BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Chemical Shift Entries

listed by the number of 13C chemical shifts in descending order


Number of entries returned: 389

Query grid description

Retrieve entries as a: Compressed file


Query result listed by the number of 13C chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
7105
SRY.B in complex with 16-mer DNA
1377
619
163
0
X
X
 
18462
Kaiso
1176
607
164
0
X
X
 
5345
LACTOSE OPERON REPRESSOR/DNA Complex
1051
458
138
0
X
X
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
34172
ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex
623
405
102
0
X
X
 
34290
functional pRN1 primase/DNA Complex
720
376
104
0
X
X
 
36186
Rok/DNA Complex
879
355
83
0
X
X
 
16485
THAP RRM1
834
351
84
0
X
X
 
5363
hERR2-DNA complex
764
322
98
0
X
X
 
5349
Extended PBX Homeodomain-DNA complex
706
317
89
0
X
X
 
4248
Lymphoid enhancer-binding factor
733
309
88
0
X
X
 
16936
MBD2 bound to a methylated DNA
530
307
70
0
X
X
 
34291
functional pRN1 primase/DNA Complex
665
303
104
0
X
X
 
19939
MBD4 methyl-cytosine binding domain bound to methylated DNA
474
291
75
0
X
X
 
4141
vnd/NK-2 homeodomain DNA complex
840
291
100
18
X
X
 
25888
F1F2-DNA complex
576
272
200
0
X
X
 
7097
brinker CG9653-PA/DNA Complex
536
255
75
0
X
X
 
4165
Tn916 integrase DNA complex
603
231
80
0
X
X
 
15083
SIGMA-54 RPON DOMAIN-DNA COMPLEX
597
208
61
0
X
X
 
4103
14mer DNA duplex containing the operator sequence BS2
258
188
22
0
 
X
 
5361
TELOMERE REPEAT BINDING FACTOR 1/DNA Complex
599
186
67
0
X
X
 
4104
BS2 operator DNA complexed with the Antennapedia Homeodomain
257
176
23
0
X
X
 
4813
LAC REPRESSOR HP62/DNA COMPLEX
513
169
66
0
X
X
 
34431
KRAS32R G9T
289
167
13
0
 
X
 
25407
DNA complex of the C-Terminal domain of MvaT
492
163
51
0
X
X
 
17729
C-Terminal domain of Ler
599
151
59
0
X
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
27173
KRAS promoter region
203
136
12
0
 
X
 
34157
DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')
281
131
0
22
 
X
 
34159
DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')
274
131
0
22
 
X
 
34158
DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')
237
130
0
22
 
X
 
18524
DNA_OUH
325
130
0
0
 
X
 
34276
Tc-DNA/RNA duplex
228
121
0
0
 
X
X
5791
Lactose operon repressor
497
117
69
0
X
X
 
15527
Mbp1_14
227
116
0
25
 
X
 
30254
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')
161
115
10
22
 
X
 
30255
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')
160
115
10
20
 
X
 
30253
DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')
155
113
10
22
 
X
 
4753
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC
135
96
0
7
 
X
 
4362
chromomycin-DNA complex
160
96
0
7
 
X
 
17409
triazole-linked DNA duplex
212
94
0
0
 
X
 
4746
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT
127
80
0
7
 
X
 
4361
chromomycin-DNA complex
152
80
0
7
 
X
 
19957
DNA-MC1
787
78
103
0
X
X
 
5634
SS1
92
75
0
0
 
X
 
5636
SS3
92
75
0
0
 
X
 
5644
SS11
92
75
0
0
 
X
 
5642
SS9
92
75
0
0
 
X
 
5639
SS6
91
74
0
0
 
X
 
5643
SS10
91
74
0
0
 
X
 
5641
SS8
91
74
0
0
 
X
 
5649
SS16
91
74
0
0
 
X
 
5647
SS14
91
74
0
0
 
X
 
5637
SS4
91
74
0
0
 
X
 
5645
SS12
91
74
0
0
 
X
 
5635
SS2
91
74
0
0
 
X
 
5640
SS7
90
73
0
0
 
X
 
5646
SS13
90
73
0
0
 
X
 
5638
SS5
90
73
0
0
 
X
 
5648
SS15
90
73
0
0
 
X
 
34328
DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')
98
72
0
11
 
X
 
17732
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
599
70
80
0
X
X
 
30473
Sp1 transcription factor duplex 5'-d(GGGGCGGGG)
164
70
0
10
 
X
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
34280
Tc-DNA/DNA duplex
234
59
0
0
 
