H1*        A  13  -6.879  13.338  11.713
  138    H8     A  13           H8         A  13  -8.480  10.923  14.426
  139   1H6     A  13          1H6         A  13  -3.268  11.965  17.589
  140   2H6     A  13          2H6         A  13  -4.811  11.136  17.578
  141    H2     A  13           H2         A  13  -2.970  14.159  13.694
  142   1H5*    G  14          1H5*        G  14  -5.572  12.883  10.424
  143   2H5*    G  14          2H5*        G  14  -4.795  14.403   9.926
  144    H4*    G  14           H4*        G  14  -2.894  13.036   9.148
  145    H3*    G  14           H3*        G  14  -4.592  10.656   9.965
  146   1H2*    G  14          1H2*        G  14  -2.505   9.481  10.151
  147   2HO*    G  14          2HO*        G  14  -0.720  10.371   9.447
  148    H1*    G  14           H1*        G  14  -1.513  11.550  11.566
  149    H8     G  14           H8         G  14  -5.241  10.231  11.964
  150    H1     G  14           H1         G  14  -1.222   8.828  16.744
  151   1H2     G  14          1H2         G  14   1.168  10.481  14.807
  152   2H2     G  14          2H2         G  14   0.816   9.624  16.290
  153   1H5*    C  15          1H5*        C  15  -0.262   9.954   5.616
  154   2H5*    C  15          2H5*        C  15  -1.940   9.316   5.663
  155    H4*    C  15           H4*        C  15  -1.435   8.737   8.034
  156    H3*    C  15           H3*        C  15   0.595  10.450   8.109
  157   1H2*    C  15          1H2*        C  15   1.813   9.518   6.568
  158   2HO*    C  15          2HO*        C  15   3.518   8.186   7.548
  159    H1*    C  15           H1*        C  15   1.300   6.608   7.462
  160   1H4     C  15          1H4         C  15   2.633   6.830   0.985
  161   2H4     C  15          2H4         C  15   4.237   6.806   1.662
  162    H5     C  15           H5         C  15   0.613   7.187   2.429
  163    H6     C  15           H6         C  15  -0.113   7.374   4.799
  164   1H5*    U  16          1H5*        U  16   1.588   6.806  12.209
  165   2H5*    U  16          2H5*        U  16   0.265   7.029  11.021
  166    H4*    U  16           H4*        U  16   0.181   6.829  14.101
  167    H3*    U  16           H3*        U  16  -0.728   5.082  11.805
  168   1H2*    U  16          1H2*        U  16  -2.461   4.223  13.129
  169   2HO*    U  16          2HO*        U  16  -1.251   4.187  15.054
  170    H1*    U  16           H1*        U  16  -3.357   6.620  13.786
  171    H3     U  16           H3         U  16  -5.773   5.002  10.133
  172    H5     U  16           H5         U  16  -2.727   7.378   8.535
  173    H6     U  16           H6         U  16  -1.717   7.481  10.715
  174   1H5*    A  17          1H5*        A  17  -0.589  -0.091  14.380
  175   2H5*    A  17          2H5*        A  17  -0.719   0.533  12.698
  176    H4*    A  17           H4*        A  17  -2.514   1.039  15.145
  177    H3*    A  17           H3*        A  17  -2.852  -1.247  13.486
  178   1H2*    A  17          1H2*        A  17  -2.653   0.011  11.695
  179   2HO*    A  17          2HO*        A  17  -5.050   0.117  11.017
  180    H1*    A  17           H1*        A  17  -4.869   1.736  12.751
  181    H8     A  17           H8         A  17  -1.751   3.368  11.263
  182   1H6     A  17          1H6         A  17  -4.947   3.640   6.011
  183   2H6     A  17          2H6         A  17  -3.510   4.142   6.867
  184    H2     A  17           H2         A  17  -7.181   0.979   9.066
  185   1H5*    C  18          1H5*        C  18  -8.463  -1.361  12.348
  186   2H5*    C  18          2H5*        C  18  -7.962  -2.651  13.487
  187    H4*    C  18           H4*        C  18  -8.077  -3.238  11.006
  188    H3*    C  18           H3*        C  18  -5.632  -3.548  12.522
  189   1H2*    C  18          1H2*        C  18  -4.477  -2.317  11.245
  190   2HO*    C  18          2HO*        C  18  -4.120  -4.828  10.570
  191    H1*    C  18           H1*        C  18  -6.306  -3.231   9.067
  192   1H4     C  18          1H4         C  18  -3.914   1.105   5.075
  193   2H4     C  18          2H4         C  18  -2.529   1.397   6.098
  194    H5     C  18           H5         C  18  -2.251   0.227   8.260
  195    H6     C  18           H6         C  18  -3.354  -1.233   9.860
  196   1H5*    A  19          1H5*        A  19  -4.010  -8.299  10.936
  197   2H5*    A  19          2H5*        A  19  -2.734  -7.184  10.351
  198    H4*    A  19           H4*        A  19  -5.683  -7.324   9.510
  199    H3*    A  19           H3*        A  19  -3.958  -9.263   8.777
  200   1H2*    A  19          1H2*        A  19  -2.375  -7.733   8.150
  201   2HO*    A  19          2HO*        A  19  -3.557  -8.242   5.547
  202    H1*    A  19           H1*        A  19  -4.410  -6.346   6.392
  203    H8     A  19           H8         A  19  -1.695  -5.335   9.052
  204   1H6     A  19          1H6         A  19   0.584  -1.981   6.348
  205   2H6     A  19          2H6         A  19   0.355  -1.417   4.705
  206    H2     A  19           H2         A  19  -3.038  -3.757   2.975
  207   1H5*    C  20          1H5*        C  20  -7.710  -7.627   6.475
  208   2H5*    C  20          2H5*        C  20  -9.364  -8.301   6.427
  209    H4*    C  20           H4*        C  20  -8.753  -9.296   4.260
  210    H3*    C  20           H3*        C  20  -6.255  -9.844   5.184
  211   1H2*    C  20          1H2*        C  20  -5.884  -7.598   5.555
  212   2HO*    C  20          2HO*        C  20  -4.666  -7.969   2.993
  213    H1*    C  20           H1*        C  20  -6.666  -7.274   2.620
  214   1H4     C  20          1H4         C  20  -4.581  -1.427   3.477
  215   2H4     C  20          2H4         C  20  -4.973  -1.360   5.180
  216    H5     C  20           H5         C  20  -5.731  -3.429   6.371
  217    H6     C  20           H6         C  20  -6.565  -5.670   6.029
  218   1H5*    U  21          1H5*        U  21  -5.671 -10.706  -0.803
  219   2H5*    U  21          2H5*        U  21  -4.060 -10.369  -0.103
  220    H4*    U  21           H4*        U  21  -6.685  -8.844   0.427
  221    H3*    U  21           H3*        U  21  -5.584  -8.758  -2.057
  222   1H2*    U  21          1H2*        U  21  -3.435  -8.336  -0.988
  223   2HO*    U  21          2HO*        U  21  -4.649  -6.297  -2.514
  224    H1*    U  21           H1*        U  21  -5.100  -6.138   0.236
  225    H3     U  21           H3         U  21  -1.000  -3.875   0.584
  226    H5     U  21           H5         U  21  -0.985  -6.870   3.524
  227    H6     U  21           H6         U  21  -2.948  -7.820   2.508
  228   1H5*    C  22          1H5*        C  22  -6.517  -3.813  -3.533
  229   2H5*    C  22          2H5*        C  22  -7.038  -4.809  -4.940
  230    H4*    C  22           H4*        C  22  -5.003  -3.162  -5.135
  231    H3*    C  22           H3*        C  22  -4.459  -6.131  -5.344
  232   1H2*    C  22          1H2*        C  22  -2.447  -5.919  -5.196
  233   2HO*    C  22          2HO*        C  22  -2.638  -3.836  -7.120
  234    H1*    C  22           H1*        C  22  -2.722  -2.910  -4.827
  235   1H4     C  22          1H4         C  22   2.150  -3.789  -0.847
  236   2H4     C  22          2H4         C  22   1.694  -5.439  -0.456
  237    H5     C  22           H5         C  22  -0.113  -6.571  -1.677
  238    H6     C  22           H6         C  22  -1.978  -6.237  -3.203
  239   1H5*    G  23          1H5*        G  23  -4.207  -1.113  -6.717
  240   2H5*    G  23          2H5*        G  23  -4.418  -1.011  -8.500
  241    H4*    G  23           H4*        G  23  -2.463   0.247  -7.468
  242    H3*    G  23           H3*        G  23  -1.396  -2.203  -8.999
  243   1H2*    G  23          1H2*        G  23   0.433  -1.591  -8.817
  244   2HO*    G  23          2HO*        G  23   0.158   0.475  -9.772
  245    H1*    G  23           H1*        G  23  -0.043   0.103  -6.696
  246    H8     G  23           H8         G  23  -0.188  -3.707  -6.072
  247    H1     G  23           H1         G  23   5.609  -1.120  -5.267
  248   1H2     G  23          1H2         G  23   5.572   1.029  -5.928
  249   2H2     G  23          2H2         G  23   4.144   1.776  -6.626
  250   1H5*    U  24          1H5*        U  24  -0.612   2.130 -10.998
  251   2H5*    U  24          2H5*        U  24  -0.394   1.710 -12.738
  252    H4*    U  24           H4*        U  24   1.375   3.253 -11.735
  253    H3*    U  24           H3*        U  24   2.320   0.401 -12.155
  254   1H2*    U  24          1H2*        U  24   4.479   1.157 -11.767
  255   2HO*    U  24          2HO*        U  24   4.963   3.086 -12.200
  256    H1*    U  24           H1*        U  24   3.732   2.473  -9.540
  257    H3     U  24           H3         U  24   6.098  -1.367  -8.467
  258    H5     U  24           H5         U  24   2.112  -2.631  -9.037
  259    H6     U  24           H6         U  24   1.582  -0.453  -9.816
  260   1H5*    G  25          1H5*        G  25   4.878   3.064 -14.143
  261   2H5*    G  25          2H5*        G  25   5.323   2.416 -15.763
  262    H4*    G  25           H4*        G  25   7.234   3.226 -14.280
  263    H3*    G  25           H3*        G  25   7.130   0.189 -14.493
  264   1H2*    G  25          1H2*        G  25   9.348   0.298 -13.507
  265   2HO*    G  25          2HO*        G  25   9.847   2.403 -14.500
  266    H1*    G  25           H1*        G  25   8.359   1.692 -11.489
  267    H8     G  25           H8         G  25   5.347  -0.336 -12.662
  268    H1     G  25           H1         G  25   9.484  -3.845  -9.293
  269   1H2     G  25          1H2         G  25  11.437  -2.737  -9.066
  270   2H2     G  25          2H2         G  25  11.668  -1.103  -9.663
  271   1H5*    C  26          1H5*        C  26  11.046   1.149 -15.373
  272   2H5*    C  26          2H5*        C  26  11.582   0.384 -16.914
  273    H4*    C  26           H4*        C  26  13.046  -0.014 -14.811
  274    H3*    C  26           H3*        C  26  11.476  -2.434 -15.843
  275   1H2*    C  26          1H2*        C  26  12.599  -3.738 -14.190
  276   2HO*    C  26          2HO*        C  26  14.594  -2.459 -14.348
  277    H1*    C  26           H1*        C  26  11.965  -2.036 -12.250
  278   1H4     C  26          1H4         C  26   7.006  -6.020 -12.763
  279   2H4     C  26          2H4         C  26   6.132  -4.884 -13.777
  280    H5     C  26           H5         C  26   7.189  -2.803 -14.583
  281    H6     C  26           H6         C  26   9.240  -1.490 -14.556
  282   1H5*    C  27          1H5*        C  27  14.579  -4.367 -14.964
  283   2H5*    C  27          2H5*        C  27  15.592  -4.925 -16.346
  284    H4*    C  27           H4*        C  27  14.964  -6.647 -14.529
  285    H3*    C  27           H3*        C  27  13.863  -6.949 -17.280
  286   1H2*    C  27          1H2*        C  27  12.210  -7.998 -16.790
  287   2HO*    C  27          2HO*        C  27  12.343 -10.046 -15.615
  288    H1*    C  27           H1*        C  27  12.990  -8.304 -13.878
  289   1H4     C  27          1H4         C  27   6.659  -9.222 -14.129
  290   2H4     C  27          2H4         C  27   6.393  -7.642 -14.847
  291    H5     C  27           H5         C  27   8.245  -6.179 -15.468
  292    H6     C  27           H6         C  27  10.669  -5.950 -15.513
  293    H3T    C  27           H3T        C  27  15.634  -8.622 -15.775
  294    H1   TOA  28           H1       TOA  28  -2.387   6.465   2.583
  295    H2   TOA  28           H2       TOA  28  -0.480   5.094   1.881
  296    H3   TOA  28           H3       TOA  28  -2.405   2.807   2.403
  297    H4   TOA  28           H4       TOA  28   0.196   3.590   3.802
  298    H5   TOA  28           H5       TOA  28  -2.662   3.583   4.773
  299   1H6   TOA  28          1H6       TOA  28  -1.706   4.660   6.720
  300   2H6   TOA  28          2H6       TOA  28  -1.054   3.014   6.564
  301    HO2  TOA  28           HO2      TOA  28  -2.222   5.782   0.362
  302    HO4  TOA  28           HO4      TOA  28  -0.285   1.712   5.210
  303    HO6  TOA  28           HO6      TOA  28   0.635   4.579   7.165
  304   1HN3  TOA  28          1H3       TOA  28  -1.226   1.790   0.861
  305   2HN3  TOA  28          2H3       TOA  28  -0.102   3.028   0.734
  306   3HN3  TOA  28          3H3       TOA  28   0.103   1.819   1.906
  307    H1   TOB  29           H1       TOB  29  -6.021   4.089   2.386
  308   1H2   TOB  29          1H2       TOB  29  -5.930   5.983   0.049
  309   2H2   TOB  29          2H2       TOB  29  -7.242   4.721   0.282
  310    H3   TOB  29           H3       TOB  29  -7.849   5.870   2.440
  311   1H4   TOB  29           H4       TOB  29  -5.840   7.935   1.455
  312    H5   TOB  29           H5       TOB  29  -5.807   6.118   3.899
  313    H6   TOB  29           H6       TOB  29  -4.068   6.214   1.419
  314   1HN1  TOB  29          1H1       TOB  29  -5.313   2.864   0.633
  315   2HN1  TOB  29          2H1       TOB  29  -4.520   4.134  -0.175
  316   3HN1  TOB  29          3H1       TOB  29  -3.876   3.491   1.246
  317   1HN3  TOB  29          1H3       TOB  29  -8.010   7.355  -0.093
  318   2HN3  TOB  29          2H3       TOB  29  -9.170   6.421   0.738
  319   3HN3  TOB  29          3H3       TOB  29  -8.705   7.935   1.345
  320    HO5  TOB  29           HO5      TOB  29  -3.632   7.074   4.276
  321    H1   TOC  30           H1       TOC  30  -5.411   9.581   3.040
  322    H2   TOC  30           H2       TOC  30  -6.317  11.170   4.690
  323   1H3   TOC  30          1H3       TOC  30  -8.698   9.398   4.779
  324   2H3   TOC  30          2H3       TOC  30  -8.435  10.796   5.845
  325    H4   TOC  30           H4       TOC  30  -8.331  12.199   3.835
  326    H5   TOC  30           H5       TOC  30  -8.981   9.625   2.331
  327   1H6   TOC  30          1H6       TOC  30  -8.760  10.970   0.279
  328   2H6   TOC  30          2H6       TOC  30 -10.089  11.591   1.301
  329   1HN2  TOC  30          1H2       TOC  30  -5.096   9.274   5.495
  330   2HN2  TOC  30          2H2       TOC  30  -6.290   9.764   6.589
  331   3HN2  TOC  30          3H2       TOC  30  -6.542   8.377   5.621
  332   1HN6  TOC  30          1H6       TOC  30  -8.547  13.270   2.143
  333   2HN6  TOC  30          2H6       TOC  30  -7.343  12.696   1.093
  334   3HN6  TOC  30          3H6       TOC  30  -8.767  13.375   0.462
  335    HO4  TOC  30           HO4      TOC  30 -10.437  11.822   4.889
   
  Start of MODEL    2
    1   1H5*    G   1          1H5*        G   1  -1.904 -19.246  -5.426
    2   2H5*    G   1          2H5*        G   1  -1.308 -19.078  -3.735
    3    H4*    G   1           H4*        G   1   0.401 -19.800  -5.456
    4    H3*    G   1           H3*        G   1   0.669 -17.060  -4.352
    5   1H2*    G   1          1H2*        G   1   1.699 -16.262  -5.907
    6   2HO*    G   1          2HO*        G   1   3.606 -17.313  -4.877
    7    H1*    G   1           H1*        G   1   1.971 -18.945  -7.285
    8    H8     G   1           H8         G   1  -0.505 -16.593  -8.787
    9    H1     G   1           H1         G   1   5.428 -15.245 -10.783
   10   1H2     G   1          1H2         G   1   6.929 -16.365  -9.522
   11   2H2     G   1          2H2         G   1   6.445 -17.379  -8.175
   12    H5T    G   1           H5T        G   1  -1.748 -16.935  -5.515
   13   1H5*    G   2          1H5*        G   2   4.919 -18.545  -4.227
   14   2H5*    G   2          2H5*        G   2   5.523 -18.225  -2.560
   15    H4*    G   2           H4*        G   2   7.008 -17.496  -4.550
   16    H3*    G   2           H3*        G   2   5.675 -15.257  -3.027
   17   1H2*    G   2          1H2*        G   2   6.154 -13.832  -4.423
   18   2HO*    G   2          2HO*        G   2   8.428 -13.887  -3.695
   19    H1*    G   2           H1*        G   2   7.440 -15.892  -6.225
   20    H8     G   2           H8         G   2   3.820 -14.806  -6.670
   21    H1     G   2           H1         G   2   7.862 -11.235 -10.097
   22   1H2     G   2          1H2         G   2   9.976 -11.596  -9.401
   23   2H2     G   2          2H2         G   2  10.386 -12.858  -8.254
   24   1H5*    C   3          1H5*        C   3  10.293 -14.481  -2.939
   25   2H5*    C   3          2H5*        C   3  10.564 -13.771  -1.307
   26    H4*    C   3           H4*        C   3  11.725 -12.507  -3.127
   27    H3*    C   3           H3*        C   3   9.139 -11.149  -2.327
   28   1H2*    C   3          1H2*        C   3   9.772  -9.318  -3.537
   29   2HO*    C   3          2HO*        C   3  11.768  -8.822  -3.742
   30    H1*    C   3           H1*        C   3  10.820 -10.767  -5.513
   31   1H4     C   3          1H4         C   3   5.232  -9.047  -7.951
   32   2H4     C   3          2H4         C   3   4.325 -10.110  -6.897
   33    H5     C   3           H5         C   3   5.440 -11.473  -5.173
   34    H6     C   3           H6         C   3   7.597 -11.998  -4.148
   35   1H5*    A   4          1H5*        A   4  12.439  -8.409  -1.924
   36   2H5*    A   4          2H5*        A   4  12.118  -7.397  -0.470
   37    H4*    A   4           H4*        A   4  12.758  -6.084  -2.495
   38    H3*    A   4           H3*        A   4   9.763  -5.969  -1.988
   39   1H2*    A   4          1H2*        A   4   9.764  -4.248  -3.677
   40   2HO*    A   4          2HO*        A   4  11.455  -3.122  -3.882
   41    H1*    A   4           H1*        A   4  11.062  -5.499  -5.304
   42    H8     A   4           H8         A   4   8.938  -7.675  -3.120
   43   1H6     A   4          1H6         A   4   4.335  -6.624  -7.118
   44   2H6     A   4          2H6         A   4   4.804  -7.494  -5.674
   45    H2     A   4           H2         A   4   7.841  -4.053  -8.249
   46   1H5*    C   5          1H5*        C   5  11.703  -2.195  -2.238
   47   2H5*    C   5          2H5*        C   5  11.071  -0.997  -1.055
   48    H4*    C   5           H4*        C   5  11.183  -0.279  -3.464
   49    H3*    C   5           H3*        C   5   8.393  -0.761  -2.505
   50   1H2*    C   5          1H2*        C   5   7.517   0.048  -4.416
   51   2HO*    C   5          2HO*        C   5   8.997   1.739  -4.790
   52    H1*    C   5           H1*        C   5   9.063  -1.539  -5.886
   53   1H4     C   5          1H4         C   5   4.130  -5.220  -4.217
   54   2H4     C   5          2H4         C   5   4.946  -5.668  -2.732
   55    H5     C   5           H5         C   5   7.104  -4.561  -2.028
   56    H6     C   5           H6         C   5   8.751  -2.816  -2.737
   57   1H5*    G   6          1H5*        G   6   6.920   3.808  -0.012
   58   2H5*    G   6          2H5*        G   6   6.769   2.045  -0.290
   59    H4*    G   6           H4*        G   6   7.201   4.313  -2.344
   60    H3*    G   6           H3*        G   6   4.796   2.640  -1.625
   61   1H2*    G   6          1H2*        G   6   3.928   3.047  -3.820
   62   2HO*    G   6          2HO*        G   6   6.456   4.317  -4.226
   63    H1*    G   6           H1*        G   6   6.165   1.982  -4.807
   64    H8     G   6           H8         G   6   6.694   0.097  -1.784
   65    H1     G   6           H1         G   6   1.284  -1.974  -4.486
   66   1H2     G   6          1H2         G   6   0.582  -0.509  -6.013
   67   2H2     G   6          2H2         G   6   1.462   0.957  -6.411
   68   1H5*    A   7          1H5*        A   7   2.460   5.965  -2.813
   69   2H5*    A   7          2H5*        A   7   1.214   6.394  -1.587
   70    H4*    A   7           H4*        A   7   0.427   5.659  -3.939
   71    H3*    A   7           H3*        A   7  -0.197   3.753  -1.655
   72   1H2*    A   7          1H2*        A   7  -1.415   2.428  -3.170
   73   2HO*    A   7          2HO*        A   7  -2.262   4.080  -4.389
   74    H1*    A   7           H1*        A   7   0.668   2.218  -4.807
   75    H8     A   7           H8         A   7   2.775   2.732  -1.920
   76   1H6     A   7          1H6         A   7   1.060  -2.696   0.477
   77   2H6     A   7          2H6         A   7   2.291  -1.449   0.488
