Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Chemical Shift Entries

listed by accession number in descending order

Number of entries returned: 389

Query grid description

Retrieve entries as a: Compressed file

Query result listed by accession number in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Rok/DNA Complex
G-quadruplex DNA (26-MER)
G-quadruplex DNA (26-MER)
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
human telomeric G-quadruplexes
DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')
DNA (25-MER)
DNA (25-MER)
Kiteplatinated DNA oligomer
TINA-conjugated antiparallel DNA triplex
DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')
DNA (28-MER)
functional pRN1 primase/DNA Complex
functional pRN1 primase/DNA Complex
Tc-DNA/DNA duplex
tc-DNA/tc-DNA duplex
Tc-DNA/RNA duplex
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_minor
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_major
DNA (27-MER)
artificial quadruplex with propeller, diagonal, and lateral loop
ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex
G-quadruplex of Human papillomavirus type 52
DNA (26-MER)
UpsB-Q-1 DNA (34-MER)
UpsB-Q-1, DNA (34-MER)
Artificial quadruplex with propeller, diagonal and lateral loop
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
DNA (27-MER)
Sp1 transcription factor duplex 5'-d(TGGGCGGGA)
Sp1 transcription factor duplex 5'-d(TGGGCGGGG)
Sp1 transcription factor duplex 5'-d(GGGGCGGGA)
Sp1 transcription factor duplex 5'-d(GGGGCGGGG)
DNA (26-MER)
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA Dodecamer with 5-methylcytosine
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA (25-MER)
DNA Dodecamer with 8-oxoguanine at 10th Position
spin labled DNA duplex
d(CGATATCG)2 : C-1305 complex
d(CGATATCG)2 : free form
NZ118 tetramer
KRAS promoter region
c-Myc Pu22
KRAS oncogene promoter region
Photoswitchable G-quadruplex
Glucose as a nuclease mimic in DNA
Glucose in a DNA double helix
DNA free
F1F2-DNA complex
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
Quercetin complexed with c-myc G-quadruplex DNA
DNA G-quadruplex
Control DNA oligonucleotide for the universal base
Universal Base oligonucleotide with UB at point 5
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
active G-quadruplex motif from AGRO100
N2-dG IQ at G1 in NarI sequence
DNA Dodecamer with 8-oxoguanine at 4th Position
DNA complex of the C-Terminal domain of MvaT
A G-quadruplex structure
DNA Dodecamer with 8-oxoguanine at 10th Position
left-handed G-quadruplex
Hs2 dimer
MBD4 methyl-cytosine binding domain bound to methylated DNA
DNA dodecamer with A:C mismatch
DNA dodecamer containing the 5-hydroxycytosine
DNA duplex
CGACTAGTCG with AIK-18/51-1
AG(7-deaza)G FAPY modified duplex
AGC FAPY modified duplex Major isomer
AGT FAPY Modified duplex
AGA modified
The dsDNA in intact bacteriophage T7
G-triplex truncated-TBA
DNA (28-MER)
fd bacteriophage
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
SHB modified duplex
RHB Modified duplex
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
DNA duplex containing N3T-ethylene-N1I
G-quadruplex bound to the bisquinolinium compound Phen-DC3
Molecular Binding of TFF1 Estrogen Response Element
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
spermine modified DNA duplex
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
antiparallel (2+2) G-quadruplex
stacked dimeric G-quadruplex
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
parallel-stranded G-quadruplex in DNA poly-G stretches
N2-dG IQ at G3 in NarI sequence
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
G-rich VEGF aptamer with LNA modifications
Bulges in G-quadruplexes
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
Duplex DNA
major G-quadruplex
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
dodecamer duplex
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
Synthetic cyclic oligonucleotide
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
2'F-ANA and ANA self-complementary duplex
human CEB25 minisatellite G-quadruplex
alpha anomeric lesion
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
DNA Containing an Aristolactam II-dA Lesion
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
C-Terminal domain of Ler
Human Telomeric DNA
Myc G-quadruplex
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
DNA/RNA hybrid
Control DNA duplex
Cidofovir DNA duplex
triazole-linked DNA duplex
25-mer DNA oligomer
MBD2 bound to a methylated DNA
2:1 complex
2:1 complex
1:1 complex
1:2 complex
2:1 complex
1:1 complex
DNA GAAA tetraloop
DNA 12mer
duplex DNA containing an abasic site with opposite T (beta anomer)
duplex DNA containing an abasic site with opposite T (alpha anomer)
cyclic octamer
Nar1 Duplex
Nar1IQ3 Duplex
SRY.B in complex with 16-mer DNA
brinker CG9653-PA/DNA Complex
HIV-1 integrase inhibitor, 93del
Thrombin-binding DNA aptamer
DNA duplex
Lactose operon repressor
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
Synthetic DNA duplex with an AG mismatch
8oxoG:G mismatch
beta alanine linked polyamide bound to purine tract DNA
hERR2-DNA complex
Extended PBX Homeodomain-DNA complex
AT-Rich DNA with the GAA-Hairpin Loop
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
High mobility group protein of Drosophila complexed to a bulge DNA
bulge DNA 12/14mer
cyclic oligonucleotide d
cyclic oligonucleotide d
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
T-tetrad telomere repeats
a3T3 hybrid
SRY-8mer duplex
SRY-14mer duplex
DNA decamer
Cis-syn thymine cyclobutane dimer
DNA dodecamer duplex
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
H-y5 Triple Helix
DNA minor groove binder
chromomycin-DNA complex
chromomycin-DNA complex
Lymphoid enhancer-binding factor
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
alphaT decamer duplex
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
DNA decamer
Sigma-K RNA Polymerase Promoter Consensus Sequence
DNA dodecamer
Rev-erb beta response element
Tn916 integrase DNA complex
vnd/NK-2 homeodomain DNA complex
BS2 operator DNA complexed with the Antennapedia Homeodomain
14mer DNA duplex containing the operator sequence BS2

  Back to the initial grid   Top of this page