X
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
17887
alpha anomeric lesion
177
56
0
18
 
X
 
18881
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
288
56
41
0
 
X
X
34062
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
197
46
0
0
 
X
 
4734
High mobility group protein of Drosophila complexed to a bulge DNA
417
46
80
0
X
X
 
15898
DNA GAAA tetraloop
72
42
0
7
 
X
 
19805
The dsDNA in intact bacteriophage T7
0
39
14
0
 
X
 
19734
fd bacteriophage
0
39
0
5
X
X
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
5282
5'-D(*GP*CP*GP*AP*AP*GP*C)-3'
68
35
9
6
 
X
 
25915
Photoswitchable G-quadruplex
48
34
0
0
 
X
 
34441
KRAS32R G25T
258
34
12
0
 
X
 
30552
DNA (27-MER)
260
32
0
0
 
X
 
34174
artificial quadruplex with propeller, diagonal, and lateral loop
164
27
0
0
 
X
 
34145
G-quadruplex of Human papillomavirus type 52
221
27
0
0
 
X
 
34063
Artificial quadruplex with propeller, diagonal and lateral loop
158
26
0
0
 
X
 
34445
F1415
129
25
0
0
 
X
 
34390
DNA (25-MER)
139
25
0
0
 
X
 
34210
DNA (5'-D(*GP*GP*GP*AP*TP*GP*GP*GP*AP*CP*AP*CP*AP*GP*(GFL)P*GP*GP*AP*CP*GP*GP*G)-3')
143
24
0
0
 
X
 
34403
F1415
125
22
0
0
 
X
 
34444
F1415
115
20
0
0
 
X
 
15033
cyclic octamer
43
20
0
4
 
X
 
36168
DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3')
236
11
0
24
 
X
 
17422
Cidofovir DNA duplex
162
4
0
0
 
X
 
16226
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
230
0
0
0
 
X
 
18699
DIMERIC PIL-E G-QUADRUPLEX DNA
134
0
0
0
 
X
 
15027
Nar1 Duplex
203
0
0
0
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
16055
5'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'
79
0
0
0
 
X
 
16281
1:1 complex
42
0
0
0
 
X
 
15860
5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'
169
0
0
0
 
X
 
16138
34-MER, SILVER ION
332
0
0
0
 
X
 
18427
2'F-ANA and ANA self-complementary duplex
72
0
0
0
 
X
 
11528
METALLO-BASE-PAIRED DNA
220
0
0
0
 
X
 
11608
DNA CONTAINING METALLO-BASE-PAIR
244
0
0
0
 
X
 
18453
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
11437
Propylene-DNA
213
0
0
0
 
X
 
16287
2:1 complex
54
0
0
0
 
X
 
15223
AB_G_alpha
228
0
0
0
 
X
 
19222
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
0
0
0
88
 
X
 
15026
Nar1IQ3 Duplex
204
0
0
0
 
X
 
18780
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
89
0
0
0
 
X
 
18640
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
11438
Protein
211
0
0
0
 
X
 
15360
DNA 12mer
266
0
0
22
 
X
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
15613
5'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'
138
0
0
0
 
X
 
17709
N-myc
115
0
0
0
 
X
 
17229
ZNF_DNA
147
0
0
0
X
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
19389
stacked dimeric G-quadruplex
134
0
0
0
 
X
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
18638
11_mer_oligonucleotide-B
142
0
0
0
 
X
 
19381
DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
186
0
0
0
 
X
 
16223
5'-D(*DCP*DTP*(FAG)P*DA)-3'
46
0
0
0
 
X
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19571
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex
176
0
0
0
 