   78    H2     A   7           H2         A   7  -1.765  -1.679  -2.836
   79   1H5*    G   8          1H5*        G   8  -5.922   4.246  -3.417
   80   2H5*    G   8          2H5*        G   8  -5.357   3.585  -1.850
   81    H4*    G   8           H4*        G   8  -5.115   2.435  -4.692
   82    H3*    G   8           H3*        G   8  -7.357   2.250  -3.211
   83   1H2*    G   8          1H2*        G   8  -6.180   1.652  -1.298
   84   2HO*    G   8          2HO*        G   8  -6.808  -1.008  -2.225
   85    H1*    G   8           H1*        G   8  -4.853  -0.537  -2.910
   86    H8     G   8           H8         G   8  -2.149   1.309  -1.733
   87    H1     G   8           H1         G   8  -4.136  -2.190   3.182
   88   1H2     G   8          1H2         G   8  -6.394  -2.800   2.818
   89   2H2     G   8          2H2         G   8  -7.062  -2.554   1.201
   90   1H5*    G   9          1H5*        G   9 -10.792   1.567  -3.721
   91   2H5*    G   9          2H5*        G   9  -9.275   1.528  -2.770
   92    H4*    G   9           H4*        G   9 -11.669  -0.433  -2.708
   93    H3*    G   9           H3*        G   9 -10.732   1.670  -0.724
   94   1H2*    G   9          1H2*        G   9 -11.826   0.387   0.969
   95   2HO*    G   9          2HO*        G   9 -12.385  -1.403  -1.196
   96    H1*    G   9           H1*        G   9 -10.387  -1.732   0.283
   97    H8     G   9           H8         G   9  -8.603   1.533  -0.893
   98    H1     G   9           H1         G   9  -6.825  -0.408   4.888
   99   1H2     G   9          1H2         G   9  -8.169  -2.072   5.601
  100   2H2     G   9          2H2         G   9  -9.367  -2.828   4.568
  101   1H5*    U  10          1H5*        U  10 -14.100   3.300   2.560
  102   2H5*    U  10          2H5*        U  10 -12.349   3.479   2.181
  103    H4*    U  10           H4*        U  10 -13.809   1.102   3.504
  104    H3*    U  10           H3*        U  10 -12.039   3.270   4.692
  105   1H2*    U  10          1H2*        U  10 -11.644   1.715   6.487
  106   2HO*    U  10          2HO*        U  10 -13.291  -0.022   4.901
  107    H1*    U  10           H1*        U  10 -10.796  -0.077   4.709
  108    H3     U  10           H3         U  10  -7.334   2.629   6.501
  109    H5     U  10           H5         U  10  -8.202   4.059   2.649
  110    H6     U  10           H6         U  10 -10.154   2.682   2.623
  111   1H5*    U  11          1H5*        U  11 -13.036   2.096   8.292
  112   2H5*    U  11          2H5*        U  11 -14.058   3.390   9.019
  113    H4*    U  11           H4*        U  11 -12.024   2.595  10.385
  114    H3*    U  11           H3*        U  11 -11.820   5.355   9.139
  115   1H2*    U  11          1H2*        U  11  -9.833   5.700  10.323
  116   2HO*    U  11          2HO*        U  11  -9.511   4.684  12.086
  117    H1*    U  11           H1*        U  11  -8.798   3.492   9.579
  118    H3     U  11           H3         U  11  -6.768   6.372   6.798
  119    H5     U  11           H5         U  11 -10.670   6.147   5.220
  120    H6     U  11           H6         U  11 -11.278   4.804   7.116
  121   1H5*    U  12          1H5*        U  12 -10.789   5.209  13.408
  122   2H5*    U  12          2H5*        U  12 -11.590   6.617  14.203
  123    H4*    U  12           H4*        U  12  -9.097   6.296  14.726
  124    H3*    U  12           H3*        U  12  -9.700   8.533  12.802
  125   1H2*    U  12          1H2*        U  12  -7.570   9.325  13.104
  126   2HO*    U  12          2HO*        U  12  -6.173   8.429  14.528
  127    H1*    U  12           H1*        U  12  -6.588   6.916  12.580
  128    H3     U  12           H3         U  12  -5.933   9.279   8.745
  129    H5     U  12           H5         U  12 -10.071   8.418   8.733
  130    H6     U  12           H6         U  12  -9.793   7.568  10.995
  131   1H5*    A  13          1H5*        A  13 -11.273  12.865  13.962
  132   2H5*    A  13          2H5*        A  13 -11.686  11.900  12.497
  133    H4*    A  13           H4*        A  13 -10.282  14.056  12.228
  134    H3*    A  13           H3*        A  13  -9.754  11.745  10.920
  135   1H2*    A  13          1H2*        A  13  -8.559  10.896  12.560
  136   2HO*    A  13          2HO*        A  13  -6.489  12.123  11.032
  137    H1*    A  13           H1*        A  13  -6.873  13.430  12.709
  138    H8     A  13           H8         A  13  -8.517  10.674  15.015
  139   1H6     A  13          1H6         A  13  -4.830  10.277  18.109
  140   2H6     A  13          2H6         A  13  -3.289  11.095  18.273
  141    H2     A  13           H2         A  13  -3.025  13.998  14.869
  142   1H5*    G  14          1H5*        G  14  -4.636  15.300  11.251
  143   2H5*    G  14          2H5*        G  14  -4.885  14.902   9.511
  144    H4*    G  14           H4*        G  14  -2.726  14.122  10.501
  145    H3*    G  14           H3*        G  14  -4.611  11.759  10.208
  146   1H2*    G  14          1H2*        G  14  -2.654  10.464  10.439
  147   2HO*    G  14          2HO*        G  14  -1.371  11.770   9.108
  148    H1*    G  14           H1*        G  14  -1.688  12.173  12.415
  149    H8     G  14           H8         G  14  -5.308  10.670  12.144
  150    H1     G  14           H1         G  14  -1.629   8.064  16.691
  151   1H2     G  14          1H2         G  14   0.413   8.980  16.645
  152   2H2     G  14          2H2         G  14   0.848  10.219  15.491
  153   1H5*    C  15          1H5*        C  15  -0.485  10.231   6.165
  154   2H5*    C  15          2H5*        C  15  -2.044   9.408   6.500
  155    H4*    C  15           H4*        C  15  -1.043   8.941   8.766
  156    H3*    C  15           H3*        C  15   0.936  10.672   8.465
  157   1H2*    C  15          1H2*        C  15   1.779   9.875   6.554
  158   2HO*    C  15          2HO*        C  15   3.055   8.644   8.717
  159    H1*    C  15           H1*        C  15   1.401   6.880   7.302
  160   1H4     C  15          1H4         C  15   0.476   7.752   0.811
  161   2H4     C  15          2H4         C  15   2.173   7.333   0.865
  162    H5     C  15           H5         C  15  -0.910   7.892   2.854
  163    H6     C  15           H6         C  15  -0.772   7.915   5.339
  164   1H5*    U  16          1H5*        U  16   1.786   6.310  12.241
  165   2H5*    U  16          2H5*        U  16   0.668   6.835  10.942
  166    H4*    U  16           H4*        U  16   0.192   6.631  13.988
  167    H3*    U  16           H3*        U  16  -0.736   5.112  11.591
  168   1H2*    U  16          1H2*        U  16  -2.711   4.413  12.867
  169   2HO*    U  16          2HO*        U  16  -1.674   6.164  14.843
  170    H1*    U  16           H1*        U  16  -3.189   6.880  13.437
  171    H3     U  16           H3         U  16  -5.708   5.419   9.694
  172    H5     U  16           H5         U  16  -2.798   8.083   8.335
  173    H6     U  16           H6         U  16  -1.695   7.933  10.463
  174   1H5*    A  17          1H5*        A  17   0.057  -0.374  13.260
  175   2H5*    A  17          2H5*        A  17  -0.237   0.469  11.708
  176    H4*    A  17           H4*        A  17  -1.509   0.982  14.465
  177    H3*    A  17           H3*        A  17  -2.339  -1.141  12.783
  178   1H2*    A  17          1H2*        A  17  -2.393   0.293  11.095
  179   2HO*    A  17          2HO*        A  17  -4.965  -0.433  12.099
  180    H1*    A  17           H1*        A  17  -4.204   2.084  12.732
  181    H8     A  17           H8         A  17  -1.474   3.648  10.768
  182   1H6     A  17          1H6         A  17  -5.290   4.176   6.001
  183   2H6     A  17          2H6         A  17  -3.780   4.664   6.726
  184    H2     A  17           H2         A  17  -7.191   1.429   9.193
  185   1H5*    C  18          1H5*        C  18  -7.919  -1.402  12.810
  186   2H5*    C  18          2H5*        C  18  -7.108  -2.736  13.691
  187    H4*    C  18           H4*        C  18  -7.737  -3.038  11.194
  188    H3*    C  18           H3*        C  18  -4.895  -3.226  12.019
  189   1H2*    C  18          1H2*        C  18  -4.142  -2.317  10.409
  190   2HO*    C  18          2HO*        C  18  -5.288  -4.313   8.670
  191    H1*    C  18           H1*        C  18  -6.714  -2.784   9.007
  192   1H4     C  18          1H4         C  18  -4.715   1.539   4.721
  193   2H4     C  18          2H4         C  18  -3.321   1.931   5.709
  194    H5     C  18           H5         C  18  -2.899   0.928   7.819
  195    H6     C  18           H6         C  18  -3.729  -0.605   9.499
  196   1H5*    A  19          1H5*        A  19  -3.821  -7.868  12.086
  197   2H5*    A  19          2H5*        A  19  -2.537  -6.829  12.803
  198    H4*    A  19           H4*        A  19  -4.283  -6.343  10.333
  199    H3*    A  19           H3*        A  19  -1.774  -7.804  10.412
  200   1H2*    A  19          1H2*        A  19  -0.563  -5.847  10.559
  201   2HO*    A  19          2HO*        A  19  -0.837  -5.062   8.009
  202    H1*    A  19           H1*        A  19  -2.786  -4.747   8.805
  203    H8     A  19           H8         A  19  -0.884  -3.199  11.875
  204   1H6     A  19          1H6         A  19   0.086   1.134   9.691
  205   2H6     A  19          2H6         A  19   0.037   1.567   8.000
  206    H2     A  19           H2         A  19  -2.064  -1.658   5.771
  207   1H5*    C  20          1H5*        C  20  -6.633  -7.560   8.892
  208   2H5*    C  20          2H5*        C  20  -6.856  -8.648   7.475
  209    H4*    C  20           H4*        C  20  -8.209  -6.416   7.626
  210    H3*    C  20           H3*        C  20  -6.142  -6.525   5.396
  211   1H2*    C  20          1H2*        C  20  -7.187  -4.502   4.591
  212   2HO*    C  20          2HO*        C  20  -8.602  -3.599   6.367
  213    H1*    C  20           H1*        C  20  -6.706  -3.389   6.944
  214   1H4     C  20          1H4         C  20  -1.327  -2.916   3.682
  215   2H4     C  20          2H4         C  20  -0.657  -4.365   4.392
  216    H5     C  20           H5         C  20  -1.978  -5.744   6.026
  217    H6     C  20           H6         C  20  -4.198  -5.984   7.026
  218   1H5*    U  21          1H5*        U  21  -8.541  -7.364   0.674
  219   2H5*    U  21          2H5*        U  21  -6.781  -7.520   1.023
  220    H4*    U  21           H4*        U  21  -8.414  -4.964   0.466
  221    H3*    U  21           H3*        U  21  -7.494  -6.794  -1.440
  222   1H2*    U  21          1H2*        U  21  -5.342  -6.539  -0.926
  223   2HO*    U  21          2HO*        U  21  -5.716  -4.346  -2.730
  224    H1*    U  21           H1*        U  21  -5.873  -3.545  -0.710
  225    H3     U  21           H3         U  21  -1.374  -2.947  -0.663
  226    H5     U  21           H5         U  21  -2.049  -5.674   2.467
  227    H6     U  21           H6         U  21  -4.355  -5.806   1.771
  228   1H5*    C  22          1H5*        C  22  -7.556  -3.099  -4.870
  229   2H5*    C  22          2H5*        C  22  -6.201  -4.179  -4.405
  230    H4*    C  22           H4*        C  22  -6.181  -1.182  -5.045
  231    H3*    C  22           H3*        C  22  -6.377  -3.031  -7.006
  232   1H2*    C  22          1H2*        C  22  -4.581  -4.228  -6.019
  233   2HO*    C  22          2HO*        C  22  -3.233  -2.757  -8.139
  234    H1*    C  22           H1*        C  22  -3.079  -1.585  -6.162
  235   1H4     C  22          1H4         C  22   1.605  -4.496  -3.000
  236   2H4     C  22          2H4         C  22   0.599  -5.856  -2.526
  237    H5     C  22           H5         C  22  -1.830  -5.817  -2.905
  238    H6     C  22           H6         C  22  -3.631  -4.673  -4.087
  239   1H5*    G  23          1H5*        G  23  -4.485  -2.247 -11.245
  240   2H5*    G  23          2H5*        G  23  -4.376  -2.852  -9.554
  241    H4*    G  23           H4*        G  23  -2.605  -0.788 -10.985
  242    H3*    G  23           H3*        G  23  -1.703  -3.703 -10.446
  243   1H2*    G  23          1H2*        G  23   0.228  -2.879 -10.752
  244   2HO*    G  23          2HO*        G  23   0.672  -1.087 -11.827
  245    H1*    G  23           H1*        G  23   0.032  -0.899  -9.392
  246    H8     G  23           H8         G  23  -1.697  -4.093  -8.007
  247    H1     G  23           H1         G  23   4.455  -3.285  -6.367
  248   1H2     G  23          1H2         G  23   5.235  -1.437  -7.381
  249   2H2     G  23          2H2         G  23   4.253  -0.457  -8.455
  250   1H5*    U  24          1H5*        U  24   0.256  -1.305 -13.680
  251   2H5*    U  24          2H5*        U  24   0.712  -2.425 -15.010
  252    H4*    U  24           H4*        U  24   2.462  -0.726 -14.318
  253    H3*    U  24           H3*        U  24   3.176  -3.529 -13.390
  254   1H2*    U  24          1H2*        U  24   5.380  -2.580 -12.948
  255   2HO*    U  24          2HO*        U  24   4.107  -0.117 -13.676
  256    H1*    U  24           H1*        U  24   4.239  -0.832 -11.319
  257    H3     U  24           H3         U  24   5.371  -4.666  -8.844
  258    H5     U  24           H5         U  24   1.429  -5.248 -10.160
  259    H6     U  24           H6         U  24   1.663  -3.280 -11.529
  260   1H5*    G  25          1H5*        G  25   6.594  -2.244 -15.563
  261   2H5*    G  25          2H5*        G  25   7.052  -3.508 -16.762
  262    H4*    G  25           H4*        G  25   8.921  -2.607 -15.270
  263    H3*    G  25           H3*        G  25   8.062  -5.436 -14.542
  264   1H2*    G  25          1H2*        G  25  10.019  -5.457 -13.115
  265   2HO*    G  25          2HO*        G  25  11.247  -3.998 -14.544
  266    H1*    G  25           H1*        G  25   9.147  -3.295 -11.883
  267    H8     G  25           H8         G  25   5.863  -4.598 -13.165
  268    H1     G  25           H1         G  25   7.954  -8.073  -8.234
  269   1H2     G  25          1H2         G  25  10.118  -7.612  -7.820
  270   2H2     G  25          2H2         G  25  11.027  -6.416  -8.728
  271   1H5*    C  26          1H5*        C  26  12.193  -5.899 -14.777
  272   2H5*    C  26          2H5*        C  26  12.619  -7.254 -15.889
  273    H4*    C  26           H4*        C  26  13.572  -7.343 -13.482
  274    H3*    C  26           H3*        C  26  11.408  -9.402 -14.150
  275   1H2*    C  26          1H2*        C  26  11.744 -10.340 -11.991
  276   2HO*    C  26          2HO*        C  26  14.063  -9.842 -11.971
  277    H1*    C  26           H1*        C  26  11.465  -7.990 -10.795
  278   1H4     C  26          1H4         C  26   5.541 -10.230 -11.645
  279   2H4     C  26          2H4         C  26   5.296  -9.159 -13.018
  280    H5     C  26           H5         C  26   7.163  -7.854 -13.968
  281    H6     C  26           H6         C  26   9.524  -7.321 -13.721
  282   1H5*    C  27          1H5*        C  27  13.444 -11.771 -12.025
  283   2H5*    C  27          2H5*        C  27  14.384 -13.034 -12.903
  284    H4*    C  27           H4*        C  27  12.851 -13.769 -10.926
  285    H3*    C  27           H3*        C  27  12.223 -14.614 -13.713
  286   1H2*    C  27          1H2*        C  27  10.246 -14.909 -13.498
  287   2HO*    C  27          2HO*        C  27   9.370 -16.360 -11.846
  288    H1*    C  27           H1*        C  27  10.258 -14.415 -10.508
  289   1H4     C  27          1H4         C  27   4.299 -13.252 -12.568
  290   2H4     C  27          2H4         C  27   4.856 -11.960 -13.619
  291    H5     C  27           H5         C  27   7.227 -11.458 -13.903
  292    H6     C  27           H6         C  27   9.481 -12.072 -13.231
  293    H3T    C  27           H3T        C  27  12.950 -16.174 -11.425
  294    H1   TOA  28           H1       TOA  28  -1.813   5.172   1.707
  295    H2   TOA  28           H2       TOA  28   0.143   3.708   2.276
  296    H3   TOA  28           H3       TOA  28  -2.038   1.964   3.452
  297    H4   TOA  28           H4       TOA  28   0.307   3.439   4.709
  298    H5   TOA  28           H5       TOA  28  -2.710   3.845   4.935
  299   1H6   TOA  28          1H6       TOA  28  -1.517   4.441   7.042
  300   2H6   TOA  28          2H6       TOA  28  -0.391   5.437   6.088
  301    HO2  TOA  28           HO2      TOA  28  -1.160   3.347   0.229
  302    HO4  TOA  28           HO4      TOA  28  -0.677   2.647   6.808
  303    HO6  TOA  28           HO6      TOA  28  -1.997   6.764   7.054
  304   1HN3  TOA  28          1H3       TOA  28  -0.457   0.652   2.390
  305   2HN3  TOA  28          2H3       TOA  28   0.860   1.404   3.162
  306   3HN3  TOA  28          3H3       TOA  28  -0.263   0.493   4.079
  307    H1   TOB  29           H1       TOB  29  -5.798   3.597   2.517
  308   1H2   TOB  29          1H2       TOB  29  -5.820   5.217  -0.027
  309   2H2   TOB  29          2H2       TOB  29  -7.250   4.261   0.583
  310    H3   TOB  29           H3       TOB  29  -7.231   5.684   2.661
  311   1H4   TOB  29           H4       TOB  29  -5.120   7.259   1.144
  312    H5   TOB  29           H5       TOB  29  -4.887   5.635   3.727
  313    H6   TOB  29           H6       TOB  29  -3.746   5.192   0.962
  314   1HN1  TOB  29          1H1       TOB  29  -4.180   2.306   1.199
  315   2HN1  TOB  29          2H1       TOB  29  -5.783   2.194   0.664
  316   3HN1  TOB  29          3H1       TOB  29  -4.658   3.134  -0.183
  317   1HN3  TOB  29          1H3       TOB  29  -7.399   7.249   0.152
  318   2HN3  TOB  29          2H3       TOB  29  -8.622   6.266   0.802
  319   3HN3  TOB  29          3H3       TOB  29  -8.095   7.632   1.656
  320    HO5  TOB  29           HO5      TOB  29  -2.594   6.266   3.631
  321    H1   TOC  30           H1       TOC  30  -4.200   8.918   2.384
  322    H2   TOC  30           H2       TOC  30  -4.202  10.425   4.326
  323   1H3   TOC  30          1H3       TOC  30  -6.709   9.039   5.114
  324   2H3   TOC  30          2H3       TOC  30  -5.876  10.245   6.119
  325    H4   TOC  30           H4       TOC  30  -6.177  11.848   4.284
  326    H5   TOC  30           H5       TOC  30  -7.724   9.594   2.919
  327   1H6   TOC  30          1H6       TOC  30  -7.125  12.436   1.967
  328   2H6   TOC  30          2H6       TOC  30  -7.925  11.155   1.007
  329   1HN2  TOC  30          1H2       TOC  30  -3.556   8.959   5.889
  330   2HN2  TOC  30          2H2       TOC  30  -4.713   7.780   5.499
  331   3HN2  TOC  30          3H2       TOC  30  -3.386   8.024   4.478
  332   1HN6  TOC  30          1H6       TOC  30  -9.009  11.924   3.624
  333   2HN6  TOC  30          2H6       TOC  30  -9.320  12.896   2.258
  334   3HN6  TOC  30          3H6       TOC  30  -9.808  11.271   2.271
  335    HO4  TOC  30           HO4      TOC  30  -7.868  11.638   5.976
   
  Start of MODEL    3
    1   1H5*    G   1          1H5*        G   1  13.165 -11.759  -1.228
    2   2H5*    G   1          2H5*        G   1  13.147 -11.498   0.553
    3    H4*    G   1           H4*        G   1  15.121 -10.541  -0.683
    4    H3*    G   1           H3*        G   1  13.159  -8.589   0.386
    5   1H2*    G   1          1H2*        G   1  13.605  -7.083  -0.899
    6   2HO*    G   1          2HO*        G   1  15.893  -6.391  -1.171
    7    H1*    G   1           H1*        G   1  15.940  -8.597  -2.088
    8    H8     G   1           H8         G   1  12.820  -8.206  -4.162
    9    H1     G   1           H1         G   1  16.634  -3.078  -4.641
   10   1H2     G   1          1H2         G   1  18.231  -3.167  -3.056
   11   2H2     G   1          2H2         G   1  18.366  -4.508  -1.936
   12    H5T    G   1           H5T        G   1  11.628 -10.025  -1.312
   13   1H5*    G   2          1H5*        G   2  17.107  -6.802   1.334
   14   2H5*    G   2          2H5*        G   2  17.123  -6.381   3.083
   15    H4*    G   2           H4*        G   2  18.055  -4.656   1.444
   16    H3*    G   2           H3*        G   2  15.339  -3.855   2.561
   17   1H2*    G   2          1H2*        G   2  15.406  -2.037   1.433
   18   2HO*    G   2          2HO*        G   2  16.951  -0.690   1.845
   19    H1*    G   2           H1*        G   2  17.740  -3.027  -0.159
