Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Chemical Shift Entries

listed by the number of 15N chemical shifts in descending order

Number of entries returned: 384

Query grid description

Retrieve entries as a: Compressed file

Query result listed by the number of 15N chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
F1F2-DNA complex
SRY.B in complex with 16-mer DNA
functional pRN1 primase/DNA Complex
functional pRN1 primase/DNA Complex
ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex
vnd/NK-2 homeodomain DNA complex
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
hERR2-DNA complex
Extended PBX Homeodomain-DNA complex
Lymphoid enhancer-binding factor
High mobility group protein of Drosophila complexed to a bulge DNA
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
Tn916 integrase DNA complex
brinker CG9653-PA/DNA Complex
MBD4 methyl-cytosine binding domain bound to methylated DNA
MBD2 bound to a methylated DNA
Lactose operon repressor
C-Terminal domain of Ler
DNA complex of the C-Terminal domain of MvaT
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
BS2 operator DNA complexed with the Antennapedia Homeodomain
14mer DNA duplex containing the operator sequence BS2
The dsDNA in intact bacteriophage T7
KRAS promoter region
duplex DNA containing an abasic site with opposite T (alpha anomer)
1:2 complex
1:1 complex
Human Telomeric DNA
Nar1IQ3 Duplex
Nar1 Duplex
2:1 complex
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
duplex DNA containing an abasic site with opposite T (beta anomer)
DNA Containing an Aristolactam II-dA Lesion
human CEB25 minisatellite G-quadruplex
2'F-ANA and ANA self-complementary duplex
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
Synthetic cyclic oligonucleotide
1:1 complex
DNA GAAA tetraloop
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
2:1 complex
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
25-mer DNA oligomer
alpha anomeric lesion
Duplex DNA
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
Bulges in G-quadruplexes
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
N2-dG IQ at G3 in NarI sequence
parallel-stranded G-quadruplex in DNA poly-G stretches
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
stacked dimeric G-quadruplex
antiparallel (2+2) G-quadruplex
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
spermine modified DNA duplex
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Molecular Binding of TFF1 Estrogen Response Element
G-quadruplex bound to the bisquinolinium compound Phen-DC3
cyclic octamer
2:1 complex
RHB Modified duplex
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
DNA (28-MER)
G-triplex truncated-TBA
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
AGA modified
AGT FAPY Modified duplex
AGC FAPY modified duplex Major isomer
AG(7-deaza)G FAPY modified duplex
triazole-linked DNA duplex
Cidofovir DNA duplex
Control DNA duplex
DNA/RNA hybrid
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
DNA dodecamer with A:C mismatch
Hs2 dimer
left-handed G-quadruplex
DNA Dodecamer with 8-oxoguanine at 10th Position
A G-quadruplex structure
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
DNA Dodecamer with 8-oxoguanine at 4th Position
N2-dG IQ at G1 in NarI sequence
active G-quadruplex motif from AGRO100
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
Universal Base oligonucleotide with UB at point 5
Control DNA oligonucleotide for the universal base
DNA G-quadruplex
Quercetin complexed with c-myc G-quadruplex DNA
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
DNA free
Glucose in a DNA double helix
Glucose as a nuclease mimic in DNA
Photoswitchable G-quadruplex
KRAS oncogene promoter region
c-Myc Pu22
d(CGATATCG)2 : free form
d(CGATATCG)2 : C-1305 complex
spin labled DNA duplex
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
DNA Dodecamer with 8-oxoguanine at 10th Position
major G-quadruplex
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA Dodecamer with 5-methylcytosine
DNA 12mer
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA (26-MER)
Sp1 transcription factor duplex 5'-d(GGGGCGGGG)
Sp1 transcription factor duplex 5'-d(GGGGCGGGA)
Sp1 transcription factor duplex 5'-d(TGGGCGGGG)
Sp1 transcription factor duplex 5'-d(TGGGCGGGA)
DNA (27-MER)
DNA duplex containing N3T-ethylene-N1I
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
Artificial quadruplex with propeller, diagonal and lateral loop
UpsB-Q-1, DNA (34-MER)
UpsB-Q-1 DNA (34-MER)
DNA (26-MER)
G-quadruplex of Human papillomavirus type 52
Myc G-quadruplex
artificial quadruplex with propeller, diagonal, and lateral loop
DNA (27-MER)
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_major
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_minor
Tc-DNA/RNA duplex
tc-DNA/tc-DNA duplex
Tc-DNA/DNA duplex
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
DNA (28-MER)
DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')
TINA-conjugated antiparallel DNA triplex
Kiteplatinated DNA oligomer
DNA (25-MER)
DNA (25-MER)
DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')
human telomeric G-quadruplexes
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
G-quadruplex DNA (26-MER)
G-quadruplex DNA (26-MER)
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
dodecamer duplex
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
Rev-erb beta response element
DNA dodecamer
Sigma-K RNA Polymerase Promoter Consensus Sequence
DNA decamer
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
alphaT decamer duplex
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
G-rich VEGF aptamer with LNA modifications
chromomycin-DNA complex
chromomycin-DNA complex
DNA minor groove binder
H-y5 Triple Helix
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
DNA dodecamer duplex
Cis-syn thymine cyclobutane dimer
DNA decamer
SRY-14mer duplex
SRY-8mer duplex
a3T3 hybrid
T-tetrad telomere repeats
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
cyclic oligonucleotide d
cyclic oligonucleotide d
bulge DNA 12/14mer
SHB modified duplex
fd bacteriophage
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
AT-Rich DNA with the GAA-Hairpin Loop
CGACTAGTCG with AIK-18/51-1
DNA duplex
DNA dodecamer containing the 5-hydroxycytosine
beta alanine linked polyamide bound to purine tract DNA
8oxoG:G mismatch
Synthetic DNA duplex with an AG mismatch
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
DNA duplex
Thrombin-binding DNA aptamer
HIV-1 integrase inhibitor, 93del
DNA (25-MER)
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')

  Back to the initial grid   Top of this page