X
 
16280
d(GAGCTC)2
35
0
0
0
 
X
 
19592
Molecular Binding of TFF1 Estrogen Response Element
287
0
0
0
 
X
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
19620
DNA duplex containing N3T-ethylene-N1I
116
0
0
0
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
16288
1:2 complex
49
0
0
0
 
X
 
19661
SHB modified duplex
198
0
0
0
 
X
 
19695
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
151
0
0
0
 
X
 
18639
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
16291
2:1 complex
55
0
0
0
 
X
 
16292
2:1 complex
58
0
0
0
 
X
 
16356
5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'
210
0
0
0
 
X
 
18724
G-quadruplex_DNA
183
0
0
0
 
X
 
19375
N2-dG IQ at G3 in NarI sequence
213
0
0
0
 
X
 
19853
AGA modified
161
0
0
0
 
X
 
19861
AGT FAPY Modified duplex
140
0
0
0
 
X
 
19862
AGC FAPY modified duplex Major isomer
133
0
0
0
 
X
 
19863
AG(7-deaza)G FAPY modified duplex
128
0
0
0
 
X
 
19886
CGACGCGTCG
98
0
0
0
 
X
 
16212
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
81
0
0
0
 
X
 
17423
Control DNA duplex
157
0
0
0
 
X
 
19890
CGACTAGTCG dimer
82
0
0
0
 
X
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
18985
DNA_1
182
0
0
20
 
X
 
19017
Bulges in G-quadruplexes
183
0
0
0
 
X
 
19035
G-rich VEGF aptamer with LNA modifications
189
0
0
0
 
X
 
25107
DNA-quercetin
61
0
0
0
 
X
 
25110
left-handed G-quadruplex
267
0
0
0
 
X
 
17746
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
160
0
0
0
 
X
 
15224
AB_G_beta
228
0
0
0
 
X
 
15227
duplex DNA containing an abasic site with opposite T (alpha anomer)
225
0
0
0
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
17791
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
141
0
0
0
 
X
 
17814
DNA Containing an Aristolactam II-dA Lesion
82
0
0
0
 
X
 
17859
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
155
0
0
0
 
X
 
19386
parallel-stranded G-quadruplex in DNA poly-G stretches
164
0
0
0
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
17980
G-quadruplexes
159
0
0
0
 
X
 
18040
DNA_1
202
0
0
20
 
X
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
25903
Glucose in a DNA double helix
212
0
0
0
 
X
 
25906
Glucose as a nuclease mimic in DNA
235
0
0
0
 
X
 
19572
quadruplex d(TGGGTTTGGGTTGGGTTTGGG)
180
0
0
0
 
X
 
27053
KRAS oncogene promoter region
218
0
0
0
 
X
 
27144
c-Myc Pu22
207
0
0
0
 
X
 
18454
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
27652
NZ118 tetramer
111
0
0
0
 
X
 
19659
RHB Modified duplex
201
0
0
0
 
X
 
27829
d(CGATATCG)2 : C-1305 complex
109
0
0
0
 
X
 
27958
spin labled DNA duplex
189
0
0
0
 
X
 
30012
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')
218
0
0
0
 
X
 
30015
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')
190
0
0
0
 
X
 
30016
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')
187
0
0
0
 
X
 
18690
MOMERIC PIL-E G-QUADRUPLEX DNA
188
0
0
0
 
X
 
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
16834
5'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'
137
0
0
0
 
X
 
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
30055
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3')
193
0
0
0
 
X
 
30056
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')
161
0
0
0
 
X
 
18050
DNA_1
179
0
0
9
 
X
 
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
18907
Duplex DNA
225
0
0
0
 
X
 
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
25099
Hs2 dimer
100
0
0
0
 
X
 
30148
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30151
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30191
DNA Dodecamer with 5-methylcytosine
164
0
0
0
 
X
 
30198
DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')
144
0
0
0
 
X
 
30250
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
144
0
0
0
 
X
 
30251
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
15228
duplex DNA containing an abasic site with opposite T (beta anomer)
225
0
0
0
 