   20    H8     G   2           H8         G   2  14.421  -4.104  -1.503
   21    H1     G   2           H1         G   2  15.762   1.904  -3.240
   22   1H2     G   2          1H2         G   2  17.432   2.709  -1.969
   23   2H2     G   2          2H2         G   2  18.343   1.703  -0.858
   24   1H5*    C   3          1H5*        C   3  17.789  -0.485   3.398
   25   2H5*    C   3          2H5*        C   3  17.471   0.087   5.074
   26    H4*    C   3           H4*        C   3  17.347   1.806   3.111
   27    H3*    C   3           H3*        C   3  14.726   1.077   4.422
   28   1H2*    C   3          1H2*        C   3  13.568   2.032   3.000
   29   2HO*    C   3          2HO*        C   3  14.283   4.161   3.785
   30    H1*    C   3           H1*        C   3  15.977   2.710   1.355
   31   1H4     C   3          1H4         C   3  11.454   1.728  -3.027
   32   2H4     C   3          2H4         C   3  11.135   0.105  -2.453
   33    H5     C   3           H5         C   3  12.295  -0.839  -0.509
   34    H6     C   3           H6         C   3  13.907  -0.362   1.257
   35   1H5*    A   4          1H5*        A   4  15.465   5.672   4.727
   36   2H5*    A   4          2H5*        A   4  14.700   6.130   6.291
   37    H4*    A   4           H4*        A   4  14.136   7.713   4.495
   38    H3*    A   4           H3*        A   4  11.846   5.762   4.962
   39   1H2*    A   4          1H2*        A   4  10.591   7.097   3.386
   40   2HO*    A   4          2HO*        A   4  11.219   9.009   4.431
   41    H1*    A   4           H1*        A   4  12.583   7.598   1.809
   42    H8     A   4           H8         A   4  12.202   3.972   3.021
   43   1H6     A   4          1H6         A   4   9.483   3.021  -2.469
   44   2H6     A   4          2H6         A   4   9.994   2.266  -0.974
   45    H2     A   4           H2         A   4  10.278   7.414  -2.024
   46   1H5*    C   5          1H5*        C   5   7.943   8.849   6.265
   47   2H5*    C   5          2H5*        C   5   8.581   7.390   5.461
   48    H4*    C   5           H4*        C   5   8.230  10.238   4.418
   49    H3*    C   5           H3*        C   5   6.746   7.722   3.772
   50   1H2*    C   5          1H2*        C   5   6.190   8.555   1.779
   51   2HO*    C   5          2HO*        C   5   5.811  10.603   1.780
   52    H1*    C   5           H1*        C   5   8.676   9.120   1.161
   53   1H4     C   5          1H4         C   5   7.698   2.833   0.046
   54   2H4     C   5          2H4         C   5   8.263   2.514   1.674
   55    H5     C   5           H5         C   5   8.775   4.333   3.296
   56    H6     C   5           H6         C   5   8.699   6.789   3.590
   57   1H5*    G   6          1H5*        G   6   3.789  10.746   3.396
   58   2H5*    G   6          2H5*        G   6   2.101  10.262   3.780
   59    H4*    G   6           H4*        G   6   2.740  11.021   1.353
   60    H3*    G   6           H3*        G   6   1.912   8.113   1.624
   61   1H2*    G   6          1H2*        G   6   1.874   8.038  -0.749
   62   2HO*    G   6          2HO*        G   6   1.261  10.345  -0.922
   63    H1*    G   6           H1*        G   6   4.396   8.938  -0.746
   64    H8     G   6           H8         G   6   4.945   7.243   2.437
   65    H1     G   6           H1         G   6   3.642   2.847  -1.998
   66   1H2     G   6          1H2         G   6   2.687   3.787  -3.770
   67   2H2     G   6          2H2         G   6   2.447   5.520  -3.931
   68   1H5*    A   7          1H5*        A   7  -0.666   9.868  -0.963
   69   2H5*    A   7          2H5*        A   7  -2.420  10.054  -1.275
   70    H4*    A   7           H4*        A   7  -1.042   8.385  -2.699
   71    H3*    A   7           H3*        A   7  -3.166   7.217  -0.871
   72   1H2*    A   7          1H2*        A   7  -2.351   5.256  -1.115
   73   2HO*    A   7          2HO*        A   7  -1.758   4.358  -3.110
   74    H1*    A   7           H1*        A   7  -0.145   6.196  -2.880
   75    H8     A   7           H8         A   7   1.031   6.151   0.522
   76   1H6     A   7          1H6         A   7   2.100   0.111   0.370
   77   2H6     A   7          2H6         A   7   2.433   1.647   1.128
   78    H2     A   7           H2         A   7  -0.505   1.214  -3.232
   79   1H5*    G   8          1H5*        G   8  -7.027   5.151  -3.251
   80   2H5*    G   8          2H5*        G   8  -5.850   4.904  -1.909
   81    H4*    G   8           H4*        G   8  -5.937   3.591  -4.687
   82    H3*    G   8           H3*        G   8  -7.562   2.975  -2.520
   83   1H2*    G   8          1H2*        G   8  -5.720   2.607  -1.220
   84   2HO*    G   8          2HO*        G   8  -6.756   0.822  -0.715
   85    H1*    G   8           H1*        G   8  -4.635   0.964  -3.548
   86    H8     G   8           H8         G   8  -2.936   3.342  -0.938
   87    H1     G   8           H1         G   8  -1.535  -2.867  -0.236
   88   1H2     G   8          1H2         G   8  -2.759  -4.078  -1.780
   89   2H2     G   8          2H2         G   8  -3.863  -3.299  -2.883
   90   1H5*    G   9          1H5*        G   9 -11.074   0.098  -3.724
   91   2H5*    G   9          2H5*        G   9 -11.551   1.831  -3.730
   92    H4*    G   9           H4*        G   9 -12.476   0.186  -1.897
   93    H3*    G   9           H3*        G   9 -10.670   2.396  -0.836
   94   1H2*    G   9          1H2*        G   9 -11.379   1.712   1.288
   95   2HO*    G   9          2HO*        G   9 -13.456   1.258   0.927
   96    H1*    G   9           H1*        G   9 -10.835  -0.870   0.760
   97    H8     G   9           H8         G   9  -8.658   2.030  -0.783
   98    H1     G   9           H1         G   9  -6.648  -0.206   4.838
   99   1H2     G   9          1H2         G   9  -8.023  -1.834   5.557
  100   2H2     G   9          2H2         G   9  -9.590  -2.115   4.820
  101   1H5*    U  10          1H5*        U  10 -14.070   4.068   3.145
  102   2H5*    U  10          2H5*        U  10 -12.321   4.115   2.728
  103    H4*    U  10           H4*        U  10 -13.992   1.725   3.745
  104    H3*    U  10           H3*        U  10 -12.070   3.588   5.188
  105   1H2*    U  10          1H2*        U  10 -11.717   1.784   6.749
  106   2HO*    U  10          2HO*        U  10 -13.463   0.363   4.978
  107    H1*    U  10           H1*        U  10 -11.041   0.176   4.764
  108    H3     U  10           H3         U  10  -7.294   2.420   6.648
  109    H5     U  10           H5         U  10  -8.146   4.242   2.958
  110    H6     U  10           H6         U  10 -10.208   3.014   2.898
  111   1H5*    U  11          1H5*        U  11 -13.110   2.161   8.736
  112   2H5*    U  11          2H5*        U  11 -14.049   3.482   9.530
  113    H4*    U  11           H4*        U  11 -12.058   2.579  10.846
  114    H3*    U  11           H3*        U  11 -11.633   5.274   9.550
  115   1H2*    U  11          1H2*        U  11  -9.664   5.541  10.816
  116   2HO*    U  11          2HO*        U  11 -10.374   4.339  12.675
  117    H1*    U  11           H1*        U  11  -8.782   3.279  10.024
  118    H3     U  11           H3         U  11  -6.590   6.061   7.373
  119    H5     U  11           H5         U  11 -10.369   5.792   5.496
  120    H6     U  11           H6         U  11 -11.117   4.508   7.402
  121   1H5*    U  12          1H5*        U  12 -11.819   7.453  14.088
  122   2H5*    U  12          2H5*        U  12 -11.447   7.036  12.378
  123    H4*    U  12           H4*        U  12  -9.525   7.239  14.793
  124    H3*    U  12           H3*        U  12  -9.849   8.851  12.290
  125   1H2*    U  12          1H2*        U  12  -7.740   9.696  12.728
  126   2HO*    U  12          2HO*        U  12  -6.600   9.100  14.509
  127    H1*    U  12           H1*        U  12  -6.798   7.226  12.911
  128    H3     U  12           H3         U  12  -5.597   8.866   8.850
  129    H5     U  12           H5         U  12  -9.711   8.078   8.417
  130    H6     U  12           H6         U  12  -9.759   7.542  10.783
  131   1H5*    A  13          1H5*        A  13 -11.219  13.227  11.704
  132   2H5*    A  13          2H5*        A  13 -11.334  11.848  10.554
  133    H4*    A  13           H4*        A  13  -9.875  13.915   9.969
  134    H3*    A  13           H3*        A  13  -9.065  11.429   9.305
  135   1H2*    A  13          1H2*        A  13  -8.393  11.095  11.502
  136   2HO*    A  13          2HO*        A  13  -5.932  11.743  10.198
  137    H1*    A  13           H1*        A  13  -6.639  13.561  11.191
  138    H8     A  13           H8         A  13  -8.714  11.501  13.863
  139   1H6     A  13          1H6         A  13  -4.058  12.798  17.703
  140   2H6     A  13          2H6         A  13  -5.596  11.981  17.514
  141    H2     A  13           H2         A  13  -3.169  14.746  13.765
  142   1H5*    G  14          1H5*        G  14  -3.955  14.646   9.705
  143   2H5*    G  14          2H5*        G  14  -3.785  13.744   8.157
  144    H4*    G  14           H4*        G  14  -2.012  13.373   9.990
  145    H3*    G  14           H3*        G  14  -3.887  11.000   9.615
  146   1H2*    G  14          1H2*        G  14  -2.423   9.801  10.905
  147   2HO*    G  14          2HO*        G  14  -0.363  10.075  10.634
  148    H1*    G  14           H1*        G  14  -1.658  12.127  12.402
  149    H8     G  14           H8         G  14  -5.216  10.559  11.977
  150    H1     G  14           H1         G  14  -2.372   9.234  17.561
  151   1H2     G  14          1H2         G  14   0.340  10.992  16.236
  152   2H2     G  14          2H2         G  14  -0.309  10.096  17.591
  153   1H5*    C  15          1H5*        C  15   0.194  10.670   7.607
  154   2H5*    C  15          2H5*        C  15   0.708   9.421   6.526
  155    H4*    C  15           H4*        C  15  -1.122   9.175   8.988
  156    H3*    C  15           H3*        C  15   1.435   9.577   9.551
  157   1H2*    C  15          1H2*        C  15   2.385   8.040   8.182
  158   2HO*    C  15          2HO*        C  15   1.781   6.788  10.645
  159    H1*    C  15           H1*        C  15   0.194   5.938   8.458
  160   1H4     C  15          1H4         C  15   1.637   6.449   2.125
  161   2H4     C  15          2H4         C  15   3.058   5.524   2.535
  162    H5     C  15           H5         C  15   0.281   7.662   3.699
  163    H6     C  15           H6         C  15  -0.350   7.760   6.010
  164   1H5*    U  16          1H5*        U  16   0.827   7.434  14.664
  165   2H5*    U  16          2H5*        U  16   1.568   5.858  14.244
  166    H4*    U  16           H4*        U  16  -0.718   5.859  15.388
  167    H3*    U  16           H3*        U  16  -0.956   5.034  12.501
  168   1H2*    U  16          1H2*        U  16  -3.037   4.034  13.286
  169   2HO*    U  16          2HO*        U  16  -2.319   3.505  15.385
  170    H1*    U  16           H1*        U  16  -3.679   6.423  14.301
  171    H3     U  16           H3         U  16  -5.732   5.274  10.225
  172    H5     U  16           H5         U  16  -2.510   7.758   9.287
  173    H6     U  16           H6         U  16  -1.737   7.565  11.573
  174   1H5*    A  17          1H5*        A  17   0.181  -0.637  13.183
  175   2H5*    A  17          2H5*        A  17  -0.177   0.402  11.766
  176    H4*    A  17           H4*        A  17  -1.476   0.443  14.559
  177    H3*    A  17           H3*        A  17  -2.109  -1.582  12.731
  178   1H2*    A  17          1H2*        A  17  -2.298  -0.050  11.072
  179   2HO*    A  17          2HO*        A  17  -4.723  -0.041  10.805
  180    H1*    A  17           H1*        A  17  -4.285   1.387  12.815
  181    H8     A  17           H8         A  17  -1.744   3.640  11.314
  182   1H6     A  17          1H6         A  17  -5.225   4.143   6.289
  183   2H6     A  17          2H6         A  17  -3.992   4.889   7.278
  184    H2     A  17           H2         A  17  -6.899   0.772   8.928
  185   1H5*    C  18          1H5*        C  18  -4.106  -4.534  12.465
  186   2H5*    C  18          2H5*        C  18  -3.426  -3.048  11.713
  187    H4*    C  18           H4*        C  18  -6.172  -4.354  11.260
  188    H3*    C  18           H3*        C  18  -3.886  -5.505  10.288
  189   1H2*    C  18          1H2*        C  18  -3.240  -3.418   9.401
  190   2HO*    C  18          2HO*        C  18  -4.277  -5.150   7.347
  191    H1*    C  18           H1*        C  18  -5.978  -3.530   8.240
  192   1H4     C  18          1H4         C  18  -4.512   1.633   4.874
  193   2H4     C  18          2H4         C  18  -3.311   2.178   6.035
  194    H5     C  18           H5         C  18  -2.691   0.817   8.026
  195    H6     C  18           H6         C  18  -3.288  -1.125   9.321
  196   1H5*    A  19          1H5*        A  19  -5.762  -7.519   5.173
  197   2H5*    A  19          2H5*        A  19  -4.577  -8.333   6.250
  198    H4*    A  19           H4*        A  19  -3.672  -7.573   4.076
  199    H3*    A  19           H3*        A  19  -2.453  -6.621   6.429
  200   1H2*    A  19          1H2*        A  19  -3.011  -4.501   5.841
  201   2HO*    A  19          2HO*        A  19  -0.976  -4.377   3.976
  202    H1*    A  19           H1*        A  19  -2.565  -5.439   2.967
  203    H8     A  19           H8         A  19  -2.837  -2.499   4.986
  204   1H6     A  19          1H6         A  19  -4.753   0.679   1.683
  205   2H6     A  19          2H6         A  19  -5.451   0.378   0.089
  206    H2     A  19           H2         A  19  -5.474  -3.971  -0.633
  207   1H5*    C  20          1H5*        C  20  -3.399  -9.522   3.185
  208   2H5*    C  20          2H5*        C  20  -2.425 -11.004   2.929
  209    H4*    C  20           H4*        C  20  -3.729  -9.982   0.952
  210    H3*    C  20           H3*        C  20  -1.215 -10.969   0.693
  211   1H2*    C  20          1H2*        C  20  -0.149  -9.102   1.243
  212   2HO*    C  20          2HO*        C  20  -0.476  -8.601  -1.525
  213    H1*    C  20           H1*        C  20  -1.940  -7.569  -0.705
  214   1H4     C  20          1H4         C  20   0.075  -2.208   1.953
  215   2H4     C  20          2H4         C  20   0.941  -3.036   3.226
  216    H5     C  20           H5         C  20   0.869  -5.516   3.467
  217    H6     C  20           H6         C  20  -0.006  -7.541   2.510
  218   1H5*    U  21          1H5*        U  21  -1.738  -8.495  -4.466
  219   2H5*    U  21          2H5*        U  21  -0.435  -8.553  -3.228
  220    H4*    U  21           H4*        U  21  -2.099  -6.154  -4.222
  221    H3*    U  21           H3*        U  21   0.488  -7.227  -5.145
  222   1H2*    U  21          1H2*        U  21   1.566  -6.005  -3.755
  223   2HO*    U  21          2HO*        U  21   0.846  -3.967  -5.651
  224    H1*    U  21           H1*        U  21  -0.781  -4.076  -3.892
  225    H3     U  21           H3         U  21   1.058  -0.817  -1.373
  226    H5     U  21           H5         U  21   2.762  -4.306   0.286
  227    H6     U  21           H6         U  21   1.596  -5.594  -1.392
  228   1H5*    C  22          1H5*        C  22  -1.476  -1.495  -6.065
  229   2H5*    C  22          2H5*        C  22  -1.204  -1.953  -7.785
  230    H4*    C  22           H4*        C  22   0.114   0.023  -6.892
  231    H3*    C  22           H3*        C  22   1.632  -2.490  -7.515
  232   1H2*    C  22          1H2*        C  22   3.116  -2.037  -6.201
  233   2HO*    C  22          2HO*        C  22   3.680   0.545  -7.371
  234    H1*    C  22           H1*        C  22   1.993   0.758  -5.849
  235   1H4     C  22          1H4         C  22   4.922   0.861  -0.201
  236   2H4     C  22          2H4         C  22   5.349  -0.846  -0.245
  237    H5     C  22           H5         C  22   4.637  -2.291  -2.110
  238    H6     C  22           H6         C  22   3.439  -2.348  -4.222
  239   1H5*    G  23          1H5*        G  23   1.809   1.686  -9.439
  240   2H5*    G  23          2H5*        G  23   2.826   1.983 -10.892
  241    H4*    G  23           H4*        G  23   2.833   3.733  -9.011
  242    H3*    G  23           H3*        G  23   5.533   2.264  -9.095
  243   1H2*    G  23          1H2*        G  23   6.312   3.477  -7.792
  244   2HO*    G  23          2HO*        G  23   5.915   5.439  -8.864
  245    H1*    G  23           H1*        G  23   3.935   4.360  -6.740
  246    H8     G  23           H8         G  23   5.053   0.720  -6.068
  247    H1     G  23           H1         G  23   6.987   4.905  -1.623
  248   1H2     G  23          1H2         G  23   6.472   6.992  -2.265
  249   2H2     G  23          2H2         G  23   5.740   7.337  -3.823
  250   1H5*    U  24          1H5*        U  24   5.628   6.926 -10.439
  251   2H5*    U  24          2H5*        U  24   7.123   6.990 -11.443
  252    H4*    U  24           H4*        U  24   6.885   8.818  -9.684
  253    H3*    U  24           H3*        U  24   8.908   6.686  -8.913
  254   1H2*    U  24          1H2*        U  24   9.613   8.229  -7.227
  255   2HO*    U  24          2HO*        U  24   9.325  10.224  -7.889
  256    H1*    U  24           H1*        U  24   7.092   8.471  -6.371
  257    H3     U  24           H3         U  24   9.392   5.566  -3.582
  258    H5     U  24           H5         U  24   7.944   3.159  -6.695
  259    H6     U  24           H6         U  24   7.232   5.126  -7.840
  260   1H5*    G  25          1H5*        G  25  11.228  10.312  -8.990
  261   2H5*    G  25          2H5*        G  25  12.751   9.966  -9.888
  262    H4*    G  25           H4*        G  25  12.997  11.058  -7.590
  263    H3*    G  25           H3*        G  25  13.804   8.120  -7.610
  264   1H2*    G  25          1H2*        G  25  14.692   8.538  -5.416
  265   2HO*    G  25          2HO*        G  25  15.264  10.789  -5.899
  266    H1*    G  25           H1*        G  25  12.333   9.482  -4.638
  267    H8     G  25           H8         G  25  11.294   7.104  -7.406
  268    H1     G  25           H1         G  25  12.998   4.042  -2.067
  269   1H2     G  25          1H2         G  25  14.072   5.475  -0.679
  270   2H2     G  25          2H2         G  25  14.253   7.182  -1.036
  271   1H5*    C  26          1H5*        C  26  17.106   9.842  -5.745
  272   2H5*    C  26          2H5*        C  26  18.621   9.326  -6.574
  273    H4*    C  26           H4*        C  26  18.495   8.956  -4.027
  274    H3*    C  26           H3*        C  26  18.304   6.401  -5.702
  275   1H2*    C  26          1H2*        C  26  18.504   5.216  -3.627
  276   2HO*    C  26          2HO*        C  26  18.643   7.839  -2.464
  277    H1*    C  26           H1*        C  26  16.509   6.613  -2.567
  278   1H4     C  26          1H4         C  26  13.883   1.737  -5.704
  279   2H4     C  26          2H4         C  26  13.571   2.731  -7.122
  280    H5     C  26           H5         C  26  14.439   5.047  -7.266
  281    H6     C  26           H6         C  26  15.705   6.760  -6.082
  282   1H5*    C  27          1H5*        C  27  20.499   4.758  -3.162
  283   2H5*    C  27          2H5*        C  27  22.213   4.578  -3.677
  284    H4*    C  27           H4*        C  27  21.101   2.563  -2.585
  285    H3*    C  27           H3*        C  27  21.845   2.382  -5.463
  286   1H2*    C  27          1H2*        C  27  20.456   0.985  -5.960
  287   2HO*    C  27          2HO*        C  27  20.424  -1.133  -4.880
  288    H1*    C  27           H1*        C  27  19.626   0.505  -3.095
  289   1H4     C  27          1H4         C  27  14.875  -1.993  -6.573
  290   2H4     C  27          2H4         C  27  14.630  -0.491  -7.444
  291    H5     C  27           H5         C  27  16.078   1.454  -7.119
  292    H6     C  27           H6         C  27  17.998   2.322  -5.887
  293    H3T    C  27           H3T        C  27  23.326   0.781  -4.537
  294    H1   TOA  28           H1       TOA  28  -2.286   6.256   2.801
  295    H2   TOA  28           H2       TOA  28  -0.291   4.870   2.512
