Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Chemical Shift Entries

listed by the number of 15N chemical shifts in descending order

Number of entries returned: 375

Query grid description

Retrieve entries as a: Compressed file

Query result listed by the number of 15N chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
F1F2-DNA complex
SRY.B in complex with 16-mer DNA
functional pRN1 primase/DNA Complex
functional pRN1 primase/DNA Complex
ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex
vnd/NK-2 homeodomain DNA complex
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
hERR2-DNA complex
Extended PBX Homeodomain-DNA complex
Lymphoid enhancer-binding factor
High mobility group protein of Drosophila complexed to a bulge DNA
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
Tn916 integrase DNA complex
MBD4 methyl-cytosine binding domain bound to methylated DNA
brinker CG9653-PA/DNA Complex
MBD2 bound to a methylated DNA
Lactose operon repressor
C-Terminal domain of Ler
DNA complex of the C-Terminal domain of MvaT
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
BS2 operator DNA complexed with the Antennapedia Homeodomain
14mer DNA duplex containing the operator sequence BS2
The dsDNA in intact bacteriophage T7
KRAS promoter region
Nar1IQ3 Duplex
Nar1 Duplex
duplex DNA containing an abasic site with opposite T (beta anomer)
DNA 12mer
Myc G-quadruplex
Human Telomeric DNA
2:1 complex
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
human CEB25 minisatellite G-quadruplex
2'F-ANA and ANA self-complementary duplex
1:1 complex
Synthetic cyclic oligonucleotide
1:2 complex
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
2:1 complex
2:1 complex
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
DNA Containing an Aristolactam II-dA Lesion
25-mer DNA oligomer
alpha anomeric lesion
dodecamer duplex
major G-quadruplex
Duplex DNA
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
cyclic octamer
Bulges in G-quadruplexes
duplex DNA containing an abasic site with opposite T (alpha anomer)
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
N2-dG IQ at G3 in NarI sequence
parallel-stranded G-quadruplex in DNA poly-G stretches
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
stacked dimeric G-quadruplex
antiparallel (2+2) G-quadruplex
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
spermine modified DNA duplex
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Molecular Binding of TFF1 Estrogen Response Element
G-quadruplex bound to the bisquinolinium compound Phen-DC3
1:1 complex
RHB Modified duplex
SHB modified duplex
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
fd bacteriophage
DNA (28-MER)
G-triplex truncated-TBA
AGA modified
triazole-linked DNA duplex
Cidofovir DNA duplex
Control DNA duplex
DNA/RNA hybrid
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
CGACTAGTCG with AIK-18/51-1
DNA duplex
DNA dodecamer containing the 5-hydroxycytosine
DNA dodecamer with A:C mismatch
G-rich VEGF aptamer with LNA modifications
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
Hs2 dimer
left-handed G-quadruplex
DNA Dodecamer with 8-oxoguanine at 10th Position
A G-quadruplex structure
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
DNA Dodecamer with 8-oxoguanine at 4th Position
N2-dG IQ at G1 in NarI sequence
active G-quadruplex motif from AGRO100
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
Universal Base oligonucleotide with UB at point 5
Control DNA oligonucleotide for the universal base
DNA G-quadruplex
Quercetin complexed with c-myc G-quadruplex DNA
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
DNA free
Glucose in a DNA double helix
Glucose as a nuclease mimic in DNA
Photoswitchable G-quadruplex
KRAS oncogene promoter region
c-Myc Pu22
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
d(CGATATCG)2 : C-1305 complex
DNA Dodecamer with 8-oxoguanine at 10th Position
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
DNA (25-MER)
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA Dodecamer with 5-methylcytosine
DNA GAAA tetraloop
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA (26-MER)
Sp1 transcription factor duplex 5'-d(GGGGCGGGG)
Sp1 transcription factor duplex 5'-d(GGGGCGGGA)
Sp1 transcription factor duplex 5'-d(TGGGCGGGG)
Sp1 transcription factor duplex 5'-d(TGGGCGGGA)
DNA (27-MER)
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
Artificial quadruplex with propeller, diagonal and lateral loop
UpsB-Q-1, DNA (34-MER)
UpsB-Q-1 DNA (34-MER)
DNA (26-MER)
G-quadruplex of Human papillomavirus type 52
artificial quadruplex with propeller, diagonal, and lateral loop
DNA (27-MER)
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_major
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_minor
Tc-DNA/RNA duplex
tc-DNA/tc-DNA duplex
Tc-DNA/DNA duplex
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
DNA (28-MER)
DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')
DNA (25-MER)
DNA (25-MER)
DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')
human telomeric G-quadruplexes
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
G-quadruplex DNA (26-MER)
G-quadruplex DNA (26-MER)
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
Rev-erb beta response element
DNA dodecamer
Sigma-K RNA Polymerase Promoter Consensus Sequence
DNA decamer
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
alphaT decamer duplex
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
chromomycin-DNA complex
chromomycin-DNA complex
DNA minor groove binder
H-y5 Triple Helix
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
DNA dodecamer duplex
Cis-syn thymine cyclobutane dimer
DNA decamer
SRY-14mer duplex
SRY-8mer duplex
a3T3 hybrid
T-tetrad telomere repeats
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
cyclic oligonucleotide d
cyclic oligonucleotide d
bulge DNA 12/14mer
DNA duplex containing N3T-ethylene-N1I
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
AT-Rich DNA with the GAA-Hairpin Loop
AGT FAPY Modified duplex
AGC FAPY modified duplex Major isomer
AG(7-deaza)G FAPY modified duplex
beta alanine linked polyamide bound to purine tract DNA
8oxoG:G mismatch
Synthetic DNA duplex with an AG mismatch
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
d(CGATATCG)2 : free form
DNA duplex
Thrombin-binding DNA aptamer
HIV-1 integrase inhibitor, 93del

  Back to the initial grid   Top of this page