X
 
15238
Ab_C_alpha
205
0
0
0
 
X
 
15239
Ab_C_beta
204
0
0
0
 
X
 
30328
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
30329
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
148
0
0
0
 
X
 
30335
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
131
0
0
0
 
X
 
30336
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
140
0
0
0
 
X
 
30402
DNA (26-MER)
267
0
0
0
 
X
 
16054
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
83
0
0
0
 
X
 
30484
Sp1 transcription factor duplex 5'-d(GGGGCGGGA)
138
0
0
0
 
X
 
30485
Sp1 transcription factor duplex 5'-d(TGGGCGGGG)
133
0
0
0
 
X
 
30506
Sp1 transcription factor duplex 5'-d(TGGGCGGGA)
139
0
0
0
 
X
 
16222
5'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'
220
0
0
0
 
X
 
30577
DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')
253
0
0
0
 
X
 
30688
DNA (5'-D(*(3D1)P*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*GP*CP*GP*GP*GP*AP*CP*A)-3')
178
0
0
0
 
X
 
34025
DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')
138
0
0
0
 
X
 
34034
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')
182
0
0
0
 
X
 
34035
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3')
172
0
0
0
 
X
 
34051
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
137
0
0
0
 
X
 
34053
DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')
109
0
0
0
 
X
 
34054
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
103
0
0
0
 
X
 
34056
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*IP*AP*GP*GP*G)-3')
79
0
0
0
 
X
 
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
16290
1:1 complex
50
0
0
0
 
X
 
34071
DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')
146
0
0
0
 
X
 
34083
UpsB-Q-1, DNA (34-MER)
301
0
0
0
 
X
 
34084
UpsB-Q-1 DNA (34-MER)
305
0
0
0
 
X
 
30045
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')
210
0
0
0
 
X
 
34118
DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')
75
0
0
0
 
X
 
34135
DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')
182
0
0
0
 
X
 
34136
DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')
184
0
0
0
 
X
 
34137
DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')
184
0
0
0
 
X
 
17379
5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE
209
0
0
0
 
X
 
17397
RET_oncogene
209
0
0
0
 
X
 
19888
CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN
82
0
0
0
 
X
 
19889
CGACTAGTCG with AIK-18/51-1
96
0
0
0
 
X
 
34162
DNA (5'-D(*TP*(DCP)P*GP*TP*TP*CP*(DCP)P*GP*TP*TP*TP*TP*TP*CP*GP*TP*TP*CP*CP*GP*T)-3')
116
0
0
0
 
X
 
34168
DNA (5'-D(*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*(BGM)P*G)-3')
176
0
0
0
 
X
 
17562
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
150
0
0
0
 
X
 
17580
Myc G-quadruplex
161
0
0
0
 
X
 
17655
Human Telomeric DNA
189
0
0
0
 
X
 
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
34221
DNA (27-MER)
233
0
0
0
 