  296    H3   TOA  28           H3       TOA  28  -2.245   2.603   2.997
  297    H4   TOA  28           H4       TOA  28   0.196   3.573   4.545
  298    H5   TOA  28           H5       TOA  28  -2.783   3.611   5.242
  299   1H6   TOA  28          1H6       TOA  28  -0.353   4.679   6.724
  300   2H6   TOA  28          2H6       TOA  28  -2.052   4.934   7.208
  301    HO2  TOA  28           HO2      TOA  28  -1.659   5.383   0.717
  302    HO4  TOA  28           HO4      TOA  28  -1.767   1.344   5.016
  303    HO6  TOA  28           HO6      TOA  28  -2.353   2.644   7.513
  304   1HN3  TOA  28          1H3       TOA  28   0.500   2.747   1.968
  305   2HN3  TOA  28          2H3       TOA  28  -0.012   1.347   2.813
  306   3HN3  TOA  28          3H3       TOA  28  -0.816   1.872   1.402
  307    H1   TOB  29           H1       TOB  29  -6.067   4.105   2.624
  308   1H2   TOB  29          1H2       TOB  29  -5.623   5.606   0.056
  309   2H2   TOB  29          2H2       TOB  29  -7.090   4.556   0.363
  310    H3   TOB  29           H3       TOB  29  -7.697   6.068   2.267
  311   1H4   TOB  29           H4       TOB  29  -5.385   7.740   1.215
  312    H5   TOB  29           H5       TOB  29  -5.668   6.257   3.850
  313    H6   TOB  29           H6       TOB  29  -3.828   5.833   1.468
  314   1HN1  TOB  29          1H1       TOB  29  -5.592   2.659   0.910
  315   2HN1  TOB  29          2H1       TOB  29  -4.370   3.633   0.249
  316   3HN1  TOB  29          3H1       TOB  29  -4.140   2.885   1.765
  317   1HN3  TOB  29          1H3       TOB  29  -7.217   7.280  -0.370
  318   2HN3  TOB  29          2H3       TOB  29  -8.657   6.541   0.183
  319   3HN3  TOB  29          3H3       TOB  29  -8.166   8.037   0.824
  320    HO5  TOB  29           HO5      TOB  29  -3.468   7.937   2.696
  321    H1   TOC  30           H1       TOC  30  -4.872   9.517   2.668
  322    H2   TOC  30           H2       TOC  30  -5.645  11.239   4.256
  323   1H3   TOC  30          1H3       TOC  30  -8.184   9.700   4.336
  324   2H3   TOC  30          2H3       TOC  30  -7.819  11.095   5.372
  325    H4   TOC  30           H4       TOC  30  -7.542  12.430   3.333
  326    H5   TOC  30           H5       TOC  30  -8.382   9.900   1.848
  327   1H6   TOC  30          1H6       TOC  30  -7.604  12.656   0.777
  328   2H6   TOC  30          2H6       TOC  30  -7.958  11.205  -0.208
  329   1HN2  TOC  30          1H2       TOC  30  -6.170   8.523   5.289
  330   2HN2  TOC  30          2H2       TOC  30  -4.649   9.296   5.211
  331   3HN2  TOC  30          3H2       TOC  30  -5.868   9.932   6.200
  332   1HN6  TOC  30          1H6       TOC  30  -9.799  12.769  -0.046
  333   2HN6  TOC  30          2H6       TOC  30 -10.207  11.240   0.569
  334   3HN6  TOC  30          3H6       TOC  30  -9.872  12.521   1.634
  335    HO4  TOC  30           HO4      TOC  30 -10.063  10.812   3.398
   
  Start of MODEL    4
    1   1H5*    G   1          1H5*        G   1  -6.374 -13.095   2.625
    2   2H5*    G   1          2H5*        G   1  -5.710 -12.740   4.261
    3    H4*    G   1           H4*        G   1  -4.871 -14.859   3.148
    4    H3*    G   1           H3*        G   1  -2.963 -12.604   3.402
    5   1H2*    G   1          1H2*        G   1  -1.729 -13.140   1.887
    6   2HO*    G   1          2HO*        G   1  -0.755 -15.241   1.774
    7    H1*    G   1           H1*        G   1  -3.175 -15.755   1.388
    8    H8     G   1           H8         G   1  -4.060 -13.288  -1.130
    9    H1     G   1           H1         G   1   1.823 -15.449  -2.436
   10   1H2     G   1          1H2         G   1   2.664 -16.535  -0.662
   11   2H2     G   1          2H2         G   1   1.748 -16.794   0.811
   12    H5T    G   1           H5T        G   1  -4.902 -10.966   3.602
   13   1H5*    G   2          1H5*        G   2  -0.157 -15.622   4.418
   14   2H5*    G   2          2H5*        G   2   0.607 -15.164   5.985
   15    H4*    G   2           H4*        G   2   2.168 -15.690   4.026
   16    H3*    G   2           H3*        G   2   1.970 -12.762   4.721
   17   1H2*    G   2          1H2*        G   2   2.948 -12.170   3.017
   18   2HO*    G   2          2HO*        G   2   4.857 -13.414   2.164
   19    H1*    G   2           H1*        G   2   3.185 -15.042   2.116
   20    H8     G   2           H8         G   2   0.422 -12.827   0.755
   21    H1     G   2           H1         G   2   5.671 -12.689  -2.887
   22   1H2     G   2          1H2         G   2   7.415 -13.536  -1.743
   23   2H2     G   2          2H2         G   2   7.214 -14.367  -0.213
   24   1H5*    C   3          1H5*        C   3   6.547 -13.718   5.145
   25   2H5*    C   3          2H5*        C   3   7.000 -12.672   6.541
   26    H4*    C   3           H4*        C   3   8.557 -12.393   4.604
   27    H3*    C   3           H3*        C   3   6.456 -10.216   4.603
   28   1H2*    C   3          1H2*        C   3   7.623  -9.105   3.036
   29   2HO*    C   3          2HO*        C   3   9.730  -9.150   3.040
   30    H1*    C   3           H1*        C   3   8.384 -11.391   1.762
   31   1H4     C   3          1H4         C   3   3.849  -9.249  -2.077
   32   2H4     C   3          2H4         C   3   2.583  -9.421  -0.880
   33    H5     C   3           H5         C   3   3.075 -10.225   1.406
   34    H6     C   3           H6         C   3   4.870 -10.932   2.913
   35   1H5*    A   4          1H5*        A   4  10.441  -8.315   4.831
   36   2H5*    A   4          2H5*        A   4  10.197  -6.855   5.857
   37    H4*    A   4           H4*        A   4  11.462  -6.376   3.774
   38    H3*    A   4           H3*        A   4   8.552  -5.559   3.466
   39   1H2*    A   4          1H2*        A   4   9.307  -4.459   1.471
   40   2HO*    A   4          2HO*        A   4  11.221  -3.766   1.448
   41    H1*    A   4           H1*        A   4  10.535  -6.387   0.591
   42    H8     A   4           H8         A   4   7.493  -7.257   2.682
   43   1H6     A   4          1H6         A   4   4.172  -6.880  -2.482
   44   2H6     A   4          2H6         A   4   4.176  -7.263  -0.779
   45    H2     A   4           H2         A   4   8.411  -5.599  -3.427
   46   1H5*    C   5          1H5*        C   5  11.271  -2.241   2.880
   47   2H5*    C   5          2H5*        C   5  10.567  -0.693   3.476
   48    H4*    C   5           H4*        C   5  11.408  -0.740   1.098
   49    H3*    C   5           H3*        C   5   8.422  -0.669   1.275
   50   1H2*    C   5          1H2*        C   5   8.258  -0.349  -0.956
   51   2HO*    C   5          2HO*        C   5  10.188   0.988  -1.165
   52    H1*    C   5           H1*        C   5   9.779  -2.472  -1.430
   53   1H4     C   5          1H4         C   5   3.933  -4.761  -0.365
   54   2H4     C   5          2H4         C   5   4.274  -4.874   1.352
   55    H5     C   5           H5         C   5   6.329  -3.878   2.342
   56    H6     C   5           H6         C   5   8.462  -2.683   1.713
   57   1H5*    G   6          1H5*        G   6   6.717   4.309   1.951
   58   2H5*    G   6          2H5*        G   6   6.479   2.562   2.266
   59    H4*    G   6           H4*        G   6   7.499   3.961  -0.292
   60    H3*    G   6           H3*        G   6   4.851   2.687   0.427
   61   1H2*    G   6          1H2*        G   6   4.453   2.361  -1.886
   62   2HO*    G   6          2HO*        G   6   5.771   4.292  -2.494
   63    H1*    G   6           H1*        G   6   6.702   0.988  -2.047
   64    H8     G   6           H8         G   6   6.599   0.171   1.427
   65    H1     G   6           H1         G   6   1.477  -2.489  -1.299
   66   1H2     G   6          1H2         G   6   1.094  -1.601  -3.298
   67   2H2     G   6          2H2         G   6   2.110  -0.360  -3.997
   68   1H5*    A   7          1H5*        A   7   3.184   5.428  -2.003
   69   2H5*    A   7          2H5*        A   7   1.781   6.327  -1.326
   70    H4*    A   7           H4*        A   7   1.372   4.717  -3.303
   71    H3*    A   7           H3*        A   7   0.358   3.683  -0.678
   72   1H2*    A   7          1H2*        A   7  -0.937   2.114  -1.986
   73   2HO*    A   7          2HO*        A   7  -1.065   3.559  -3.900
   74    H1*    A   7           H1*        A   7   1.291   1.279  -2.936
   75    H8     A   7           H8         A   7   2.759   2.490   0.245
   76   1H6     A   7          1H6         A   7  -0.331  -1.954   3.299
   77   2H6     A   7          2H6         A   7   1.021  -0.843   3.389
   78    H2     A   7           H2         A   7  -1.948  -1.739  -0.842
   79   1H5*    G   8          1H5*        G   8  -4.429   4.952  -3.664
   80   2H5*    G   8          2H5*        G   8  -3.582   4.080  -2.342
   81    H4*    G   8           H4*        G   8  -4.038   3.196  -5.271
   82    H3*    G   8           H3*        G   8  -5.373   2.294  -2.692
   83   1H2*    G   8          1H2*        G   8  -5.813   0.220  -3.769
   84   2HO*    G   8          2HO*        G   8  -4.857  -0.030  -5.908
   85    H1*    G   8           H1*        G   8  -3.197  -0.103  -4.099
   86    H8     G   8           H8         G   8  -2.749   2.384  -1.456
   87    H1     G   8           H1         G   8  -5.444  -2.817   1.040
   88   1H2     G   8          1H2         G   8  -6.193  -4.167  -0.642
   89   2H2     G   8          2H2         G   8  -6.026  -3.723  -2.328
   90   1H5*    G   9          1H5*        G   9  -9.236   1.674  -3.746
   91   2H5*    G   9          2H5*        G   9 -10.182   3.091  -3.177
   92    H4*    G   9           H4*        G   9 -10.880   0.797  -2.343
   93    H3*    G   9           H3*        G   9  -9.612   2.450  -0.128
   94   1H2*    G   9          1H2*        G   9 -10.564   0.760   1.306
   95   2HO*    G   9          2HO*        G   9 -11.663  -0.982   0.270
   96    H1*    G   9           H1*        G   9  -9.374  -1.153  -0.107
   97    H8     G   9           H8         G   9  -6.886   1.501  -0.690
   98    H1     G   9           H1         G   9  -7.015  -0.198   5.463
   99   1H2     G   9          1H2         G   9  -8.911  -1.349   5.901
  100   2H2     G   9          2H2         G   9  -9.966  -1.911   4.624
  101   1H5*    U  10          1H5*        U  10 -12.785   0.900   1.353
  102   2H5*    U  10          2H5*        U  10 -14.092   1.962   1.942
  103    H4*    U  10           H4*        U  10 -13.266  -0.122   3.314
  104    H3*    U  10           H3*        U  10 -14.220   2.089   4.546
  105   1H2*    U  10          1H2*        U  10 -12.088   3.111   4.077
  106   2HO*    U  10          2HO*        U  10 -12.241   2.393   6.850
  107    H1*    U  10           H1*        U  10 -11.047   0.742   5.679
  108    H3     U  10           H3         U  10  -7.045   2.666   6.379
  109    H5     U  10           H5         U  10  -8.146   4.092   2.547
  110    H6     U  10           H6         U  10 -10.163   2.877   2.759
  111   1H5*    U  11          1H5*        U  11 -13.623   2.618   9.547
  112   2H5*    U  11          2H5*        U  11 -12.977   3.286   8.016
  113    H4*    U  11           H4*        U  11 -11.505   2.178  10.491
  114    H3*    U  11           H3*        U  11 -11.661   4.916   9.198
  115   1H2*    U  11          1H2*        U  11  -9.669   5.443  10.389
  116   2HO*    U  11          2HO*        U  11  -9.246   4.428  12.111
  117    H1*    U  11           H1*        U  11  -8.520   3.236   9.670
  118    H3     U  11           H3         U  11  -6.383   6.076   6.993
  119    H5     U  11           H5         U  11 -10.249   5.982   5.306
  120    H6     U  11           H6         U  11 -10.942   4.582   7.143
  121   1H5*    U  12          1H5*        U  12 -10.569   5.050  13.452
  122   2H5*    U  12          2H5*        U  12 -11.417   6.476  14.160
  123    H4*    U  12           H4*        U  12  -8.922   6.350  14.631
  124    H3*    U  12           H3*        U  12  -9.556   8.347  12.490
  125   1H2*    U  12          1H2*        U  12  -7.434   9.242  12.920
  126   2HO*    U  12          2HO*        U  12  -6.182   8.446  14.533
  127    H1*    U  12           H1*        U  12  -6.409   6.795  12.568
  128    H3     U  12           H3         U  12  -5.553   8.967   8.662
  129    H5     U  12           H5         U  12  -9.685   8.196   8.484
  130    H6     U  12           H6         U  12  -9.542   7.398  10.769
  131   1H5*    A  13          1H5*        A  13 -11.404  12.532  12.987
  132   2H5*    A  13          2H5*        A  13 -11.491  11.580  11.458
  133    H4*    A  13           H4*        A  13 -10.128  13.790  11.505
  134    H3*    A  13           H3*        A  13  -9.220  11.602  10.171
  135   1H2*    A  13          1H2*        A  13  -8.500  10.753  12.233
  136   2HO*    A  13          2HO*        A  13  -6.274  11.669  10.678
  137    H1*    A  13           H1*        A  13  -6.950  13.361  12.501
  138    H8     A  13           H8         A  13  -8.732  10.769  14.902
  139   1H6     A  13          1H6         A  13  -3.500  11.007  18.175
  140   2H6     A  13          2H6         A  13  -5.110  10.326  18.070
  141    H2     A  13           H2         A  13  -2.967  13.587  14.549
  142   1H5*    G  14          1H5*        G  14  -5.482  12.943  11.299
  143   2H5*    G  14          2H5*        G  14  -4.738  14.553  11.107
  144    H4*    G  14           H4*        G  14  -2.866  13.394   9.957
  145    H3*    G  14           H3*        G  14  -4.497  10.884  10.438
  146   1H2*    G  14          1H2*        G  14  -2.467   9.691  10.364
  147   2HO*    G  14          2HO*        G  14  -0.713  10.621   9.567
  148    H1*    G  14           H1*        G  14  -1.376  11.456  12.094
  149    H8     G  14           H8         G  14  -5.198  10.316  12.366
  150    H1     G  14           H1         G  14  -1.298   8.116  16.930
  151   1H2     G  14          1H2         G  14   0.795   8.820  16.572
  152   2H2     G  14          2H2         G  14   1.214   9.805  15.189
  153   1H5*    C  15          1H5*        C  15  -0.856  10.762   5.571
  154   2H5*    C  15          2H5*        C  15  -2.578  10.335   5.851
  155    H4*    C  15           H4*        C  15  -1.777   9.531   8.084
  156    H3*    C  15           H3*        C  15   0.542  10.851   7.850
  157   1H2*    C  15          1H2*        C  15   1.166   9.861   5.916
  158   2HO*    C  15          2HO*        C  15   2.751   8.118   6.419
  159    H1*    C  15           H1*        C  15   0.316   7.070   6.884
  160   1H4     C  15          1H4         C  15   1.361   6.196   0.574
  161   2H4     C  15          2H4         C  15   0.031   7.290   0.289
  162    H5     C  15           H5         C  15  -1.229   8.360   2.095
  163    H6     C  15           H6         C  15  -1.207   8.684   4.622
  164   1H5*    U  16          1H5*        U  16   1.878   6.873  11.698
  165   2H5*    U  16          2H5*        U  16   0.515   7.124  10.560
  166    H4*    U  16           H4*        U  16   0.557   7.139  13.648
  167    H3*    U  16           H3*        U  16  -0.565   5.236  11.579
  168   1H2*    U  16          1H2*        U  16  -2.212   4.581  13.226
  169   2HO*    U  16          2HO*        U  16  -1.166   6.680  14.787
  170    H1*    U  16           H1*        U  16  -3.012   6.965  13.472
  171    H3     U  16           H3         U  16  -5.419   5.035   9.919
  172    H5     U  16           H5         U  16  -2.488   7.501   8.240
  173    H6     U  16           H6         U  16  -1.472   7.711  10.367
  174   1H5*    A  17          1H5*        A  17  -0.552   0.280  14.461
  175   2H5*    A  17          2H5*        A  17  -0.508   0.647  12.702
  176    H4*    A  17           H4*        A  17  -2.305   1.816  14.909
  177    H3*    A  17           H3*        A  17  -2.832  -0.670  13.646
  178   1H2*    A  17          1H2*        A  17  -2.704   0.299  11.649
  179   2HO*    A  17          2HO*        A  17  -5.166  -0.470  12.583
  180    H1*    A  17           H1*        A  17  -4.600   2.438  12.659
  181    H8     A  17           H8         A  17  -1.627   3.641  10.727
  182   1H6     A  17          1H6         A  17  -4.983   2.925   5.552
  183   2H6     A  17          2H6         A  17  -3.628   3.767   6.262
  184    H2     A  17           H2         A  17  -7.193   1.060   9.073
  185   1H5*    C  18          1H5*        C  18  -7.493  -0.007  13.635
  186   2H5*    C  18          2H5*        C  18  -7.891  -1.519  14.527
  187    H4*    C  18           H4*        C  18  -8.889  -1.256  12.211
  188    H3*    C  18           H3*        C  18  -7.023  -3.425  12.794
  189   1H2*    C  18          1H2*        C  18  -5.801  -3.107  11.167
  190   2HO*    C  18          2HO*        C  18  -8.065  -4.263   9.819
  191    H1*    C  18           H1*        C  18  -8.163  -1.881   9.813
  192   1H4     C  18          1H4         C  18  -4.110  -0.266   5.106
  193   2H4     C  18          2H4         C  18  -2.794  -0.063   6.229
  194    H5     C  18           H5         C  18  -2.956  -0.654   8.590
  195    H6     C  18           H6         C  18  -4.499  -1.317  10.366
  196   1H5*    A  19          1H5*        A  19  -9.184  -2.764   8.388
  197   2H5*    A  19          2H5*        A  19 -10.893  -3.272   8.255
  198    H4*    A  19           H4*        A  19  -9.312  -3.766   6.399
  199    H3*    A  19           H3*        A  19 -10.945  -5.818   7.606
  200   1H2*    A  19          1H2*        A  19  -9.168  -7.028   8.199
  201   2HO*    A  19          2HO*        A  19  -9.087  -7.815   5.424
  202    H1*    A  19           H1*        A  19  -7.845  -6.023   5.677
  203    H8     A  19           H8         A  19  -6.347  -6.356   9.273
  204   1H6     A  19          1H6         A  19  -2.737 -10.697   6.695
  205   2H6     A  19          2H6         A  19  -2.941  -9.690   8.124
  206    H2     A  19           H2         A  19  -5.689  -9.379   3.644
  207   1H5*    C  20          1H5*        C  20 -12.887  -4.788   2.172
  208   2H5*    C  20          2H5*        C  20 -13.422  -6.477   2.425
  209    H4*    C  20           H4*        C  20 -11.470  -6.278   0.984
  210    H3*    C  20           H3*        C  20 -11.214  -7.823   3.348
  211   1H2*    C  20          1H2*        C  20  -9.784  -6.283   4.143
  212   2HO*    C  20          2HO*        C  20  -8.118  -8.118   2.681
  213    H1*    C  20           H1*        C  20  -8.734  -6.085   1.299
  214   1H4     C  20          1H4         C  20  -4.295  -2.170   3.767
  215   2H4     C  20          2H4         C  20  -5.275  -1.893   5.194
  216    H5     C  20           H5         C  20  -7.338  -3.004   5.613
  217    H6     C  20           H6         C  20  -9.071  -4.440   4.613
  218   1H5*    U  21          1H5*        U  21  -8.306  -7.830  -0.128
  219   2H5*    U  21          2H5*        U  21  -7.912  -9.461  -0.757
  220    H4*    U  21           H4*        U  21  -6.352  -7.479  -1.074
  221    H3*    U  21           H3*        U  21  -5.183  -9.741   0.578
  222   1H2*    U  21          1H2*        U  21  -3.616  -8.508   1.245
  223   2HO*    U  21          2HO*        U  21  -3.282  -7.807  -1.492
  224    H1*    U  21           H1*        U  21  -4.696  -6.330  -0.564
  225    H3     U  21           H3         U  21  -1.987  -3.268   1.303
  226    H5     U  21           H5         U  21  -3.358  -5.415   4.668
  227    H6     U  21           H6         U  21  -4.536  -6.895   3.167
  228   1H5*    C  22          1H5*        C  22  -5.818  -6.139  -2.416
  229   2H5*    C  22          2H5*        C  22  -6.114  -6.838  -4.032
  230    H4*    C  22           H4*        C  22  -5.467  -4.422  -3.886
  231    H3*    C  22           H3*        C  22  -4.316  -6.129  -5.676
  232   1H2*    C  22          1H2*        C  22  -2.467  -6.457  -4.369
  233   2HO*    C  22          2HO*        C  22  -1.856  -4.239  -6.086
  234    H1*    C  22           H1*        C  22  -2.369  -3.481  -3.887
  235   1H4     C  22          1H4         C  22   2.058  -4.678   0.505
  236   2H4     C  22          2H4         C  22   1.656  -6.384   0.598
