data_25571 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 25571 _Entry.Title ; HIV-1 Core Packaging Signal ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2015-04-15 _Entry.Accession_date 2015-04-15 _Entry.Last_release_date 2015-05-26 _Entry.Original_release_date 2015-05-26 _Entry.Origination author _Entry.NMR_STAR_version 3.1.2.6 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Sarah Keane . C. . . 25571 2 Michael Summers . F. . . 25571 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 25571 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID HIV-1 . 25571 'Packaging Signal' . 25571 RNA . 25571 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 25571 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 695 25571 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2017-03-22 2015-04-15 update BMRB 'update entry citation' 25571 1 . . 2015-05-26 2015-04-15 original author 'original release' 25571 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2N1Q 'BMRB Entry Tracking System' 25571 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 25571 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 25999508 _Citation.Full_citation . _Citation.Title ; RNA structure. Structure of the HIV-1 RNA packaging signal ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Science _Citation.Journal_name_full . _Citation.Journal_volume 348 _Citation.Journal_issue 6237 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 917 _Citation.Page_last 921 _Citation.Year 2015 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Sarah Keane . C. . . 25571 1 2 Xiao Heng . . . . 25571 1 3 Kun Lu . . . . 25571 1 4 Siarhei Kharytonchyk . . . . 25571 1 5 Venkateswaran Ramakrishnan . . . . 25571 1 6 Gregory Carter . . . . 25571 1 7 Shawn Barton . . . . 25571 1 8 Azra Hosic . . . . 25571 1 9 Alyssa Florwick . . . . 25571 1 10 Justin Santos . . . . 25571 1 11 Nicholas Bolden . C. . . 25571 1 12 Sayo McCowin . . . . 25571 1 13 David Case . A. . . 25571 1 14 Bruce Johnson . . . . 25571 1 15 Marco Salemi . . . . 25571 1 16 Alice Telesnitsky . . . . 25571 1 17 Michael Summers . F. . . 25571 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 25571 _Assembly.ID 1 _Assembly.Name 'HIV-1 Core Packaging Signal' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (155-MER)' 1 $RNA_(155-MER) A . yes native no no . . . 25571 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(155-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(155-MER) _Entity.Entry_ID 25571 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(155-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGUGCCCGUCUGUUGUGUGA CUCUGGUGAGAGCCAGAGGA GAUCUCUCGACGCAGGACUC GGCUUGCUGGAGACGGCAAG AGGCGAGGGGCGGCGACUGG UGAGUACGCCAAAAAUUUUG ACUAGCGGAGGCUAGAAGGA GAGAGAUGGGUGCCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 155 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 50544.359 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 105 G . 25571 1 2 106 G . 25571 1 3 107 U . 25571 1 4 108 G . 25571 1 5 109 C . 25571 1 6 110 C . 25571 1 7 111 C . 25571 1 8 112 G . 25571 1 9 113 U . 25571 1 10 114 C . 25571 1 11 115 U . 25571 1 12 116 G . 25571 1 13 117 U . 25571 1 14 118 U . 25571 1 15 119 G . 25571 1 16 120 U . 25571 1 17 121 G . 25571 1 18 122 U . 25571 1 19 123 G . 25571 1 20 124 A . 25571 1 21 125 C . 25571 1 22 126 U . 25571 1 23 127 C . 25571 1 24 128 U . 25571 1 25 129 G . 25571 1 26 130 G . 25571 1 27 131 U . 25571 1 28 132 G . 25571 1 29 133 A . 25571 1 30 134 G . 25571 1 31 135 A . 25571 1 32 217 G . 25571 1 33 218 C . 25571 1 34 219 C . 25571 1 35 220 A . 25571 1 36 221 G . 25571 1 37 222 A . 25571 1 38 223 G . 25571 1 39 224 G . 25571 1 40 225 A . 25571 1 41 226 G . 25571 1 42 227 A . 25571 1 43 228 U . 25571 1 44 229 C . 25571 1 45 230 U . 25571 1 46 231 C . 25571 1 47 232 U . 25571 1 48 233 C . 25571 1 49 234 G . 25571 1 50 235 A . 25571 1 51 236 C . 25571 1 52 237 G . 25571 1 53 238 C . 25571 1 54 239 A . 