data_6042 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 6042 _Entry.Title ; NMR structure of the 30mer stemloop-D of coxsackieviral RNA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2003-12-11 _Entry.Accession_date 2003-12-11 _Entry.Last_release_date 2004-11-30 _Entry.Original_release_date 2004-11-30 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 2.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 O. Ohlenschlager . . . 6042 2 J. Wohnert . . . 6042 3 E. Bucci . . . 6042 4 S. Seitz . . . 6042 5 S. Hafner . . . 6042 6 R. Ramachandran . . . 6042 7 R. Zell . . . 6042 8 M. Gorlach . . . 6042 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID coupling_constants 1 6042 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID 'coupling constants' 14 6042 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2004-11-30 2003-12-11 original author . 6042 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1RFR 'BMRB Entry Tracking System' 6042 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 6042 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 14962384 _Citation.Full_citation . _Citation.Title ; The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA and its Interaction with the Proteinase 3C ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Stucture _Citation.Journal_name_full . _Citation.Journal_volume 12 _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 237 _Citation.Page_last 248 _Citation.Year 2004 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 O. Ohlenschlager . . . 6042 1 2 J. Wohnert . . . 6042 1 3 E. Bucci . . . 6042 1 4 S. Seitz . . . 6042 1 5 S. Hafner . . . 6042 1 6 R. Ramachandran . . . 6042 1 7 R. Zell . . . 6042 1 8 M. Gorlach . . . 6042 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID 'A-form helix stems' 6042 1 'base-paired U:U-C:U-U:U mismatch' 6042 1 'loop with conformation similar to stable UNCG-tetraloops and U:G closing base pair' 6042 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_system_SLD-RNA _Assembly.Sf_category assembly _Assembly.Sf_framecode system_SLD-RNA _Assembly.Entry_ID 6042 _Assembly.ID 1 _Assembly.Name '30mer stemloop-D of coxsackieviral RNA' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Assembly_type.Type _Assembly_type.Entry_ID _Assembly_type.Assembly_ID monomer 6042 1 stop_ loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 SLD-RNA 1 $SLD-RNA . . . native . . . . . 6042 1 stop_ loop_ _Assembly_db_link.Author_supplied _Assembly_db_link.Database_code _Assembly_db_link.Accession_code _Assembly_db_link.Entry_mol_code _Assembly_db_link.Entry_mol_name _Assembly_db_link.Entry_experimental_method _Assembly_db_link.Entry_structure_resolution _Assembly_db_link.Entry_relation_type _Assembly_db_link.Entry_details _Assembly_db_link.Entry_ID _Assembly_db_link.Assembly_ID . PDB 1RFR . . . . . . 6042 1 stop_ loop_ _Assembly_common_name.Name _Assembly_common_name.Type _Assembly_common_name.Entry_ID _Assembly_common_name.Assembly_ID '30mer stemloop-D of coxsackieviral RNA' system 6042 1 SLD-RNA abbreviation 6042 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_SLD-RNA _Entity.Sf_category entity _Entity.Sf_framecode SLD-RNA _Entity.Entry_ID 6042 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name SLD-RNA _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCACUCUGGUAUCACGGUA CCUUUGUGUC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 30 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic . _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID SLD-RNA abbreviation 6042 1 SLD-RNA common 6042 1 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 6042 1 2 . G . 6042 1 3 . C . 6042 1 4 . A . 6042 1 5 . C . 6042 1 6 . U . 6042 1 7 . C . 6042 1 8 . U . 6042 1 9 . G . 6042 1 10 . G . 6042 1 11 . U . 6042 1 12 . A . 6042 1 13 . U . 6042 1 14 . C . 6042 1 15 . A . 6042 1 16 . C . 6042 1 17 . G . 6042 1 18 . G . 6042 1 19 . U . 6042 1 20 . A . 6042 1 21 . C . 6042 1 22 . C . 6042 1 23 . U . 6042 1 24 . U . 6042 1 25 . U . 6042 1 26 . G . 6042 1 27 . U . 6042 1 28 . G . 6042 1 29 . U . 6042 1 30 . C . 6042 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 6042 1 . G 2 2 6042 1 . C 3 3 6042 1 . A 4 4 6042 1 . C 5 5 6042 1 . U 6 6 6042 1 . C 7 7 6042 1 . U 8 8 6042 1 . G 9 9 6042 1 . G 10 10 6042 1 . U 11 11 6042 1 . A 12 12 6042 1 . U 13 13 6042 1 . C 14 14 6042 1 . A 15 15 6042 1 . C 16 16 6042 1 . G 17 17 6042 1 . G 18 18 6042 1 . U 19 19 6042 1 . A 20 20 6042 1 . C 21 21 6042 1 . C 22 22 6042 1 . U 23 23 6042 1 . U 24 24 6042 1 . U 25 25 6042 1 . G 26 26 6042 1 . U 27 27 6042 1 . G 28 28 6042 1 . U 29 29 6042 1 . C 30 30 6042 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 6042 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $SLD-RNA . 12072 organism . 'Enterovirus Human enterovirus B' 'COXSACKIEVIRUS B3' . . Viruses . Enterovirus 'Human enterovirus B' . . . . . . . . . . . . . . . . . . . . . 6042 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 6042 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $SLD-RNA . 'recombinant technology' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6042 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 6042 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]' . . 1 $SLD-RNA . . 0.9 . . mM . . . . 6042 1 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 1 3 KCl . . . . . . . 40 . . mM . . . . 6042 1 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 1 5 H2O . . . . . . . 95 . . % . . . . 6042 1 6 D2O . . . . . . . 5 . . % . . . . 