  237    H5     C  22           H5         C  22  -0.208  -7.348  -0.658
  238    H6     C  22           H6         C  22  -1.927  -6.888  -2.326
  239   1H5*    G  23          1H5*        G  23  -2.234  -0.916  -7.841
  240   2H5*    G  23          2H5*        G  23  -2.807  -2.461  -8.559
  241    H4*    G  23           H4*        G  23  -0.519  -1.479  -9.274
  242    H3*    G  23           H3*        G  23  -0.268  -4.156  -7.760
  243   1H2*    G  23          1H2*        G  23   1.855  -4.077  -8.407
  244   2HO*    G  23          2HO*        G  23   2.699  -2.754  -9.742
  245    H1*    G  23           H1*        G  23   2.365  -1.870  -7.595
  246    H8     G  23           H8         G  23  -0.256  -4.143  -5.817
  247    H1     G  23           H1         G  23   5.196  -3.337  -2.643
  248   1H2     G  23          1H2         G  23   6.571  -2.012  -3.840
  249   2H2     G  23          2H2         G  23   6.073  -1.203  -5.317
  250   1H5*    U  24          1H5*        U  24   2.353  -3.749 -11.206
  251   2H5*    U  24          2H5*        U  24   2.576  -5.356 -11.973
  252    H4*    U  24           H4*        U  24   4.686  -4.047 -11.479
  253    H3*    U  24           H3*        U  24   4.374  -6.391  -9.567
  254   1H2*    U  24          1H2*        U  24   6.712  -5.942  -9.022
  255   2HO*    U  24          2HO*        U  24   6.359  -3.702 -10.773
  256    H1*    U  24           H1*        U  24   6.049  -3.456  -8.373
  257    H3     U  24           H3         U  24   5.710  -5.914  -4.401
  258    H5     U  24           H5         U  24   2.034  -6.453  -6.404
  259    H6     U  24           H6         U  24   2.999  -5.329  -8.280
  260   1H5*    G  25          1H5*        G  25   8.217  -6.855 -11.147
  261   2H5*    G  25          2H5*        G  25   8.422  -8.550 -11.724
  262    H4*    G  25           H4*        G  25  10.249  -7.645 -10.206
  263    H3*    G  25           H3*        G  25   8.428  -9.651  -8.826
  264   1H2*    G  25          1H2*        G  25  10.065  -9.657  -7.050
  265   2HO*    G  25          2HO*        G  25  11.376  -7.685  -8.675
  266    H1*    G  25           H1*        G  25   9.830  -7.023  -6.837
  267    H8     G  25           H8         G  25   6.454  -7.893  -8.312
  268    H1     G  25           H1         G  25   6.790  -9.293  -2.090
  269   1H2     G  25          1H2         G  25   8.938  -9.280  -1.415
  270   2H2     G  25          2H2         G  25  10.256  -8.756  -2.448
  271   1H5*    C  26          1H5*        C  26  12.118 -11.385  -7.969
  272   2H5*    C  26          2H5*        C  26  12.112 -13.115  -8.480
  273    H4*    C  26           H4*        C  26  12.703 -12.624  -6.016
  274    H3*    C  26           H3*        C  26   9.973 -13.913  -6.500
  275   1H2*    C  26          1H2*        C  26   9.710 -14.063  -4.141
  276   2HO*    C  26          2HO*        C  26  12.318 -12.867  -4.045
  277    H1*    C  26           H1*        C  26  10.281 -11.492  -3.810
  278   1H4     C  26          1H4         C  26   4.057 -11.690  -5.147
  279   2H4     C  26          2H4         C  26   4.353 -11.343  -6.846
  280    H5     C  26           H5         C  26   6.647 -11.244  -7.750
  281    H6     C  26           H6         C  26   9.005 -11.468  -7.180
  282   1H5*    C  27          1H5*        C  27  10.620 -15.886  -3.370
  283   2H5*    C  27          2H5*        C  27  11.042 -17.620  -3.611
  284    H4*    C  27           H4*        C  27   9.210 -17.044  -1.881
  285    H3*    C  27           H3*        C  27   8.476 -18.529  -4.358
  286   1H2*    C  27          1H2*        C  27   6.537 -17.975  -4.436
  287   2HO*    C  27          2HO*        C  27   5.058 -18.375  -2.620
  288    H1*    C  27           H1*        C  27   6.589 -16.558  -1.759
  289   1H4     C  27          1H4         C  27   1.667 -13.988  -4.962
  290   2H4     C  27          2H4         C  27   2.688 -13.590  -6.335
  291    H5     C  27           H5         C  27   5.039 -14.205  -6.417
  292    H6     C  27           H6         C  27   6.844 -15.328  -5.234
  293    H3T    C  27           H3T        C  27   8.085 -20.234  -2.792
  294    H1   TOA  28           H1       TOA  28  -2.508   5.740   1.074
  295    H2   TOA  28           H2       TOA  28  -0.542   4.277   1.751
  296    H3   TOA  28           H3       TOA  28  -2.769   2.534   2.841
  297    H4   TOA  28           H4       TOA  28  -0.552   4.077   4.233
  298    H5   TOA  28           H5       TOA  28  -3.584   4.424   4.221
  299   1H6   TOA  28          1H6       TOA  28  -2.580   5.083   6.413
  300   2H6   TOA  28          2H6       TOA  28  -1.396   6.064   5.532
  301    HO2  TOA  28           HO2      TOA  28  -1.691   3.887  -0.321
  302    HO4  TOA  28           HO4      TOA  28  -1.683   3.264   6.280
  303    HO6  TOA  28           HO6      TOA  28  -3.153   7.419   6.329
  304   1HN3  TOA  28          1H3       TOA  28   0.144   2.079   2.589
  305   2HN3  TOA  28          2H3       TOA  28  -0.825   1.223   3.698
  306   3HN3  TOA  28          3H3       TOA  28  -1.129   1.131   2.035
  307    H1   TOB  29           H1       TOB  29  -6.424   4.022   1.557
  308   1H2   TOB  29          1H2       TOB  29  -6.501   6.013  -0.696
  309   2H2   TOB  29          2H2       TOB  29  -7.881   4.879  -0.272
  310    H3   TOB  29           H3       TOB  29  -7.958   5.977   1.996
  311   1H4   TOB  29           H4       TOB  29  -5.954   7.881   0.695
  312    H5   TOB  29           H5       TOB  29  -5.654   5.974   3.071
  313    H6   TOB  29           H6       TOB  29  -4.394   5.924   0.329
  314   1HN1  TOB  29          1H1       TOB  29  -5.080   2.784   0.117
  315   2HN1  TOB  29          2H1       TOB  29  -6.328   3.319  -0.897
  316   3HN1  TOB  29          3H1       TOB  29  -4.827   4.075  -0.926
  317   1HN3  TOB  29          1H3       TOB  29  -8.415   7.647  -0.383
  318   2HN3  TOB  29          2H3       TOB  29  -9.459   6.586   0.460
  319   3HN3  TOB  29          3H3       TOB  29  -8.948   8.027   1.194
  320    HO5  TOB  29           HO5      TOB  29  -3.389   6.745   3.097
  321    H1   TOC  30           H1       TOC  30  -4.989   9.312   2.456
  322    H2   TOC  30           H2       TOC  30  -5.577  10.976   4.153
  323   1H3   TOC  30          1H3       TOC  30  -8.220   9.625   4.266
  324   2H3   TOC  30          2H3       TOC  30  -7.711  10.941   5.345
  325    H4   TOC  30           H4       TOC  30  -7.419  12.343   3.351
  326    H5   TOC  30           H5       TOC  30  -8.509   9.943   1.816
  327   1H6   TOC  30          1H6       TOC  30  -7.578  12.674   0.806
  328   2H6   TOC  30          2H6       TOC  30  -8.090  11.295  -0.212
  329   1HN2  TOC  30          1H2       TOC  30  -6.396   8.319   5.109
  330   2HN2  TOC  30          2H2       TOC  30  -4.774   8.727   4.926
  331   3HN2  TOC  30          3H2       TOC  30  -5.726   9.575   6.035
  332   1HN6  TOC  30          1H6       TOC  30 -10.296  11.486   0.678
  333   2HN6  TOC  30          2H6       TOC  30  -9.800  12.686   1.776
  334   3HN6  TOC  30          3H6       TOC  30  -9.789  12.998   0.103
  335    HO4  TOC  30           HO4      TOC  30 -10.051  10.917   3.451
   
  Start of MODEL    5
    1   1H5*    G   1          1H5*        G   1  -5.602 -14.907   8.023
    2   2H5*    G   1          2H5*        G   1  -4.798 -13.685   9.067
    3    H4*    G   1           H4*        G   1  -3.297 -15.238   7.831
    4    H3*    G   1           H3*        G   1  -3.172 -12.414   6.924
    5   1H2*    G   1          1H2*        G   1  -2.682 -12.912   4.989
    6   2HO*    G   1          2HO*        G   1  -0.641 -14.358   4.759
    7    H1*    G   1           H1*        G   1  -2.157 -15.779   5.768
    8    H8     G   1           H8         G   1  -4.860 -14.671   3.255
    9    H1     G   1           H1         G   1   0.660 -16.422   0.509
   10   1H2     G   1          1H2         G   1   2.236 -16.723   2.093
   11   2H2     G   1          2H2         G   1   1.921 -16.430   3.793
   12    H5T    G   1           H5T        G   1  -5.171 -12.139   7.346
   13   1H5*    G   2          1H5*        G   2   0.930 -14.283   7.175
   14   2H5*    G   2          2H5*        G   2   2.023 -13.228   8.137
   15    H4*    G   2           H4*        G   2   3.000 -14.302   6.061
   16    H3*    G   2           H3*        G   2   2.496 -11.348   5.765
   17   1H2*    G   2          1H2*        G   2   2.819 -11.379   3.729
   18   2HO*    G   2          2HO*        G   2   5.184 -11.597   4.165
   19    H1*    G   2           H1*        G   2   3.308 -14.365   3.805
   20    H8     G   2           H8         G   2  -0.071 -12.921   2.774
   21    H1     G   2           H1         G   2   3.835 -13.894  -2.202
   22   1H2     G   2          1H2         G   2   5.934 -14.262  -1.450
   23   2H2     G   2          2H2         G   2   6.300 -14.423   0.256
   24   1H5*    C   3          1H5*        C   3   7.095 -12.145   5.042
   25   2H5*    C   3          2H5*        C   3   7.865 -10.682   5.757
   26    H4*    C   3           H4*        C   3   8.793 -11.258   3.503
   27    H3*    C   3           H3*        C   3   6.707  -9.069   3.288
   28   1H2*    C   3          1H2*        C   3   7.342  -8.707   1.157
   29   2HO*    C   3          2HO*        C   3   9.379  -8.873   0.623
   30    H1*    C   3           H1*        C   3   7.852 -11.353   0.689
   31   1H4     C   3          1H4         C   3   2.452 -10.369  -2.506
   32   2H4     C   3          2H4         C   3   1.513 -10.179  -1.040
   33    H5     C   3           H5         C   3   2.553 -10.237   1.189
   34    H6     C   3           H6         C   3   4.674 -10.459   2.381
   35   1H5*    A   4          1H5*        A   4  10.582  -7.548   1.735
   36   2H5*    A   4          2H5*        A   4  10.616  -5.804   2.186
   37    H4*    A   4           H4*        A   4  11.229  -6.213  -0.192
   38    H3*    A   4           H3*        A   4   8.347  -5.272   0.040
   39   1H2*    A   4          1H2*        A   4   8.449  -5.041  -2.344
   40   2HO*    A   4          2HO*        A   4  10.236  -4.564  -3.174
   41    H1*    A   4           H1*        A   4   9.471  -7.231  -2.765
   42    H8     A   4           H8         A   4   7.077  -7.123   0.176
   43   1H6     A   4          1H6         A   4   2.590  -8.303  -3.888
   44   2H6     A   4          2H6         A   4   2.983  -8.100  -2.194
   45    H2     A   4           H2         A   4   6.424  -7.714  -6.158
   46   1H5*    C   5          1H5*        C   5  10.633  -2.761  -2.523
   47   2H5*    C   5          2H5*        C   5  10.190  -1.026  -2.341
   48    H4*    C   5           H4*        C   5  10.158  -1.990  -4.659
   49    H3*    C   5           H3*        C   5   7.414  -1.412  -3.588
   50   1H2*    C   5          1H2*        C   5   6.456  -1.952  -5.555
   51   2HO*    C   5          2HO*        C   5   8.139  -1.076  -6.957
   52    H1*    C   5           H1*        C   5   7.738  -4.210  -5.722
   53   1H4     C   5          1H4         C   5   2.740  -5.600  -2.039
   54   2H4     C   5          2H4         C   5   3.632  -5.123  -0.606
   55    H5     C   5           H5         C   5   5.886  -4.029  -0.767
   56    H6     C   5           H6         C   5   7.616  -3.261  -2.462
   57   1H5*    G   6          1H5*        G   6   6.210   2.693  -2.597
   58   2H5*    G   6          2H5*        G   6   5.683   1.068  -2.052
   59    H4*    G   6           H4*        G   6   6.162   2.087  -4.933
   60    H3*    G   6           H3*        G   6   3.723   1.298  -3.368
   61   1H2*    G   6          1H2*        G   6   2.591   0.881  -5.434
   62   2HO*    G   6          2HO*        G   6   3.929   2.545  -6.555
   63    H1*    G   6           H1*        G   6   4.494  -0.844  -6.036
   64    H8     G   6           H8         G   6   5.228  -1.223  -2.541
   65    H1     G   6           H1         G   6  -0.626  -3.547  -3.637
   66   1H2     G   6          1H2         G   6  -1.381  -2.842  -5.634
   67   2H2     G   6          2H2         G   6  -0.415  -1.856  -6.712
   68   1H5*    A   7          1H5*        A   7   0.465   5.790  -3.297
   69   2H5*    A   7          2H5*        A   7   0.950   4.432  -2.231
   70    H4*    A   7           H4*        A   7   0.492   4.456  -5.291
   71    H3*    A   7           H3*        A   7  -1.038   3.351  -2.939
   72   1H2*    A   7          1H2*        A   7  -2.024   1.751  -4.480
   73   2HO*    A   7          2HO*        A   7  -1.898   3.424  -6.214
   74    H1*    A   7           H1*        A   7   0.382   1.059  -5.397
   75    H8     A   7           H8         A   7   2.087   1.292  -2.421
   76   1H6     A   7          1H6         A   7  -1.419  -2.847   0.507
   77   2H6     A   7          2H6         A   7   0.133  -2.041   0.453
   78    H2     A   7           H2         A   7  -3.604  -1.554  -3.215
   79   1H5*    G   8          1H5*        G   8  -4.042   3.821  -5.778
   80   2H5*    G   8          2H5*        G   8  -5.605   4.706  -5.811
   81    H4*    G   8           H4*        G   8  -5.751   2.285  -5.103
   82    H3*    G   8           H3*        G   8  -5.989   4.248  -2.825
   83   1H2*    G   8          1H2*        G   8  -6.158   2.728  -1.401
   84   2HO*    G   8          2HO*        G   8  -8.250   1.951  -2.438
   85    H1*    G   8           H1*        G   8  -5.344   0.580  -3.325
   86    H8     G   8           H8         G   8  -2.408   2.279  -2.174
   87    H1     G   8           H1         G   8  -4.239  -1.582   2.550
   88   1H2     G   8          1H2         G   8  -6.345  -2.122   2.339
   89   2H2     G   8          2H2         G   8  -7.220  -2.021   0.837
   90   1H5*    G   9          1H5*        G   9 -11.297   3.629  -1.360
   91   2H5*    G   9          2H5*        G   9  -9.698   3.276  -0.616
   92    H4*    G   9           H4*        G   9 -11.782   1.278  -1.777
   93    H3*    G   9           H3*        G   9 -10.878   2.049   0.988
   94   1H2*    G   9          1H2*        G   9 -11.196  -0.151   1.753
   95   2HO*    G   9          2HO*        G   9 -11.609  -1.354  -0.596
   96    H1*    G   9           H1*        G   9  -9.666  -1.085  -0.203
   97    H8     G   9           H8         G   9  -7.820   1.802  -0.603
   98    H1     G   9           H1         G   9  -6.818  -0.051   5.397
   99   1H2     G   9          1H2         G   9  -8.389  -1.590   6.014
  100   2H2     G   9          2H2         G   9  -9.734  -1.996   4.970
  101   1H5*    U  10          1H5*        U  10 -13.522   4.611   3.333
  102   2H5*    U  10          2H5*        U  10 -11.726   4.603   3.309
  103    H4*    U  10           H4*        U  10 -13.682   2.214   3.330
  104    H3*    U  10           H3*        U  10 -11.855   3.437   5.413
  105   1H2*    U  10          1H2*        U  10 -11.496   1.280   6.365
  106   2HO*    U  10          2HO*        U  10 -13.029   0.342   4.154
  107    H1*    U  10           H1*        U  10 -10.656   0.338   4.070
  108    H3     U  10           H3         U  10  -7.297   2.817   6.606
  109    H5     U  10           H5         U  10  -7.795   4.456   2.769
  110    H6     U  10           H6         U  10  -9.824   3.089   2.571
  111   1H5*    U  11          1H5*        U  11 -12.068   0.342   9.096
  112   2H5*    U  11          2H5*        U  11 -13.421   1.206   9.886
  113    H4*    U  11           H4*        U  11 -10.935   1.616  10.592
  114    H3*    U  11           H3*        U  11 -12.276   4.112   9.462
  115   1H2*    U  11          1H2*        U  11 -10.356   5.230  10.411
  116   2HO*    U  11          2HO*        U  11 -10.403   4.044  12.306
  117    H1*    U  11           H1*        U  11  -8.705   3.227   9.568
  118    H3     U  11           H3         U  11  -7.115   6.330   6.740
  119    H5     U  11           H5         U  11 -11.165   6.038   5.591
  120    H6     U  11           H6         U  11 -11.502   4.487   7.407
  121   1H5*    U  12          1H5*        U  12 -11.981   7.142  13.757
  122   2H5*    U  12          2H5*        U  12 -11.616   6.936  12.010
  123    H4*    U  12           H4*        U  12  -9.737   6.571  14.442
  124    H3*    U  12           H3*        U  12  -9.947   8.604  12.241
  125   1H2*    U  12          1H2*        U  12  -7.827   9.226  12.633
  126   2HO*    U  12          2HO*        U  12  -6.627   8.491  14.314
  127    H1*    U  12           H1*        U  12  -7.024   6.656  12.422
  128    H3     U  12           H3         U  12  -5.984   9.059   8.639
  129    H5     U  12           H5         U  12 -10.105   8.212   8.297
  130    H6     U  12           H6         U  12 -10.006   7.331  10.571
  131   1H5*    A  13          1H5*        A  13 -11.467  12.990  12.594
  132   2H5*    A  13          2H5*        A  13 -11.702  11.903  11.176
  133    H4*    A  13           H4*        A  13 -10.191  14.022  10.967
  134    H3*    A  13           H3*        A  13  -9.493  11.751   9.671
  135   1H2*    A  13          1H2*        A  13  -8.834  10.915  11.830
  136   2HO*    A  13          2HO*        A  13  -6.617  11.426  10.079
  137    H1*    A  13           H1*        A  13  -6.963  13.311  11.831
  138    H8     A  13           H8         A  13  -8.863  10.911  14.349
  139   1H6     A  13          1H6         A  13  -5.445  10.834  17.758
  140   2H6     A  13          2H6         A  13  -3.882  11.607  17.930
  141    H2     A  13           H2         A  13  -3.216  13.973  14.183
  142   1H5*    G  14          1H5*        G  14  -5.456  12.276  10.902
  143   2H5*    G  14          2H5*        G  14  -5.218  13.918  10.234
  144    H4*    G  14           H4*        G  14  -3.000  13.147   9.497
  145    H3*    G  14           H3*        G  14  -4.067  10.387  10.208
  146   1H2*    G  14          1H2*        G  14  -1.944   9.698  10.805
  147   2HO*    G  14          2HO*        G  14  -0.795  11.041   9.191
  148    H1*    G  14           H1*        G  14  -1.567  11.788  12.369
  149    H8     G  14           H8         G  14  -5.275  10.400  11.967
  150    H1     G  14           H1         G  14  -2.069   8.402  17.134
  151   1H2     G  14          1H2         G  14   0.021   9.196  17.095
  152   2H2     G  14          2H2         G  14   0.609  10.189  15.782
  153   1H5*    C  15          1H5*        C  15   0.082   9.102   6.232
  154   2H5*    C  15          2H5*        C  15  -1.676   8.950   6.455
  155    H4*    C  15           H4*        C  15  -1.007   8.218   8.838
  156    H3*    C  15           H3*        C  15   1.711   8.563   7.654
  157   1H2*    C  15          1H2*        C  15   2.508   6.726   8.504
  158   2HO*    C  15          2HO*        C  15   1.252   7.006  10.709
  159    H1*    C  15           H1*        C  15   0.353   5.170   7.942
  160   1H4     C  15          1H4         C  15   4.953   5.076   3.371
  161   2H4     C  15          2H4         C  15   3.912   6.164   2.484
  162    H5     C  15           H5         C  15   1.804   7.145   3.514
  163    H6     C  15           H6         C  15   0.498   7.165   5.584
  164   1H5*    U  16          1H5*        U  16  -0.447   8.454  11.212
  165   2H5*    U  16          2H5*        U  16  -0.054   9.388  12.695
  166    H4*    U  16           H4*        U  16  -0.403   7.262  13.952
  167    H3*    U  16           H3*        U  16  -0.723   6.011  11.189
  168   1H2*    U  16          1H2*        U  16  -2.165   4.470  12.183
  169   2HO*    U  16          2HO*        U  16  -1.083   4.202  14.100
  170    H1*    U  16           H1*        U  16  -3.651   6.333  13.338
  171    H3     U  16           H3         U  16  -5.825   4.996   9.457
  172    H5     U  16           H5         U  16  -3.013   7.820   8.187
  173    H6     U  16           H6         U  16  -2.090   7.807  10.421
  174   1H5*    A  17          1H5*        A  17  -0.088   0.747  13.799
  175   2H5*    A  17          2H5*        A  17  -0.493   1.326  12.143
  176    H4*    A  17           H4*        A  17  -2.055   1.764  14.774
  177    H3*    A  17           H3*        A  17  -2.417  -0.705  13.412