X
 
34244
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_major
292
0
0
0
 
X
 
34245
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')_minor
150
0
0
0
 
X
 
34269
DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3')
193
0
0
0
 
X
 
17786
(5'S)-8,5'-cyclo-2'-deoxyguanosine
167
0
0
0
 
X
 
17787
(5'S)-8,5'-cyclo-2'-deoxyguanosine
164
0
0
0
 
X
 
17788
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
187
0
0
0
X
X
 
17789
(5'S)-8,5'-cyclo-2'-deoxyadenosine
171
0
0
0
 
X
 
17790
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
152
0
0
0
 
X
 
34296
DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')
250
0
0
0
 
X
 
34297
DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3')
156
0
0
0
 
X
 
34302
DNA (28-MER)
229
0
0
0
 
X
 
17885
DNA_dodecamer
73
0
0
0
 
X
 
34331
hTel-oxoG10
165
0
0
0
 
X
 
34332
hTel-oxoG21
157
0
0
0
 
X
 
34353
TINA-conjugated antiparallel DNA triplex
178
0
0
0
 
X
 
34378
Kiteplatinated DNA oligomer
200
0
0
0
 
X
 
18199
DNA_1
48
0
0
0
 
X
 
18209
DNA_molecule_G3ATG3ACACAG4ACG3
153
0
0
0
 
X
 
34397
DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')
271
0
0
0
 
X
 
34398
DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3')
304
0
0
0
 
X
 
18430
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
149
0
0
0
 
X
 
18452
Synthetic cyclic oligonucleotide
116
0
0
0
X
X
 
34435
VK2
235
0
0
0
 
X
 
34436
GCn
115
0
0
11
 
X
 
34438
GCnCG
132
0
0
13
 
X
 
27828
d(CGATATCG)2 : free form
50
0
0
0
 
X
 
18625
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
200
0
0
0
 
X
 
18626
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
198
0
0
0
 
X
 
34467
human telomeric G-quadruplexes
50
0
0
0
 
X
 
36020
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
82
0
0
0
 
X
 
36022
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
90
0
0
0
 
X
 
36116
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')
175
0
0
0
 
X
 
36159
G-quadruplex DNA (26-MER)
260
0
0
0
 
X
 
36160
G-quadruplex DNA (26-MER)
388
0
0
0
 
X
 
18762
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
154
0
0
0
 
X
 
36174
DNA (5'-D(*CP*GP*CP*GP*AP*AP*AP*TP*TP*TP*CP*GP*CP*G)-3')
258
0
0
0
 
X
 
18781
DNA
88
0
0
0
 
X
 
18835
dodecamer duplex
109
0
0
0
 
X
 
18862
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
111
0
0
0
 
X
 
30058
DNA (25-MER)
256
0
0
0
 
X
 
18902
major G-quadruplex
202
0
0
0
 
X
 
4170
DNA-duplex-6GP
131
0
0
0
 
X
 
4172
Rev-erb beta response element
268
0
0
28
 
X
 
4176
DNA dodecamer
123
0
0
0
 
X
 
4187
Sigma-K RNA Polymerase Promoter Consensus Sequence
204
0
0
0
 
X
 
4235
DNA decamer
82
0
0
9
 
X
 
4240
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
109
0
0
0
 
X
 
4243
DNA (5'-D(TCCCGTTTCCA)-3')
84
0
0
10
 
X
 
4244
alphaT decamer duplex
94
0
0
9
 
X
 
4247
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
145
0
0
0
 
X
X
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
4258
MCB12T
94
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
4372
apt
117
0
0
0
 