6042 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 6042 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]' . . 1 $SLD-RNA . . 0.9 . . mM . . . . 6042 2 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 2 3 KCl . . . . . . . 40 . . mM . . . . 6042 2 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 2 5 D2O . . . . . . . 99.99 . . % . . . . 6042 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 6042 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]-G, C' . . 1 $SLD-RNA . . 1.2 . . mM . . . . 6042 3 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 3 3 KCl . . . . . . . 40 . . mM . . . . 6042 3 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 3 5 H2O . . . . . . . 95 . . % . . . . 6042 3 6 D2O . . . . . . . 5 . . % . . . . 6042 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 6042 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]-G, C' . . 1 $SLD-RNA . . 1.2 . . mM . . . . 6042 4 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 4 3 KCl . . . . . . . 40 . . mM . . . . 6042 4 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 4 5 D2O . . . . . . . 99.99 . . % . . . . 6042 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 6042 _Sample.ID 5 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]-A, U' . . 1 $SLD-RNA . . 1.2 . . mM . . . . 6042 5 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 5 3 KCl . . . . . . . 40 . . mM . . . . 6042 5 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 5 5 H2O . . . . . . . 95 . . % . . . . 6042 5 6 D2O . . . . . . . 5 . . % . . . . 6042 5 stop_ save_ save_sample_6 _Sample.Sf_category sample _Sample.Sf_framecode sample_6 _Sample.Entry_ID 6042 _Sample.ID 6 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA '[U-13C; U-15N]-A, U' . . 1 $SLD-RNA . . 1.2 . . mM . . . . 6042 6 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 6 3 KCl . . . . . . . 40 . . mM . . . . 6042 6 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 6 5 D2O . . . . . . . 99.99 . . % . . . . 6042 6 stop_ save_ save_sample_7 _Sample.Sf_category sample _Sample.Sf_framecode sample_7 _Sample.Entry_ID 6042 _Sample.ID 7 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA [U-15N] . . 1 $SLD-RNA . . 1.4 . . mM . . . . 6042 7 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 7 3 KCl . . . . . . . 40 . . mM . . . . 6042 7 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 7 5 H2O . . . . . . . 95 . . % . . . . 6042 7 6 D2O . . . . . . . 5 . . % . . . . 6042 7 stop_ save_ save_sample_8 _Sample.Sf_category sample _Sample.Sf_framecode sample_8 _Sample.Entry_ID 6042 _Sample.ID 8 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 SLD-RNA [U-15N] . . 1 $SLD-RNA . . 1.2 . . mM . . . . 6042 8 2 KH2PO4/K2HPO4 . . . . . . . 10 . . mM . . . . 6042 8 3 KCl . . . . . . . 40 . . mM . . . . 6042 8 4 EDTA . . . . . . . 0.2 . . mM . . . . 6042 8 5 D2O . . . . . . . 99.99 . . % . . . . 6042 8 stop_ save_ ####################### # Sample conditions # ####################### save_sample_cond_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_1 _Sample_condition_list.Entry_ID 6042 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 6042 1 pH 6.2 . n/a 6042 1 pressure 1 . atm 6042 1 temperature 298 . K 6042 1 stop_ save_ save_sample_cond_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_2 _Sample_condition_list.Entry_ID 6042 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 6042 2 pH 6.2 . n/a 6042 2 pressure 1 . atm 6042 2 temperature 283 . K 6042 2 stop_ save_ ############################ # Computer software used # ############################ save_VNMR _Software.Sf_category software _Software.Sf_framecode VNMR _Software.Entry_ID 6042 _Software.ID 1 _Software.Name VNMR _Software.Version '6.1, rev. c' _Software.Details 'Varian Inc.' loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 6042 1 processing 6042 1 stop_ save_ save_XEASY _Software.Sf_category software _Software.Sf_framecode XEASY _Software.Entry_ID 6042 _Software.ID 2 _Software.Name XEASY _Software.Version 1.3.9 _Software.Details Bartels loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 6042 2 stop_ save_ save_FOUND _Software.Sf_category software _Software.Sf_framecode FOUND _Software.Entry_ID 6042 _Software.ID 3 _Software.Name FOUND _Software.Version 'implemented in CYANA-1.0.6' _Software.Details Guntert loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 6042 3 stop_ save_ save_CYANA _Software.Sf_category software _Software.Sf_framecode CYANA _Software.Entry_ID 6042 _Software.ID 4 _Software.Name CYANA _Software.Version 1.0.6 _Software.Details Herrmann loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 6042 4 stop_ save_ save_OPAL _Software.Sf_category software _Software.Sf_framecode OPAL _Software.Entry_ID 6042 _Software.ID 5 _Software.Name OPAL _Software.Version 2.6 _Software.Details Luginbuhl loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 6042 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 6042 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Varian _NMR_spectrometer.Model INOVA _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 750 save_ save_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode spectrometer_list _NMR_spectrometer_list.Entry_ID 6042 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Varian INOVA . 750 . . . 6042 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 6042 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 . . . . . . . . . . . . . . . . . . . . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 6042 1 stop_ save_