  178   1H2*    A  17          1H2*        A  17  -2.308   0.413  11.499
  179   2HO*    A  17          2HO*        A  17  -5.022  -0.293  12.139
  180    H1*    A  17           H1*        A  17  -4.630   2.076  12.413
  181    H8     A  17           H8         A  17  -1.518   3.518  10.555
  182   1H6     A  17          1H6         A  17  -4.959   2.861   5.524
  183   2H6     A  17          2H6         A  17  -3.648   3.763   6.262
  184    H2     A  17           H2         A  17  -7.134   0.973   9.143
  185   1H5*    C  18          1H5*        C  18  -8.220  -0.527  12.608
  186   2H5*    C  18          2H5*        C  18  -7.768  -1.726  13.861
  187    H4*    C  18           H4*        C  18  -8.230  -2.564  11.480
  188    H3*    C  18           H3*        C  18  -5.684  -3.049  12.792
  189   1H2*    C  18          1H2*        C  18  -4.533  -2.183  11.305
  190   2HO*    C  18          2HO*        C  18  -5.150  -4.683  10.011
  191    H1*    C  18           H1*        C  18  -6.682  -3.009   9.399
  192   1H4     C  18          1H4         C  18  -4.146   0.710   4.844
  193   2H4     C  18          2H4         C  18  -2.582   0.628   5.617
  194    H5     C  18           H5         C  18  -2.348  -0.100   7.951
  195    H6     C  18           H6         C  18  -3.462  -1.261   9.779
  196   1H5*    A  19          1H5*        A  19  -6.133  -7.978   9.896
  197   2H5*    A  19          2H5*        A  19  -5.166  -6.931  11.005
  198    H4*    A  19           H4*        A  19  -4.942  -7.259   7.951
  199    H3*    A  19           H3*        A  19  -3.894  -9.226   9.394
  200   1H2*    A  19          1H2*        A  19  -2.724  -7.652  10.719
  201   2HO*    A  19          2HO*        A  19  -1.275  -9.189   9.027
  202    H1*    A  19           H1*        A  19  -1.842  -6.337   8.074
  203    H8     A  19           H8         A  19  -1.843  -6.064  11.890
  204   1H6     A  19          1H6         A  19  -0.121  -1.572  12.294
  205   2H6     A  19          2H6         A  19   0.153  -0.262  11.168
  206    H2     A  19           H2         A  19  -0.951  -1.899   7.107
  207   1H5*    C  20          1H5*        C  20  -6.619  -8.018   4.827
  208   2H5*    C  20          2H5*        C  20  -4.998  -7.236   4.883
  209    H4*    C  20           H4*        C  20  -7.380  -6.741   6.798
  210    H3*    C  20           H3*        C  20  -6.523  -5.137   4.350
  211   1H2*    C  20          1H2*        C  20  -7.296  -3.192   5.517
  212   2HO*    C  20          2HO*        C  20  -7.584  -4.670   7.881
  213    H1*    C  20           H1*        C  20  -5.631  -3.792   7.562
  214   1H4     C  20          1H4         C  20  -1.529  -2.271   2.643
  215   2H4     C  20          2H4         C  20  -0.508  -3.355   3.559
  216    H5     C  20           H5         C  20  -1.372  -4.659   5.547
  217    H6     C  20           H6         C  20  -3.303  -5.128   6.802
  218   1H5*    U  21          1H5*        U  21  -9.780  -3.525   2.457
  219   2H5*    U  21          2H5*        U  21 -10.835  -4.963   2.211
  220    H4*    U  21           H4*        U  21 -10.749  -3.259   0.360
  221    H3*    U  21           H3*        U  21 -10.537  -5.908  -0.098
  222   1H2*    U  21          1H2*        U  21  -8.361  -6.002   0.106
  223   2HO*    U  21          2HO*        U  21  -7.824  -5.608  -2.576
  224    H1*    U  21           H1*        U  21  -7.951  -3.647  -1.785
  225    H3     U  21           H3         U  21  -3.587  -2.913  -0.918
  226    H5     U  21           H5         U  21  -4.750  -5.309   2.335
  227    H6     U  21           H6         U  21  -6.987  -5.307   1.461
  228   1H5*    C  22          1H5*        C  22  -9.576  -4.299  -5.224
  229   2H5*    C  22          2H5*        C  22  -9.189  -5.373  -3.832
  230    H4*    C  22           H4*        C  22  -7.357  -3.385  -5.301
  231    H3*    C  22           H3*        C  22  -7.794  -6.356  -5.538
  232   1H2*    C  22          1H2*        C  22  -5.960  -6.795  -4.666
  233   2HO*    C  22          2HO*        C  22  -5.186  -5.736  -7.146
  234    H1*    C  22           H1*        C  22  -5.146  -3.909  -5.145
  235   1H4     C  22          1H4         C  22  -0.358  -5.077  -1.124
  236   2H4     C  22          2H4         C  22  -1.238  -6.314  -0.238
  237    H5     C  22           H5         C  22  -3.558  -6.896  -0.813
  238    H6     C  22           H6         C  22  -5.379  -6.476  -2.389
  239   1H5*    G  23          1H5*        G  23  -5.774  -6.475 -10.390
  240   2H5*    G  23          2H5*        G  23  -5.841  -6.560  -8.603
  241    H4*    G  23           H4*        G  23  -3.684  -5.277 -10.406
  242    H3*    G  23           H3*        G  23  -3.456  -7.807  -8.666
  243   1H2*    G  23          1H2*        G  23  -1.519  -7.654  -8.598
  244   2HO*    G  23          2HO*        G  23  -1.008  -7.491 -10.764
  245    H1*    G  23           H1*        G  23  -1.370  -4.968  -8.911
  246    H8     G  23           H8         G  23  -3.158  -6.685  -5.934
  247    H1     G  23           H1         G  23   2.961  -5.155  -4.912
  248   1H2     G  23          1H2         G  23   3.861  -4.384  -6.836
  249   2H2     G  23          2H2         G  23   2.903  -4.118  -8.280
  250   1H5*    U  24          1H5*        U  24  -1.062  -7.858 -12.807
  251   2H5*    U  24          2H5*        U  24  -0.899  -9.621 -13.149
  252    H4*    U  24           H4*        U  24   1.220  -8.233 -13.406
  253    H3*    U  24           H3*        U  24   1.224  -9.940 -10.888
  254   1H2*    U  24          1H2*        U  24   3.586  -9.445 -10.816
  255   2HO*    U  24          2HO*        U  24   3.808  -9.311 -13.160
  256    H1*    U  24           H1*        U  24   3.021  -6.826 -10.935
  257    H3     U  24           H3         U  24   3.727  -8.098  -6.490
  258    H5     U  24           H5         U  24  -0.377  -8.641  -7.186
  259    H6     U  24           H6         U  24  -0.015  -8.202  -9.500
  260   1H5*    G  25          1H5*        G  25   4.703 -11.168 -12.834
  261   2H5*    G  25          2H5*        G  25   4.736 -12.968 -12.921
  262    H4*    G  25           H4*        G  25   6.818 -11.829 -11.981
  263    H3*    G  25           H3*        G  25   5.159 -13.215  -9.832
  264   1H2*    G  25          1H2*        G  25   7.085 -12.865  -8.430
  265   2HO*    G  25          2HO*        G  25   8.616 -13.094 -10.229
  266    H1*    G  25           H1*        G  25   7.079 -10.270  -9.028
  267    H8     G  25           H8         G  25   3.417 -11.191  -9.363
  268    H1     G  25           H1         G  25   5.246 -10.671  -3.257
  269   1H2     G  25          1H2         G  25   7.493 -10.606  -3.131
  270   2H2     G  25          2H2         G  25   8.521 -10.622  -4.554
  271   1H5*    C  26          1H5*        C  26   8.871 -14.764  -9.110
  272   2H5*    C  26          2H5*        C  26   8.812 -16.561  -8.993
  273    H4*    C  26           H4*        C  26   9.836 -15.253  -7.002
  274    H3*    C  26           H3*        C  26   7.125 -16.558  -6.418
  275   1H2*    C  26          1H2*        C  26   7.465 -15.872  -4.146
  276   2HO*    C  26          2HO*        C  26   9.825 -16.176  -4.302
  277    H1*    C  26           H1*        C  26   8.007 -13.374  -4.879
  278   1H4     C  26          1H4         C  26   1.667 -13.746  -4.228
  279   2H4     C  26          2H4         C  26   1.455 -13.955  -5.958
  280    H5     C  26           H5         C  26   3.389 -14.262  -7.464
  281    H6     C  26           H6         C  26   5.822 -14.393  -7.562
  282   1H5*    C  27          1H5*        C  27   8.743 -17.267  -3.107
  283   2H5*    C  27          2H5*        C  27   9.206 -18.975  -2.791
  284    H4*    C  27           H4*        C  27   7.957 -17.701  -0.943
  285    H3*    C  27           H3*        C  27   6.610 -19.995  -2.282
  286   1H2*    C  27          1H2*        C  27   4.705 -19.410  -1.919
  287   2HO*    C  27          2HO*        C  27   3.944 -18.988   0.291
  288    H1*    C  27           H1*        C  27   5.520 -17.082  -0.162
  289   1H4     C  27          1H4         C  27  -0.519 -15.984  -2.012
  290   2H4     C  27          2H4         C  27  -0.055 -15.947  -3.702
  291    H5     C  27           H5         C  27   2.216 -16.488  -4.437
  292    H6     C  27           H6         C  27   4.456 -17.095  -3.689
  293    H3T    C  27           H3T        C  27   7.452 -19.619   0.430
  294    H1   TOA  28           H1       TOA  28  -1.572   5.702   2.477
  295    H2   TOA  28           H2       TOA  28   0.207   4.120   1.973
  296    H3   TOA  28           H3       TOA  28  -1.998   2.071   2.306
  297    H4   TOA  28           H4       TOA  28   0.541   2.566   3.932
  298    H5   TOA  28           H5       TOA  28  -2.375   2.928   4.643
  299   1H6   TOA  28          1H6       TOA  28  -1.451   3.881   6.679
  300   2H6   TOA  28          2H6       TOA  28  -1.051   2.153   6.556
  301    HO2  TOA  28           HO2      TOA  28  -1.234   4.967   0.254
  302    HO4  TOA  28           HO4      TOA  28  -0.302   0.764   5.297
  303    HO6  TOA  28           HO6      TOA  28   0.816   3.343   7.310
  304   1HN3  TOA  28          1H3       TOA  28   0.741   1.895   1.208
  305   2HN3  TOA  28          2H3       TOA  28   0.044   0.559   2.005
  306   3HN3  TOA  28          3H3       TOA  28  -0.724   1.237   0.662
  307    H1   TOB  29           H1       TOB  29  -5.585   3.926   2.264
  308   1H2   TOB  29          1H2       TOB  29  -5.108   5.685  -0.122
  309   2H2   TOB  29          2H2       TOB  29  -6.646   4.717   0.116
  310    H3   TOB  29           H3       TOB  29  -7.048   6.053   2.208
  311   1H4   TOB  29           H4       TOB  29  -4.651   7.658   1.238
  312    H5   TOB  29           H5       TOB  29  -4.967   5.918   3.725
  313    H6   TOB  29           H6       TOB  29  -3.287   5.608   1.209
  314   1HN1  TOB  29          1H1       TOB  29  -3.606   2.865   1.088
  315   2HN1  TOB  29          2H1       TOB  29  -5.171   2.545   0.537
  316   3HN1  TOB  29          3H1       TOB  29  -4.168   3.611  -0.321
  317   1HN3  TOB  29          1H3       TOB  29  -7.675   6.633  -0.189
  318   2HN3  TOB  29          2H3       TOB  29  -8.002   7.732   1.069
  319   3HN3  TOB  29          3H3       TOB  29  -6.675   7.985   0.037
  320    HO5  TOB  29           HO5      TOB  29  -2.665   6.460   4.079
  321    H1   TOC  30           H1       TOC  30  -4.077   9.345   2.479
  322    H2   TOC  30           H2       TOC  30  -4.317  10.817   4.425
  323   1H3   TOC  30          1H3       TOC  30  -6.793   9.290   5.008
  324   2H3   TOC  30          2H3       TOC  30  -6.083  10.517   6.093
  325    H4   TOC  30           H4       TOC  30  -6.331  12.137   4.271
  326    H5   TOC  30           H5       TOC  30  -7.670   9.846   2.757
  327   1H6   TOC  30          1H6       TOC  30  -7.128  12.729   1.897
  328   2H6   TOC  30          2H6       TOC  30  -7.807  11.435   0.863
  329   1HN2  TOC  30          1H2       TOC  30  -3.303   8.556   4.677
  330   2HN2  TOC  30          2H2       TOC  30  -3.789   9.361   6.091
  331   3HN2  TOC  30          3H2       TOC  30  -4.729   8.087   5.454
  332   1HN6  TOC  30          1H6       TOC  30  -9.411  13.032   1.921
  333   2HN6  TOC  30          2H6       TOC  30  -9.756  11.386   2.134
  334   3HN6  TOC  30          3H6       TOC  30  -9.058  12.266   3.405
  335    HO4  TOC  30           HO4      TOC  30  -8.105  11.810   5.835
   
  Start of MODEL    6
    1   1H5*    G   1          1H5*        G   1  -7.120 -19.303 -10.384
    2   2H5*    G   1          2H5*        G   1  -6.449 -19.972  -8.853
    3    H4*    G   1           H4*        G   1  -4.981 -20.205 -10.890
    4    H3*    G   1           H3*        G   1  -4.120 -18.260  -8.825
    5   1H2*    G   1          1H2*        G   1  -2.982 -17.097 -10.035
    6   2HO*    G   1          2HO*        G   1  -1.329 -18.772  -9.698
    7    H1*    G   1           H1*        G   1  -3.308 -18.962 -12.402
    8    H8     G   1           H8         G   1  -5.315 -15.882 -12.696
    9    H1     G   1           H1         G   1   0.801 -14.634 -14.127
   10   1H2     G   1          1H2         G   1   2.101 -16.369 -13.499
   11   2H2     G   1          2H2         G   1   1.446 -17.760 -12.654
   12    H5T    G   1           H5T        G   1  -7.385 -17.995  -8.428
   13   1H5*    G   2          1H5*        G   2  -0.255 -20.238  -9.718
   14   2H5*    G   2          2H5*        G   2   0.432 -20.781  -8.144
   15    H4*    G   2           H4*        G   2   1.957 -19.431  -9.736
   16    H3*    G   2           H3*        G   2   1.025 -17.982  -7.257
   17   1H2*    G   2          1H2*        G   2   1.686 -16.157  -7.917
   18   2HO*    G   2          2HO*        G   2   3.784 -15.919  -9.103
   19    H1*    G   2           H1*        G   2   2.622 -17.361 -10.523
   20    H8     G   2           H8         G   2  -0.723 -15.585 -10.305
   21    H1     G   2           H1         G   2   4.054 -11.579 -11.730
   22   1H2     G   2          1H2         G   2   6.032 -12.587 -11.336
   23   2H2     G   2          2H2         G   2   6.159 -14.279 -10.885
   24   1H5*    C   3          1H5*        C   3   5.642 -18.022  -7.314
   25   2H5*    C   3          2H5*        C   3   6.103 -18.221  -5.584
   26    H4*    C   3           H4*        C   3   7.427 -16.455  -6.772
   27    H3*    C   3           H3*        C   3   5.213 -15.246  -5.089
   28   1H2*    C   3          1H2*        C   3   6.183 -13.192  -5.394
   29   2HO*    C   3          2HO*        C   3   8.239 -13.025  -5.590
   30    H1*    C   3           H1*        C   3   6.863 -13.713  -7.940
   31   1H4     C   3          1H4         C   3   1.842  -9.930  -8.676
   32   2H4     C   3          2H4         C   3   0.710 -11.143  -8.112
   33    H5     C   3           H5         C   3   1.465 -13.378  -7.382
   34    H6     C   3           H6         C   3   3.437 -14.762  -6.961
   35   1H5*    A   4          1H5*        A   4   9.053 -13.706  -3.941
   36   2H5*    A   4          2H5*        A   4   9.034 -13.491  -2.153
   37    H4*    A   4           H4*        A   4   9.897 -11.504  -3.377
   38    H3*    A   4           H3*        A   4   7.015 -11.104  -2.494
   39   1H2*    A   4          1H2*        A   4   7.391  -8.790  -3.121
   40   2HO*    A   4          2HO*        A   4   9.295  -8.077  -2.940
   41    H1*    A   4           H1*        A   4   8.393  -9.302  -5.295
   42    H8     A   4           H8         A   4   5.746 -11.747  -4.240
   43   1H6     A   4          1H6         A   4   1.672  -7.898  -6.868
   44   2H6     A   4          2H6         A   4   1.851  -9.420  -6.019
   45    H2     A   4           H2         A   4   5.701  -5.938  -6.875
   46   1H5*    C   5          1H5*        C   5   9.706  -8.206  -1.069
   47   2H5*    C   5          2H5*        C   5   9.339  -7.657   0.608
   48    H4*    C   5           H4*        C   5   9.622  -5.877  -1.120
   49    H3*    C   5           H3*        C   5   6.764  -6.188  -0.270
   50   1H2*    C   5          1H2*        C   5   6.210  -4.355  -1.443
   51   2HO*    C   5          2HO*        C   5   7.625  -2.872  -1.679
   52    H1*    C   5           H1*        C   5   7.352  -5.259  -3.637
   53   1H4     C   5          1H4         C   5   1.647  -8.185  -3.515
   54   2H4     C   5          2H4         C   5   2.331  -9.461  -2.526
   55    H5     C   5           H5         C   5   4.669  -9.338  -1.634
   56    H6     C   5           H6         C   5   6.675  -7.868  -1.540
   57   1H5*    G   6          1H5*        G   6   8.065  -2.133   0.326
   58   2H5*    G   6          2H5*        G   6   7.401  -1.361   1.808
   59    H4*    G   6           H4*        G   6   7.053  -0.207  -0.493
   60    H3*    G   6           H3*        G   6   4.514  -1.265   0.793
   61   1H2*    G   6          1H2*        G   6   3.304  -0.229  -0.904
   62   2HO*    G   6          2HO*        G   6   4.663   1.588  -1.138
   63    H1*    G   6           H1*        G   6   4.743  -1.470  -2.729
   64    H8     G   6           H8         G   6   5.013  -3.943   0.081
   65    H1     G   6           H1         G   6  -0.808  -4.021  -2.530
   66   1H2     G   6          1H2         G   6  -1.091  -2.204  -3.826
   67   2H2     G   6          2H2         G   6   0.131  -0.960  -4.018
   68   1H5*    A   7          1H5*        A   7   2.834   4.073  -1.013
   69   2H5*    A   7          2H5*        A   7   2.206   3.580   0.597
   70    H4*    A   7           H4*        A   7   2.385   1.892  -1.997
   71    H3*    A   7           H3*        A   7   0.113   3.157  -0.478
   72   1H2*    A   7          1H2*        A   7  -0.932   1.399  -0.405
   73   2HO*    A   7          2HO*        A   7  -1.606   1.818  -2.690
   74    H1*    A   7           H1*        A   7   1.157  -0.015  -2.012
   75    H8     A   7           H8         A   7   2.077  -0.993   1.144
   76   1H6     A   7          1H6         A   7  -2.480  -5.054   1.949
   77   2H6     A   7          2H6         A   7  -0.901  -4.506   2.452
   78    H2     A   7           H2         A   7  -3.633  -2.341  -1.478
   79   1H5*    G   8          1H5*        G   8  -1.892   2.222  -4.640
   80   2H5*    G   8          2H5*        G   8  -2.577   3.836  -5.035
   81    H4*    G   8           H4*        G   8  -3.992   1.787  -5.502
   82    H3*    G   8           H3*        G   8  -5.105   3.990  -4.408
   83   1H2*    G   8          1H2*        G   8  -4.510   3.266  -2.243
   84   2HO*    G   8          2HO*        G   8  -7.250   2.595  -2.722
   85    H1*    G   8           H1*        G   8  -5.886   0.636  -2.874
   86    H8     G   8           H8         G   8  -2.683   2.035  -1.156
   87    H1     G   8           H1         G   8  -5.955  -2.260   2.255
   88   1H2     G   8          1H2         G   8  -7.910  -2.763   1.010
   89   2H2     G   8          2H2         G   8  -8.072  -2.194  -0.635
   90   1H5*    G   9          1H5*        G   9 -10.182   3.420  -3.212
   91   2H5*    G   9          2H5*        G   9  -8.680   3.241  -2.254
   92    H4*    G   9           H4*        G   9 -11.001   1.264  -2.731
   93    H3*    G   9           H3*        G   9 -10.021   2.759  -0.286
   94   1H2*    G   9          1H2*        G   9 -11.149   1.130   1.020
   95   2HO*    G   9          2HO*        G   9 -11.689  -0.545  -1.118
   96    H1*    G   9           H1*        G   9  -9.779  -0.802  -0.192
   97    H8     G   9           H8         G   9  -7.509   2.204  -0.733
   98    H1     G   9           H1         G   9  -6.860  -0.139   5.159
   99   1H2     G   9          1H2         G   9  -8.538  -1.465   5.676
  100   2H2     G   9          2H2         G   9  -9.593  -2.173   4.481
  101   1H5*    U  10          1H5*        U  10 -13.950   3.897   2.983
  102   2H5*    U  10          2H5*        U  10 -12.158   4.008   2.844
  103    H4*    U  10           H4*        U  10 -13.934   1.522   3.324
  104    H3*    U  10           H3*        U  10 -12.177   3.178   5.175
  105   1H2*    U  10          1H2*        U  10 -11.736   1.215   6.433
  106   2HO*    U  10          2HO*        U  10 -12.607  -0.793   5.430
  107    H1*    U  10           H1*        U  10 -10.864  -0.038   4.285
  108    H3     U  10           H3         U  10  -7.559   2.526   6.605
  109    H5     U  10           H5         U  10  -8.213   4.289   2.836
  110    H6     U  10           H6         U  10 -10.185   2.862   2.601
  111   1H5*    U  11          1H5*        U  11 -13.157   1.546   8.265
  112   2H5*    U  11          2H5*        U  11 -14.258   2.560   9.270
  113    H4*    U  11           H4*        U  11 -12.141   1.692  10.412
  114    H3*    U  11           H3*        U  11 -12.360   4.672   9.863
  115   1H2*    U  11          1H2*        U  11 -10.283   5.072  10.796
  116   2HO*    U  11          2HO*        U  11 -10.625   3.774  12.571
  117    H1*    U  11           H1*        U  11  -9.048   2.947   9.772
  118    H3     U  11           H3         U  11  -7.042   5.972   7.139