X
 
4392
DNA minor groove binder
94
0
0
0
 
X
 
4400
H-y5 Triple Helix
247
0
0
0
 
X
 
4409
DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')
163
0
0
0
 
X
 
4412
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
169
0
0
0
 
X
 
4415
DNA dodecamer duplex
193
0
0
22
 
X
 
4416
Cis-syn thymine cyclobutane dimer
193
0
0
22
 
X
 
4488
DNA decamer
165
0
0
0
 
X
 
4536
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'
197
0
0
0
 
X
 
4542
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'
206
0
0
0
 
X
 
4547
DNA/RNA
168
0
0
16
 
X
X
4550
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
83
0
0
0
 
X
 
4555
SRY-14mer duplex
243
0
0
26
 
X
 
4556
SRY-8mer duplex
137
0
0
14
 
X
 
4576
a3T3 hybrid
104
0
0
0
 
X
 
4609
T-tetrad telomere repeats
59
0
0
0
 
X
 
4618
DNA
104
0
0
0
 
X
 
4646
DNA
144
0
0
17
 
X
 
4647
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
208
0
0
0
 
X
 
4687
cyclic oligonucleotide d
80
0
0
0
 
X
 
4692
TELOMERE FRAGMENT
239
0
0
21
 
X
 
4694
cyclic oligonucleotide d
76
0
0
0
 
X
 
4733
bulge DNA 12/14mer
203
0
0
0
 
X
 
19696
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
154
0
0
0
 
X
 
19728
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
112
0
0
0
 
X
 
4749
DNA THREE-WAY JUNCTION
282
0
0
0
 
X
 
19745
DNA (28-MER)
212
0
0
0
 
X
 
34086
DNA (26-MER)
274
0
0
0
 
X
 
4835
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
82
0
0
0
 
X
 
50109
d(GTATGGCCATAC)2 DNA duplex
83
0
0
0
 
X
 
50278
dsDNA
159
0
0
0
 
X
 
5134
dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'
248
0
0
27
 
X
 
5135
dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'
241
0
0
26
 
X
 
5164
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
232
0
0
0
 
X
 
5167
AT-Rich DNA with the GAA-Hairpin Loop
252
0
0
0
 
X
 
5243
5'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'
363
0
0
0
 
X
 
5245
5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'
109
0
0
13
 
X
 
19912
DNA duplex
142
0
0
0
 
X
 
19917
DNA dodecamer containing the 5-hydroxycytosine
70
0
0
0
 
X
 
19925
DNA dodecamer with A:C mismatch
72
0
0
0
 
X
 
34186
cmbr-481317
158
0
0
0
 
X
 
17708
N-myc
130
0
0
0
 
X
 
5370
beta alanine linked polyamide bound to purine tract DNA
272
0
0
0
 
X
 
5385
8oxoG:G mismatch
116
0
0
0
 
X
 
5562
CCGCGG
49
0
0
0
 
X
 
25369
DNA Dodecamer with 8-oxoguanine at 10th Position
160
0
0
0
 
X
 
25378
A G-quadruplex structure
232
0
0
0
 
X
 
34277
tc-DNA/tc-DNA duplex
190
0
0
0
 
X
 
25528
DNA Dodecamer with 8-oxoguanine at 4th Position
162
0
0
0
 
X
 
25531
N2-dG IQ at G1 in NarI sequence
156
0
0
0
 
X
 
25596
G-quadruplex
166
0
0
0
 
X
 
25651
active G-quadruplex motif from AGRO100
247
0
0
0
 
X
 
25672
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
184
0
0
0
 
X
 
25686
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
209
0
0
0
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
25746
DNA G-quadruplex
114
0
0
0
 
X
 
25759
Quercetin complexed with c-myc G-quadruplex DNA
57
0
0
0
 
X
 
25840
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
51
0
0
0
 
X
 
34389
DNA (25-MER)
136
0
0
0
 
X
 
25890
DNA free
340
0
0
0
 
X
 
5671
5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'
0
0
0
22
 
X
 
5681
CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)
91
0
0
8
 
X
 
5714
Synthetic DNA duplex with an AG mismatch
219
0
0
0
 
X
 
5716
CK14 DNA 14-MER DUPLEX
200
0
0
0
 
X
 
5717
XBY6 DNA 14-MER DUPLEX
100
0
0
0
 
X
 
5718
XBY2 DNA 14-MER DUPLEX
198
0
0
0
 
X
 
5730
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
234
0
0
0
 
X
 
5737
5'-D(*TP*TP*AP*GP*GP*GP*T)-3'
63
0
0
0
 
X
 
5739
5'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'
203
0
0
0
 
X
 
5775
5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'
147
0
0
0
 
X
X
5776
sPrODN1:RNA
152
0
0
0
 
X
X
5777
PODN:RNA
157
0
0
0
 
X
X
5781
Propynyl_DNA.RNA_hybrid
175
0
0
0
 
X
X
30038
DNA
162
0
0
14
 
X
 
5927
5'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'
197
0
0
0
 
X
 
5979
DNA
229
0
0
0
 
X
 
5993
DNA duplex
118
0
0
0
 
X
 
6009
Thrombin-binding DNA aptamer
162
0
0
14
 
X
 
6273
GTTCACAGAAC DNA hairpin
101
0
0
10
 
X
 
6274
GTACACAGTAC DNA hairpin
101
0
0
0
 
X
 
6430
HIV-1 integrase inhibitor, 93del
148
0
0
15
 
X
 
6537
5'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2
208
0
0
0
 
X
 
6975
Bcl2MidG4Pu23-G15T/G16T
199
0
0
0
 
X
 
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
7392
CTC[IQ]GGCGCCATC
173
0
0
0
 
X
 

  Back to the initial grid   Top of this page