  119    H5     U  11           H5         U  11 -11.005   5.933   5.684
  120    H6     U  11           H6         U  11 -11.582   4.455   7.499
  121   1H5*    U  12          1H5*        U  12 -11.775   7.080  14.315
  122   2H5*    U  12          2H5*        U  12 -11.479   6.986  12.554
  123    H4*    U  12           H4*        U  12  -9.530   6.477  14.922
  124    H3*    U  12           H3*        U  12  -9.733   8.498  12.749
  125   1H2*    U  12          1H2*        U  12  -7.581   8.932  12.929
  126   2HO*    U  12          2HO*        U  12  -6.264   8.165  14.497
  127    H1*    U  12           H1*        U  12  -6.878   6.431  12.684
  128    H3     U  12           H3         U  12  -6.241   8.742   8.791
  129    H5     U  12           H5         U  12 -10.361   7.871   8.837
  130    H6     U  12           H6         U  12 -10.020   7.048  11.131
  131   1H5*    A  13          1H5*        A  13 -11.226  12.906  13.056
  132   2H5*    A  13          2H5*        A  13 -11.736  11.492  12.062
  133    H4*    A  13           H4*        A  13 -10.370  13.393  10.940
  134    H3*    A  13           H3*        A  13  -9.910  10.746  10.551
  135   1H2*    A  13          1H2*        A  13  -8.555  10.506  12.228
  136   2HO*    A  13          2HO*        A  13  -6.661  11.194  10.203
  137    H1*    A  13           H1*        A  13  -6.928  12.950  11.446
  138    H8     A  13           H8         A  13  -8.278  10.727  14.449
  139   1H6     A  13          1H6         A  13  -4.638  11.692  17.491
  140   2H6     A  13          2H6         A  13  -3.232  12.735  17.409
  141    H2     A  13           H2         A  13  -3.368  14.772  13.429
  142   1H5*    G  14          1H5*        G  14  -5.050  14.105   9.116
  143   2H5*    G  14          2H5*        G  14  -4.989  13.024   7.681
  144    H4*    G  14           H4*        G  14  -2.973  13.101   9.251
  145    H3*    G  14           H3*        G  14  -4.411  10.474   9.618
  146   1H2*    G  14          1H2*        G  14  -2.328   9.774  10.554
  147   2HO*    G  14          2HO*        G  14  -0.955  10.978   9.088
  148    H1*    G  14           H1*        G  14  -2.178  12.202  11.851
  149    H8     G  14           H8         G  14  -5.486  10.101  11.803
  150    H1     G  14           H1         G  14  -1.666   9.164  16.861
  151   1H2     G  14          1H2         G  14   0.234  10.330  16.594
  152   2H2     G  14          2H2         G  14   0.526  11.299  15.167
  153   1H5*    C  15          1H5*        C  15  -0.072   8.812   6.205
  154   2H5*    C  15          2H5*        C  15  -1.770   8.614   6.697
  155    H4*    C  15           H4*        C  15  -0.735   7.918   8.960
  156    H3*    C  15           H3*        C  15   1.778   8.212   7.356
  157   1H2*    C  15          1H2*        C  15   2.711   6.383   8.279
  158   2HO*    C  15          2HO*        C  15   1.474   6.809  10.530
  159    H1*    C  15           H1*        C  15   0.424   4.916   7.925
  160   1H4     C  15          1H4         C  15   4.135   4.480   2.647
  161   2H4     C  15          2H4         C  15   3.312   5.901   2.048
  162    H5     C  15           H5         C  15   1.515   7.062   3.407
  163    H6     C  15           H6         C  15   0.478   7.062   5.638
  164   1H5*    U  16          1H5*        U  16  -0.315   8.435  11.047
  165   2H5*    U  16          2H5*        U  16   0.238   9.411  12.446
  166    H4*    U  16           H4*        U  16  -0.142   7.367  13.827
  167    H3*    U  16           H3*        U  16  -0.676   5.993  11.161
  168   1H2*    U  16          1H2*        U  16  -2.058   4.517  12.340
  169   2HO*    U  16          2HO*        U  16  -0.812   4.345  14.176
  170    H1*    U  16           H1*        U  16  -3.451   6.465  13.473
  171    H3     U  16           H3         U  16  -5.826   4.900   9.805
  172    H5     U  16           H5         U  16  -3.105   7.686   8.240
  173    H6     U  16           H6         U  16  -2.056   7.788  10.398
  174   1H5*    A  17          1H5*        A  17   0.268   0.766  13.725
  175   2H5*    A  17          2H5*        A  17  -0.261   1.338  12.103
  176    H4*    A  17           H4*        A  17  -1.625   1.719  14.841
  177    H3*    A  17           H3*        A  17  -2.045  -0.737  13.458
  178   1H2*    A  17          1H2*        A  17  -2.139   0.408  11.560
  179   2HO*    A  17          2HO*        A  17  -4.562  -0.668  12.536
  180    H1*    A  17           H1*        A  17  -4.407   1.960  12.726
  181    H8     A  17           H8         A  17  -1.539   3.580  10.651
  182   1H6     A  17          1H6         A  17  -5.519   3.204   6.000
  183   2H6     A  17          2H6         A  17  -4.070   3.938   6.637
  184    H2     A  17           H2         A  17  -7.199   0.935   9.712
  185   1H5*    C  18          1H5*        C  18  -5.412  -3.553  13.721
  186   2H5*    C  18          2H5*        C  18  -4.267  -2.684  12.634
  187    H4*    C  18           H4*        C  18  -7.341  -2.671  12.622
  188    H3*    C  18           H3*        C  18  -5.727  -4.730  11.634
  189   1H2*    C  18          1H2*        C  18  -4.747  -3.479  10.145
  190   2HO*    C  18          2HO*        C  18  -6.951  -4.864   9.002
  191    H1*    C  18           H1*        C  18  -7.470  -2.426   9.544
  192   1H4     C  18          1H4         C  18  -4.298   1.011   5.150
  193   2H4     C  18          2H4         C  18  -2.789   0.864   6.022
  194    H5     C  18           H5         C  18  -2.660  -0.153   8.235
  195    H6     C  18           H6         C  18  -3.916  -1.415   9.922
  196   1H5*    A  19          1H5*        A  19 -11.101  -7.214  10.970
  197   2H5*    A  19          2H5*        A  19  -9.418  -7.824  11.062
  198    H4*    A  19           H4*        A  19 -10.538  -5.501   9.383
  199    H3*    A  19           H3*        A  19 -11.073  -8.115   8.799
  200   1H2*    A  19          1H2*        A  19  -8.766  -8.663   8.903
  201   2HO*    A  19          2HO*        A  19  -9.210  -8.142   6.077
  202    H1*    A  19           H1*        A  19  -8.535  -6.374   7.012
  203    H8     A  19           H8         A  19  -6.274  -7.485  10.042
  204   1H6     A  19          1H6         A  19  -2.069  -7.404   7.620
  205   2H6     A  19          2H6         A  19  -1.644  -7.086   5.951
  206    H2     A  19           H2         A  19  -5.483  -6.243   3.803
  207   1H5*    C  20          1H5*        C  20 -12.941  -3.180   5.212
  208   2H5*    C  20          2H5*        C  20 -13.773  -4.765   5.294
  209    H4*    C  20           H4*        C  20 -12.457  -4.327   3.229
  210    H3*    C  20           H3*        C  20 -12.100  -6.713   4.573
  211   1H2*    C  20          1H2*        C  20 -10.234  -5.681   5.708
  212   2HO*    C  20          2HO*        C  20  -8.367  -6.853   4.786
  213    H1*    C  20           H1*        C  20  -9.611  -4.969   2.842
  214   1H4     C  20          1H4         C  20  -4.025  -2.569   4.450
  215   2H4     C  20          2H4         C  20  -4.308  -2.732   6.170
  216    H5     C  20           H5         C  20  -6.555  -3.485   7.076
  217    H6     C  20           H6         C  20  -8.732  -4.216   6.437
  218   1H5*    U  21          1H5*        U  21 -11.805  -4.317   1.008
  219   2H5*    U  21          2H5*        U  21 -12.702  -4.475  -0.539
  220    H4*    U  21           H4*        U  21 -10.331  -3.446  -0.511
  221    H3*    U  21           H3*        U  21 -10.821  -6.009  -2.026
  222   1H2*    U  21          1H2*        U  21  -8.828  -6.708  -1.814
  223   2HO*    U  21          2HO*        U  21  -8.078  -4.201  -2.964
  224    H1*    U  21           H1*        U  21  -8.188  -3.938  -0.933
  225    H3     U  21           H3         U  21  -3.936  -4.877   0.210
  226    H5     U  21           H5         U  21  -6.130  -7.853   2.240
  227    H6     U  21           H6         U  21  -8.112  -7.077   1.091
  228   1H5*    C  22          1H5*        C  22  -7.268  -0.922  -2.510
  229   2H5*    C  22          2H5*        C  22  -8.513  -0.721  -3.791
  230    H4*    C  22           H4*        C  22  -6.133  -1.262  -4.535
  231    H3*    C  22           H3*        C  22  -8.088  -3.559  -4.747
  232   1H2*    C  22          1H2*        C  22  -6.669  -4.953  -5.046
  233   2HO*    C  22          2HO*        C  22  -5.039  -3.394  -6.816
  234    H1*    C  22           H1*        C  22  -4.519  -2.797  -4.817
  235   1H4     C  22          1H4         C  22  -1.122  -6.839  -1.342
  236   2H4     C  22          2H4         C  22  -2.368  -8.078  -1.304
  237    H5     C  22           H5         C  22  -4.617  -7.646  -2.247
  238    H6     C  22           H6         C  22  -5.962  -6.039  -3.484
  239   1H5*    G  23          1H5*        G  23  -5.561  -0.551  -9.106
  240   2H5*    G  23          2H5*        G  23  -5.876  -2.184  -8.412
  241    H4*    G  23           H4*        G  23  -3.581  -0.239  -7.724
  242    H3*    G  23           H3*        G  23  -3.450  -2.827  -9.399
  243   1H2*    G  23          1H2*        G  23  -1.576  -3.122  -8.924
  244   2HO*    G  23          2HO*        G  23  -0.738  -1.115  -9.562
  245    H1*    G  23           H1*        G  23  -1.601  -1.625  -6.637
  246    H8     G  23           H8         G  23  -3.677  -4.892  -6.687
  247    H1     G  23           H1         G  23   2.311  -5.610  -4.537
  248   1H2     G  23          1H2         G  23   3.462  -3.696  -4.845
  249   2H2     G  23          2H2         G  23   2.738  -2.279  -5.590
  250   1H5*    U  24          1H5*        U  24  -0.438   0.754 -10.565
  251   2H5*    U  24          2H5*        U  24  -0.037   0.422 -12.290
  252    H4*    U  24           H4*        U  24   1.947   0.906 -10.769
  253    H3*    U  24           H3*        U  24   1.672  -2.030 -11.496
  254   1H2*    U  24          1H2*        U  24   3.871  -2.289 -10.631
  255   2HO*    U  24          2HO*        U  24   5.095  -0.625 -10.647
  256    H1*    U  24           H1*        U  24   3.171  -1.068  -8.360
  257    H3     U  24           H3         U  24   3.242  -5.664  -7.656
  258    H5     U  24           H5         U  24  -0.583  -4.849  -9.168
  259    H6     U  24           H6         U  24   0.097  -2.606  -9.601
  260   1H5*    G  25          1H5*        G  25   5.566  -0.869 -12.660
  261   2H5*    G  25          2H5*        G  25   5.901  -1.485 -14.319
  262    H4*    G  25           H4*        G  25   7.648  -2.001 -12.528
  263    H3*    G  25           H3*        G  25   6.000  -4.437 -13.322
  264   1H2*    G  25          1H2*        G  25   7.656  -5.691 -12.087
  265   2HO*    G  25          2HO*        G  25   9.413  -4.191 -12.611
  266    H1*    G  25           H1*        G  25   7.236  -4.165  -9.965
  267    H8     G  25           H8         G  25   3.857  -3.961 -11.681
  268    H1     G  25           H1         G  25   4.734  -9.560  -8.735
  269   1H2     G  25          1H2         G  25   6.919  -9.822  -8.220
  270   2H2     G  25          2H2         G  25   8.108  -8.559  -8.483
  271   1H5*    C  26          1H5*        C  26   9.900  -5.840 -13.641
  272   2H5*    C  26          2H5*        C  26  10.163  -6.623 -15.243
  273    H4*    C  26           H4*        C  26  10.713  -8.015 -13.117
  274    H3*    C  26           H3*        C  26   8.253  -8.904 -14.711
  275   1H2*    C  26          1H2*        C  26   8.092 -10.765 -13.236
  276   2HO*    C  26          2HO*        C  26   9.633 -10.907 -11.522
  277    H1*    C  26           H1*        C  26   8.232  -9.210 -11.088
  278   1H4     C  26          1H4         C  26   2.084  -9.468 -12.732
  279   2H4     C  26          2H4         C  26   2.175  -7.907 -13.537
  280    H5     C  26           H5         C  26   4.356  -6.786 -13.892
  281    H6     C  26           H6         C  26   6.749  -6.939 -13.465
  282   1H5*    C  27          1H5*        C  27   9.370 -12.382 -13.889
  283   2H5*    C  27          2H5*        C  27  10.123 -13.293 -15.248
  284    H4*    C  27           H4*        C  27   8.312 -14.482 -13.864
  285    H3*    C  27           H3*        C  27   7.762 -13.806 -16.712
  286   1H2*    C  27          1H2*        C  27   5.749 -13.727 -16.564
  287   2HO*    C  27          2HO*        C  27   4.495 -15.581 -15.805
  288    H1*    C  27           H1*        C  27   5.698 -14.746 -13.713
  289   1H4     C  27          1H4         C  27   0.017 -11.973 -14.750
  290   2H4     C  27          2H4         C  27   0.766 -10.421 -15.072
  291    H5     C  27           H5         C  27   3.196 -10.160 -15.218
  292    H6     C  27           H6         C  27   5.336 -11.310 -15.001
  293    H3T    C  27           H3T        C  27   7.933 -16.346 -15.398
  294    H1   TOA  28           H1       TOA  28  -1.935   5.438   2.090
  295    H2   TOA  28           H2       TOA  28  -0.108   3.755   2.004
  296    H3   TOA  28           H3       TOA  28  -2.342   1.838   2.693
  297    H4   TOA  28           H4       TOA  28   0.137   2.685   4.232
  298    H5   TOA  28           H5       TOA  28  -2.853   3.125   4.715
  299   1H6   TOA  28          1H6       TOA  28  -1.612   2.875   6.826
  300   2H6   TOA  28          2H6       TOA  28  -0.436   4.092   6.267
  301    HO2  TOA  28           HO2      TOA  28  -1.522   4.187   0.071
  302    HO4  TOA  28           HO4      TOA  28  -0.746   1.283   5.971
  303    HO6  TOA  28           HO6      TOA  28  -2.104   4.942   7.771
  304   1HN3  TOA  28          1H3       TOA  28  -0.518   0.200   2.802
  305   2HN3  TOA  28          2H3       TOA  28  -0.955   0.722   1.258
  306   3HN3  TOA  28          3H3       TOA  28   0.496   1.260   1.958
  307    H1   TOB  29           H1       TOB  29  -6.002   3.926   2.279
  308   1H2   TOB  29          1H2       TOB  29  -5.848   6.210   0.313
  309   2H2   TOB  29          2H2       TOB  29  -7.342   5.197   0.603
  310    H3   TOB  29           H3       TOB  29  -7.307   5.999   3.002
  311   1H4   TOB  29           H4       TOB  29  -5.074   7.774   1.955
  312    H5   TOB  29           H5       TOB  29  -5.053   5.564   4.069
  313    H6   TOB  29           H6       TOB  29  -3.797   5.768   1.317
  314   1HN1  TOB  29          1H1       TOB  29  -4.606   2.842   0.701
  315   2HN1  TOB  29          2H1       TOB  29  -5.813   3.471  -0.290
  316   3HN1  TOB  29          3H1       TOB  29  -4.339   4.252  -0.155
  317   1HN3  TOB  29          1H3       TOB  29  -8.672   7.084   1.463
  318   2HN3  TOB  29          2H3       TOB  29  -8.033   8.186   2.581
  319   3HN3  TOB  29          3H3       TOB  29  -7.434   8.144   0.975
  320    HO5  TOB  29           HO5      TOB  29  -2.725   6.001   4.207
  321    H1   TOC  30           H1       TOC  30  -3.968   8.838   4.052
  322    H2   TOC  30           H2       TOC  30  -4.602  10.627   5.600
  323   1H3   TOC  30          1H3       TOC  30  -7.376   9.619   5.311
  324   2H3   TOC  30          2H3       TOC  30  -6.865  10.882   6.458
  325    H4   TOC  30           H4       TOC  30  -6.078  12.182   4.531
  326    H5   TOC  30           H5       TOC  30  -7.239   9.916   2.852
  327   1H6   TOC  30          1H6       TOC  30  -5.788  12.460   1.998
  328   2H6   TOC  30          2H6       TOC  30  -6.343  11.159   0.904
  329   1HN2  TOC  30          1H2       TOC  30  -5.752   8.051   6.471
  330   2HN2  TOC  30          2H2       TOC  30  -4.104   8.452   6.517
  331   3HN2  TOC  30          3H2       TOC  30  -5.210   9.347   7.442
  332   1HN6  TOC  30          1H6       TOC  30  -8.588  11.724   1.371
  333   2HN6  TOC  30          2H6       TOC  30  -8.134  12.722   2.669
  334   3HN6  TOC  30          3H6       TOC  30  -7.770  13.181   1.072
  335    HO4  TOC  30           HO4      TOC  30  -8.866  11.131   4.234
   
  Start of MODEL    7
    1   1H5*    G   1          1H5*        G   1  -1.218 -20.958   4.220
    2   2H5*    G   1          2H5*        G   1  -1.237 -20.256   5.878
    3    H4*    G   1           H4*        G   1   0.901 -21.400   5.194
    4    H3*    G   1           H3*        G   1   0.993 -18.441   5.387
    5   1H2*    G   1          1H2*        G   1   2.583 -18.154   4.168
    6   2HO*    G   1          2HO*        G   1   4.599 -19.282   4.514
    7    H1*    G   1           H1*        G   1   3.084 -21.126   3.868
    8    H8     G   1           H8         G   1   1.514 -19.653   0.891
    9    H1     G   1           H1         G   1   7.749 -18.192   0.935
   10   1H2     G   1          1H2         G   1   8.627 -18.619   2.966
   11   2H2     G   1          2H2         G   1   7.671 -19.279   4.279
   12    H5T    G   1           H5T        G   1  -0.753 -18.237   4.948
   13   1H5*    G   2          1H5*        G   2   4.770 -19.318   7.214
   14   2H5*    G   2          2H5*        G   2   4.828 -18.491   8.813
   15    H4*    G   2           H4*        G   2   6.836 -18.186   7.258
   16    H3*    G   2           H3*        G   2   5.064 -15.763   7.535
   17   1H2*    G   2          1H2*        G   2   5.976 -14.758   5.988
   18   2HO*    G   2          2HO*        G   2   7.871 -14.366   7.418
   19    H1*    G   2           H1*        G   2   7.816 -17.106   5.485
   20    H8     G   2           H8         G   2   4.693 -16.625   3.386
   21    H1     G   2           H1         G   2   9.772 -13.691   0.848
   22   1H2     G   2          1H2         G   2  11.427 -13.568   2.371
   23   2H2     G   2          2H2         G   2  11.325 -14.358   3.935
   24   1H5*    C   3          1H5*        C   3   9.389 -14.597   8.878
   25   2H5*    C   3          2H5*        C   3   9.113 -13.444  10.234
   26    H4*    C   3           H4*        C   3  10.830 -12.649   8.590
   27    H3*    C   3           H3*        C   3   8.145 -11.332   8.100
   28   1H2*    C   3          1H2*        C   3   9.183  -9.857   6.690
   29   2HO*    C   3          2HO*        C   3  11.142  -9.287   7.016
   30    H1*    C   3           H1*        C   3  10.836 -11.736   5.700
   31   1H4     C   3          1H4         C   3   6.626 -11.145   1.017
   32   2H4     C   3          2H4         C   3   5.337 -11.908   1.926
   33    H5     C   3           H5         C   3   5.695 -12.717   4.234
   34    H6     C   3           H6         C   3   7.299 -12.789   6.081
   35   1H5*    A   4          1H5*        A   4  11.170  -8.350   8.752
   36   2H5*    A   4          2H5*        A   4  10.401  -6.993   9.650
   37    H4*    A   4           H4*        A   4  11.721  -6.262   7.662
   38    H3*    A   4           H3*        A   4   8.738  -6.260   7.069
   39   1H2*    A   4          1H2*        A   4   9.376  -5.061   5.069
   40   2HO*    A   4          2HO*        A   4  11.039  -3.878   5.186
   41    H1*    A   4           H1*        A   4  11.181  -6.613   4.446
   42    H8     A   4           H8         A   4   8.272  -8.269   6.161
   43   1H6     A   4          1H6         A   4   5.699  -8.638   0.526
   44   2H6     A   4          2H6         A   4   5.483  -9.061   2.214
   45    H2     A   4           H2         A   4   9.450  -6.230   0.235
   46   1H5*    C   5          1H5*        C   5  10.579  -2.404   6.530
   47   2H5*    C   5          2H5*        C   5   9.456  -1.063   6.966
   48    H4*    C   5           H4*        C   5  10.531  -0.976   4.699
   49    H3*    C   5           H3*        C   5   7.612  -1.629   4.525
   50   1H2*    C   5          1H2*        C   5   7.713  -1.403   2.290
   51   2HO*    C   5          2HO*        C   5   9.072  -0.032   1.536
   52    H1*    C   5           H1*        C   5   9.715  -3.112   2.105
   53   1H4     C   5          1H4         C   5   4.303  -6.533   2.597
   54   2H4     C   5          2H4         C   5   4.528  -6.600   4.335
   55    H5     C   5           H5         C   5   6.261  -5.199   5.495
   56    H6     C   5           H6         C   5   8.100  -3.580   5.065
   57   1H5*    G   6          1H5*        G   6   7.908   1.973   2.352
   58   2H5*    G   6          2H5*        G   6   6.471   3.046   2.489
   59    H4*    G   6           H4*        G   6   7.190   2.081   0.157
   60    H3*    G   6           H3*        G   6   4.525   1.061   1.202
   61   1H2*    G   6          1H2*        G   6   4.203   0.163  -0.997
   62   2HO*    G   6          2HO*        G   6   5.502   1.892  -1.995
   63    H1*    G   6           H1*        G   6   6.517  -1.146  -0.695
   64    H8     G   6           H8         G   6   5.912  -1.401   2.887
   65    H1     G   6           H1         G   6   1.077  -4.193  -0.209
   66   1H2     G   6          1H2         G   6   1.018  -3.494  -2.349
   67   2H2     G   6          2H2         G   6   2.260  -2.463  -3.029
   68   1H5*    A   7          1H5*        A   7   3.812   3.918  -2.128
   69   2H5*    A   7          2H5*        A   7   2.650   5.267  -2.332
   70    H4*    A   7           H4*        A   7   2.001   2.894  -3.177
   71    H3*    A   7           H3*        A   7   0.460   3.936  -0.813
   72   1H2*    A   7          1H2*        A   7  -0.502   2.164  -0.483
   73   2HO*    A   7          2HO*        A   7  -1.279   0.716  -2.040
   74    H1*    A   7           H1*        A   7   1.088   0.673  -2.519
   75    H8     A   7           H8         A   7   2.563   0.620   0.865
   76   1H6     A   7          1H6         A   7  -1.446  -3.745   2.579
   77   2H6     A   7          2H6         A   7   0.073  -2.944   2.938
   78    H2     A   7           H2         A   7  -2.793  -2.077  -1.390
   79   1H5*    G   8          1H5*        G   8  -3.810   3.845  -4.986
   80   2H5*    G   8          2H5*        G   8  -3.254   4.334  -3.339
   81    H4*    G   8           H4*        G   8  -4.002   1.493  -4.295
   82    H3*    G   8           H3*        G   8  -5.637   3.550  -2.765
   83   1H2*    G   8          1H2*        G   8  -5.935   2.210  -1.213
   84   2HO*    G   8          2HO*        G   8  -7.609   1.088  -2.694
   85    H1*    G   8           H1*        G   8  -4.459   0.023  -2.684
   86    H8     G   8           H8         G   8  -2.464   1.675  -0.057
   87    H1     G   8           H1         G   8  -6.039  -2.985   2.480
   88   1H2     G   8          1H2         G   8  -7.686  -3.589   0.898
   89   2H2     G   8          2H2         G   8  -7.763  -2.814  -0.653
   90   1H5*    G   9          1H5*        G   9 -10.700   2.614  -2.752
   91   2H5*    G   9          2H5*        G   9  -9.249   2.705  -1.707
   92    H4*    G   9           H4*        G   9 -10.960   0.236  -2.489
   93    H3*    G   9           H3*        G   9 -10.706   1.837   0.068
   94   1H2*    G   9          1H2*        G   9 -11.154  -0.101   1.329
   95   2HO*    G   9          2HO*        G   9 -11.558  -2.078   0.215
   96    H1*    G   9           H1*        G   9  -9.280  -1.464   0.091
   97    H8     G   9           H8         G   9  -7.761   1.849  -0.533
   98    H1     G   9           H1         G   9  -6.878   0.145   5.531
   99   1H2     G   9          1H2         G   9  -8.239  -1.541   6.068
  100   2H2     G   9          2H2         G   9  -9.350  -2.255   4.926
  101   1H5*    U  10          1H5*        U  10 -14.244   3.396   2.810
  102   2H5*    U  10          2H5*        U  10 -12.512   3.883   2.786
  103    H4*    U  10           H4*        U  10 -13.767   1.106   3.264
  104    H3*    U  10           H3*        U  10 -12.289   3.036   5.083
  105   1H2*    U  10          1H2*        U  10 -11.656   1.124   6.375
  106   2HO*    U  10          2HO*        U  10 -12.259  -0.946   5.188
  107    H1*    U  10           H1*        U  10 -10.573   0.004   4.240
  108    H3     U  10           H3         U  10  -7.768   3.105   6.688
  109    H5     U  10           H5         U  10  -8.399   4.528   2.777
  110    H6     U  10           H6         U  10 -10.130   2.827   2.530
  111   1H5*    U  11          1H5*        U  11 -12.860   1.390   8.208
  112   2H5*    U  11          2H5*        U  11 -14.085   2.261   9.201
  113    H4*    U  11           H4*        U  11 -11.791   1.834  10.283
  114    H3*    U  11           H3*        U  11 -12.484   4.712   9.564
  115   1H2*    U  11          1H2*        U  11 -10.502   5.428  10.566
  116   2HO*    U  11          2HO*        U  11 -10.677   4.097  12.343
  117    H1*    U  11           H1*        U  11  -8.997   3.469   9.514
  118    H3     U  11           H3         U  11  -7.424   6.655   6.828
  119    H5     U  11           H5         U  11 -11.466   6.375   5.629
  120    H6     U  11           H6         U  11 -11.811   4.788   7.412
  121   1H5*    U  12          1H5*        U  12 -12.227   7.435  13.841
  122   2H5*    U  12          2H5*        U  12 -11.812   7.234  12.109
  123    H4*    U  12           H4*        U  12 -10.007   6.871  14.610
  124    H3*    U  12           H3*        U  12 -10.097   8.844  12.366
  125   1H2*    U  12          1H2*        U  12  -7.957   9.391  12.819
  126   2HO*    U  12          2HO*        U  12  -6.800   8.553  14.491
  127    H1*    U  12           H1*        U  12  -7.206   6.870  12.587
  128    H3     U  12           H3         U  12  -6.283   9.345   8.816
  129    H5     U  12           H5         U  12 -10.390   8.421   8.528
  130    H6     U  12           H6         U  12 -10.217   7.519  10.793
  131   1H5*    A  13          1H5*        A  13 -11.181  13.206  12.240
  132   2H5*    A  13          2H5*        A  13 -11.224  12.049  10.865
  133    H4*    A  13           H4*        A  13  -9.671  14.150  10.786
  134    H3*    A  13           H3*        A  13  -8.863  11.769   9.737
  135   1H2*    A  13          1H2*        A  13  -8.363  11.058  11.885
  136   2HO*    A  13          2HO*        A  13  -5.972  11.715  10.467
  137    H1*    A  13           H1*        A  13  -6.649  13.578  12.134
  138    H8     A  13           H8         A  13  -8.794  11.134  14.404
  139   1H6     A  13          1H6         A  13  -5.607  10.778  18.018
  140   2H6     A  13          2H6         A  13  -4.024  11.466  18.315
  141    H2     A  13           H2         A  13  -3.019  13.937  14.712
  142   1H5*    G  14          1H5*        G  14  -5.224  12.970  11.040
  143   2H5*    G  14          2H5*        G  14  -4.431  14.548  10.832
  144    H4*    G  14           H4*        G  14  -2.383  13.301  10.273
  145    H3*    G  14           H3*        G  14  -4.125  10.837  10.523
  146   1H2*    G  14          1H2*        G  14  -2.071   9.660  10.944
  147   2HO*    G  14          2HO*        G  14  -0.798  11.181   9.538
  148    H1*    G  14           H1*        G  14  -1.456  11.495  12.795
  149    H8     G  14           H8         G  14  -5.269  10.458  12.288
  150    H1     G  14           H1         G  14  -2.302   7.819  17.305
  151   1H2     G  14          1H2         G  14  -0.155   8.431  17.341
  152   2H2     G  14          2H2         G  14   0.526   9.496  16.133
  153   1H5*    C  15          1H5*        C  15  -0.002   9.928   6.197
  154   2H5*    C  15          2H5*        C  15  -1.748   9.688   6.539
  155    H4*    C  15           H4*        C  15  -0.993   8.481   8.574
  156    H3*    C  15           H3*        C  15   1.451   9.566   8.586
  157   1H2*    C  15          1H2*        C  15   1.853   8.942   6.395
  158   2HO*    C  15          2HO*        C  15   3.384   7.085   6.514
  159    H1*    C  15           H1*        C  15   0.885   6.116   7.084
  160   1H4     C  15          1H4         C  15   0.895   7.191   0.537
  161   2H4     C  15          2H4         C  15   2.002   5.855   0.672
  162    H5     C  15           H5         C  15  -0.193   8.255   2.419
  163    H6     C  15           H6         C  15  -0.264   8.220   4.990
  164   1H5*    U  16          1H5*        U  16  -0.151   8.035  11.147
  165   2H5*    U  16          2H5*        U  16   0.547   8.753  12.635
  166    H4*    U  16           H4*        U  16  -0.435   6.831  13.857
  167    H3*    U  16           H3*        U  16  -1.045   5.746  11.079
  168   1H2*    U  16          1H2*        U  16  -2.843   4.556  12.176
  169   2HO*    U  16          2HO*        U  16  -1.997   4.070  14.108
  170    H1*    U  16           H1*        U  16  -3.758   6.712  13.205
  171    H3     U  16           H3         U  16  -6.178   5.575   9.449
  172    H5     U  16           H5         U  16  -2.981   7.867   7.998
  173    H6     U  16           H6         U  16  -1.985   7.785  10.184
  174   1H5*    A  17          1H5*        A  17   0.506   0.221  12.152
  175   2H5*    A  17          2H5*        A  17  -0.290   1.133  10.830
  176    H4*    A  17           H4*        A  17  -0.736   1.466  13.870
  177    H3*    A  17           H3*        A  17  -1.845  -0.799  12.641
  178   1H2*    A  17          1H2*        A  17  -2.460   0.395  10.882
  179   2HO*    A  17          2HO*        A  17  -4.819   0.538  11.169
  180    H1*    A  17           H1*        A  17  -3.943   2.294  12.674
  181    H8     A  17           H8         A  17  -1.613   3.954  10.343
  182   1H6     A  17          1H6         A  17  -5.801   3.855   5.939
  183   2H6     A  17          2H6         A  17  -4.308   4.518   6.557
  184    H2     A  17           H2         A  17  -7.230   1.152   9.435
  185   1H5*    C  18          1H5*        C  18  -4.603  -3.626  13.620
  186   2H5*    C  18          2H5*        C  18  -3.741  -2.605  12.413
  187    H4*    C  18           H4*        C  18  -6.770  -2.864  12.876
  188    H3*    C  18           H3*        C  18  -5.333  -4.906  11.695
  189   1H2*    C  18          1H2*        C  18  -4.338  -3.510  10.199
  190   2HO*    C  18          2HO*        C  18  -6.661  -4.692   8.960
  191    H1*    C  18           H1*        C  18  -7.134  -2.574   9.681
  192   1H4     C  18          1H4         C  18  -4.354   1.346   5.432
  193   2H4     C  18          2H4         C  18  -2.859   1.379   6.342
  194    H5     C  18           H5         C  18  -2.588   0.221   8.457
  195    H6     C  18           H6         C  18  -3.676  -1.264  10.073
  196   1H5*    A  19          1H5*        A  19  -9.707  -3.701  10.719
  197   2H5*    A  19          2H5*        A  19 -11.253  -4.555  11.037
  198    H4*    A  19           H4*        A  19 -10.519  -4.227   8.616
  199    H3*    A  19           H3*        A  19 -11.457  -6.640   9.639
  200   1H2*    A  19          1H2*        A  19  -9.333  -7.533   9.819
  201   2HO*    A  19          2HO*        A  19  -9.983  -8.161   7.091
  202    H1*    A  19           H1*        A  19  -8.930  -6.345   7.057
  203    H8     A  19           H8         A  19  -6.742  -6.998  10.312
  204   1H6     A  19          1H6         A  19  -2.539  -9.101   6.286
  205   2H6     A  19          2H6         A  19  -2.884  -8.775   7.970
  206    H2     A  19           H2         A  19  -6.183  -7.855   3.974
  207   1H5*    C  20          1H5*        C  20 -12.832  -2.520   5.445
  208   2H5*    C  20          2H5*        C  20 -13.956  -3.912   5.396
  209    H4*    C  20           H4*        C  20 -12.417  -3.538   3.392
  210    H3*    C  20           H3*        C  20 -12.589  -6.026   4.748
  211   1H2*    C  20          1H2*        C  20 -10.526  -5.861   5.608
  212   2HO*    C  20          2HO*        C  20  -9.916  -6.771   2.973
  213    H1*    C  20           H1*        C  20  -9.892  -4.611   2.926
  214   1H4     C  20          1H4         C  20  -3.896  -3.706   4.528
  215   2H4     C  20          2H4         C  20  -4.217  -3.770   6.254
  216    H5     C  20           H5         C  20  -6.523  -3.799   7.144
  217    H6     C  20           H6         C  20  -8.866  -4.141   6.515
  218   1H5*    U  21          1H5*        U  21 -10.284  -7.721   0.104
  219   2H5*    U  21          2H5*        U  21  -8.734  -7.570   1.001
  220    H4*    U  21           H4*        U  21  -9.808  -5.797  -1.283
  221    H3*    U  21           H3*        U  21  -8.885  -8.291  -1.752
  222   1H2*    U  21          1H2*        U  21  -7.080  -8.011  -0.446
  223   2HO*    U  21          2HO*        U  21  -5.439  -7.324  -2.561
  224    H1*    U  21           H1*        U  21  -6.429  -5.462  -1.969
  225    H3     U  21           H3         U  21  -3.130  -3.802   0.578
  226    H5     U  21           H5         U  21  -4.686  -6.810   3.038
  227    H6     U  21           H6         U  21  -6.370  -7.245   1.366
  228   1H5*    C  22          1H5*        C  22  -5.935  -6.126  -5.726
  229   2H5*    C  22          2H5*        C  22  -6.096  -7.238  -4.316
  230    H4*    C  22           H4*        C  22  -4.133  -4.910  -4.747
  231    H3*    C  22           H3*        C  22  -3.839  -7.888  -5.125
  232   1H2*    C  22          1H2*        C  22  -2.545  -8.042  -3.500
  233   2HO*    C  22          2HO*        C  22  -0.973  -6.657  -5.359
  234    H1*    C  22           H1*        C  22  -2.235  -5.023  -3.576
  235   1H4     C  22          1H4         C  22   0.495  -5.712   2.135
  236   2H4     C  22          2H4         C  22  -0.490  -7.101   2.565
  237    H5     C  22           H5         C  22  -2.132  -8.059   1.006
  238    H6     C  22           H6         C  22  -3.137  -7.825  -1.211
  239   1H5*    G  23          1H5*        G  23   0.400  -6.831  -8.571
  240   2H5*    G  23          2H5*        G  23  -0.413  -7.340  -7.057
  241    H4*    G  23           H4*        G  23   1.598  -5.018  -7.420
  242    H3*    G  23           H3*        G  23   2.099  -7.739  -6.120
  243   1H2*    G  23          1H2*        G  23   3.654  -7.027  -5.098
  244   2HO*    G  23          2HO*        G  23   4.717  -5.698  -6.842
  245    H1*    G  23           H1*        G  23   2.726  -4.505  -4.923
  246    H8     G  23           H8         G  23   0.490  -7.207  -3.299
  247    H1     G  23           H1         G  23   5.370  -5.229   0.349
  248   1H2     G  23          1H2         G  23   6.707  -3.872  -0.856
  249   2H2     G  23          2H2         G  23   6.413  -3.553  -2.559
  250   1H5*    U  24          1H5*        U  24   5.877  -4.305  -8.485
  251   2H5*    U  24          2H5*        U  24   6.724  -5.542  -9.482
  252    H4*    U  24           H4*        U  24   8.110  -4.277  -7.714
  253    H3*    U  24           H3*        U  24   7.574  -7.158  -6.886
  254   1H2*    U  24          1H2*        U  24   9.188  -6.802  -5.245
  255   2HO*    U  24          2HO*        U  24  10.713  -5.482  -5.584
  256    H1*    U  24           H1*        U  24   8.152  -4.352  -4.625
  257    H3     U  24           H3         U  24   7.562  -7.217  -1.069
  258    H5     U  24           H5         U  24   4.507  -8.251  -3.725
  259    H6     U  24           H6         U  24   5.451  -6.758  -5.363
  260   1H5*    G  25          1H5*        G  25  11.771  -6.335  -7.035
  261   2H5*    G  25          2H5*        G  25  12.659  -7.772  -7.656
  262    H4*    G  25           H4*        G  25  13.563  -6.684  -5.536
  263    H3*    G  25           H3*        G  25  12.196  -9.341  -4.932
  264   1H2*    G  25          1H2*        G  25  13.292  -9.091  -2.777
  265   2HO*    G  25          2HO*        G  25  15.163  -7.955  -3.676
  266    H1*    G  25           H1*        G  25  12.220  -6.686  -2.511
  267    H8     G  25           H8         G  25   9.720  -8.606  -4.683
  268    H1     G  25           H1         G  25   9.298 -10.111   1.511
  269   1H2     G  25          1H2         G  25  11.103  -9.320   2.621
  270   2H2     G  25          2H2         G  25  12.326  -8.332   1.845
  271   1H5*    C  26          1H5*        C  26  15.960  -9.568  -3.102
  272   2H5*    C  26          2H5*        C  26  16.771 -11.131  -3.484
  273    H4*    C  26           H4*        C  26  16.519 -10.459  -0.985
  274    H3*    C  26           H3*        C  26  14.810 -12.838  -1.884
  275   1H2*    C  26          1H2*        C  26  14.140 -13.076   0.393
  276   2HO*    C  26          2HO*        C  26  15.892 -10.849   0.853
  277    H1*    C  26           H1*        C  26  13.458 -10.521   0.574
  278   1H4     C  26          1H4         C  26   8.385 -13.570  -1.790
  279   2H4     C  26          2H4         C  26   8.806 -13.120  -3.436
  280    H5     C  26           H5         C  26  10.943 -11.978  -3.942
  281    H6     C  26           H6         C  26  12.992 -11.099  -2.961
  282   1H5*    C  27          1H5*        C  27  15.633 -14.118   1.579
  283   2H5*    C  27          2H5*        C  27  16.832 -15.457   1.664
  284    H4*    C  27           H4*        C  27  14.627 -15.674   3.024
  285    H3*    C  27           H3*        C  27  15.172 -17.528   0.756
  286   1H2*    C  27          1H2*        C  27  13.263 -18.006   0.315
  287   2HO*    C  27          2HO*        C  27  11.784 -18.864   1.984
  288    H1*    C  27           H1*        C  27  12.096 -16.504   2.673
  289   1H4     C  27          1H4         C  27   7.419 -17.102  -1.691
  290   2H4     C  27          2H4         C  27   8.334 -16.166  -2.860
  291    H5     C  27           H5         C  27  10.599 -15.400  -2.422
  292    H6     C  27           H6         C  27  12.414 -15.376  -0.803
  293    H3T    C  27           H3T        C  27  16.288 -17.840   2.745
  294    H1   TOA  28           H1       TOA  28  -2.048   5.835   1.976
  295    H2   TOA  28           H2       TOA  28  -0.153   4.261   1.780
  296    H3   TOA  28           H3       TOA  28  -2.206   2.241   2.702
  297    H4   TOA  28           H4       TOA  28   0.340   3.279   4.012
  298    H5   TOA  28           H5       TOA  28  -2.605   3.576   4.766
  299   1H6   TOA  28          1H6       TOA  28  -0.089   4.720   6.020
  300   2H6   TOA  28          2H6       TOA  28  -1.766   5.120   6.500
  301    HO2  TOA  28           HO2      TOA  28  -1.664   4.545  -0.059
  302    HO4  TOA  28           HO4      TOA  28  -0.431   1.914   5.883
  303    HO6  TOA  28           HO6      TOA  28  -0.728   3.479   7.970
  304   1HN3  TOA  28          1H3       TOA  28  -0.138   0.798   2.685
  305   2HN3  TOA  28          2H3       TOA  28  -0.797   1.184   1.173
  306   3HN3  TOA  28          3H3       TOA  28   0.578   1.999   1.719
  307    H1   TOB  29           H1       TOB  29  -6.018   4.163   2.606
  308   1H2   TOB  29          1H2       TOB  29  -6.089   6.223   0.397
  309   2H2   TOB  29          2H2       TOB  29  -7.518   5.218   0.895
  310    H3   TOB  29           H3       TOB  29  -7.378   6.246   3.178
  311   1H4   TOB  29           H4       TOB  29  -5.259   7.995   1.871
  312    H5   TOB  29           H5       TOB  29  -5.021   5.958   4.142
  313    H6   TOB  29           H6       TOB  29  -3.967   5.973   1.292
  314   1HN1  TOB  29          1H1       TOB  29  -4.591   3.023   1.070
  315   2HN1  TOB  29          2H1       TOB  29  -6.064   3.280   0.305
  316   3HN1  TOB  29          3H1       TOB  29  -4.730   4.247  -0.083
  317   1HN3  TOB  29          1H3       TOB  29  -7.573   8.310   1.072
  318   2HN3  TOB  29          2H3       TOB  29  -8.779   7.181   1.463
  319   3HN3  TOB  29          3H3       TOB  29  -8.272   8.291   2.637
  320    HO5  TOB  29           HO5      TOB  29  -2.695   6.500   4.073
  321    H1   TOC  30           H1       TOC  30  -4.078   9.230   3.950
  322    H2   TOC  30           H2       TOC  30  -4.787  11.165   5.275
  323   1H3   TOC  30          1H3       TOC  30  -7.527  10.045   5.051
  324   2H3   TOC  30          2H3       TOC  30  -7.082  11.440   6.060
  325    H4   TOC  30           H4       TOC  30  -6.289  12.551   4.027
  326    H5   TOC  30           H5       TOC  30  -7.349  10.082   2.581
  327   1H6   TOC  30          1H6       TOC  30  -6.441  11.116   0.531
  328   2H6   TOC  30          2H6       TOC  30  -7.708  12.148   1.255
  329   1HN2  TOC  30          1H2       TOC  30  -4.197   9.320   6.545
  330   2HN2  TOC  30          2H2       TOC  30  -5.561  10.031   7.239
  331   3HN2  TOC  30          3H2       TOC  30  -5.713   8.574   6.349
  332   1HN6  TOC  30          1H6       TOC  30  -5.993  13.497   2.249
  333   2HN6  TOC  30          2H6       TOC  30  -4.781  12.508   1.588
  334   3HN6  TOC  30          3H6       TOC  30  -5.788  13.421   0.566
  335    HO4  TOC  30           HO4      TOC  30  -8.561  12.811   4.710
   
   
  No H/Q in entry =         335