25571 1 55 240 G . 25571 1 56 241 G . 25571 1 57 242 A . 25571 1 58 243 C . 25571 1 59 244 U . 25571 1 60 245 C . 25571 1 61 246 G . 25571 1 62 247 G . 25571 1 63 248 C . 25571 1 64 249 U . 25571 1 65 250 U . 25571 1 66 251 G . 25571 1 67 252 C . 25571 1 68 253 U . 25571 1 69 254 G . 25571 1 70 260 G . 25571 1 71 261 A . 25571 1 72 262 G . 25571 1 73 263 A . 25571 1 74 264 C . 25571 1 75 265 G . 25571 1 76 266 G . 25571 1 77 267 C . 25571 1 78 268 A . 25571 1 79 269 A . 25571 1 80 270 G . 25571 1 81 271 A . 25571 1 82 272 G . 25571 1 83 273 G . 25571 1 84 274 C . 25571 1 85 275 G . 25571 1 86 276 A . 25571 1 87 277 G . 25571 1 88 278 G . 25571 1 89 279 G . 25571 1 90 280 G . 25571 1 91 281 C . 25571 1 92 282 G . 25571 1 93 283 G . 25571 1 94 284 C . 25571 1 95 285 G . 25571 1 96 286 A . 25571 1 97 287 C . 25571 1 98 288 U . 25571 1 99 289 G . 25571 1 100 290 G . 25571 1 101 291 U . 25571 1 102 292 G . 25571 1 103 293 A . 25571 1 104 294 G . 25571 1 105 295 U . 25571 1 106 296 A . 25571 1 107 297 C . 25571 1 108 298 G . 25571 1 109 299 C . 25571 1 110 300 C . 25571 1 111 301 A . 25571 1 112 302 A . 25571 1 113 303 A . 25571 1 114 304 A . 25571 1 115 305 A . 25571 1 116 306 U . 25571 1 117 307 U . 25571 1 118 308 U . 25571 1 119 309 U . 25571 1 120 310 G . 25571 1 121 311 A . 25571 1 122 312 C . 25571 1 123 313 U . 25571 1 124 314 A . 25571 1 125 315 G . 25571 1 126 316 C . 25571 1 127 317 G . 25571 1 128 318 G . 25571 1 129 319 A . 25571 1 130 320 G . 25571 1 131 321 G . 25571 1 132 322 C . 25571 1 133 323 U . 25571 1 134 324 A . 25571 1 135 325 G . 25571 1 136 326 A . 25571 1 137 327 A . 25571 1 138 328 G . 25571 1 139 329 G . 25571 1 140 330 A . 25571 1 141 331 G . 25571 1 142 332 A . 25571 1 143 333 G . 25571 1 144 334 A . 25571 1 145 335 G . 25571 1 146 336 A . 25571 1 147 337 U . 25571 1 148 338 G . 25571 1 149 339 G . 25571 1 150 340 G . 25571 1 151 341 U . 25571 1 152 342 G . 25571 1 153 343 C . 25571 1 154 344 C . 25571 1 155 345 C . 25571 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 25571 1 . G 2 2 25571 1 . U 3 3 25571 1 . G 4 4 25571 1 . C 5 5 25571 1 . C 6 6 25571 1 . C 7 7 25571 1 . G 8 8 25571 1 . U 9 9 25571 1 . C 10 10 25571 1 . U 11 11 25571 1 . G 12 12 25571 1 . U 13 13 25571 1 . U 14 14 25571 1 . G 15 15 25571 1 . U 16 16 25571 1 . G 17 17 25571 1 . U 18 18 25571 1 . G 19 19 25571 1 . A 20 20 25571 1 . C 21 21 25571 1 . U 22 22 25571 1 . C 23 23 25571 1 . U 24 24 25571 1 . G 25 25 25571 1 . G 26 26 25571 1 . U 27 27 25571 1 . G 28 28 25571 1 . A 29 29 25571 1 . G 30 30 25571 1 . A 31 31 25571 1 . G 32 32 25571 1 . C 33 33 25571 1 . C 34 34 25571 1 . A 35 35 25571 1 . G 36 36 25571 1 . A 37 37 25571 1 . G 38 38 25571 1 . G 39 39 25571 1 . A 40 40 25571 1 . G 41 41 25571 1 . A 42 42 25571 1 . U 43 43 25571 1 . C 44 44 25571 1 . U 45 45 25571 1 . C 46 46 25571 1 . U 47 47 25571 1 . C 48 48 25571 1 . G 49 49 25571 1 . A 50 50 25571 1 . C 51 51 25571 1 . G 52 52 25571 1 . C 53 53 25571 1 . A 54 54 25571 1 . G 55 55 25571 1 . G 56 56 25571 1 . A 57 57 25571 1 . C 58 58 25571 1 . U 59 59 25571 1 . C 60 60 25571 1 . G 61 61 25571 1 . G 62 62 25571 1 . C 63 63 25571 1 . U 64 64 25571 1 . U 65 65 25571 1 . G 66 66 25571 1 . C 67 67 25571 1 . U 68 68 25571 1 . G 69 69 25571 1 . G 70 70 25571 1 . A 71 71 25571 1 . G 72 72 25571 1 . A 73 73 25571 1 . C 74 74 25571 1 . G 75 75 25571 1 . G 76 76 25571 1 . C 77 77 25571 1 . A 78 78 25571 1 . A 79 79 25571 1 . G 80 80 25571 1 . A 81 81 25571 1 . G 82 82 25571 1 . G 83 83 25571 1 . C 84 84 25571 1 . G 85 85 25571 1 . A 86 86 25571 1 . G 87 87 25571 1 . G 88 88 25571 1 . G 89 89 25571 1 . G 90 90 25571 1 . C 91 91 25571 1 . G 92 92 25571 1 . G 93 93 25571 1 . C 94 94 25571 1 . G 95 95 25571 1 . A 96 96 25571 1 . C 97 97 25571 1 . U 98 98 25571 1 . G 99 99 25571 1 . G 100 100 25571 1 . U 101 101 25571 1 . G 102 102 25571 1 . A 103 103 25571 1 . G 104 104 25571 1 . U 105 105 25571 1 . A 106 106 25571 1 . C 107 107 25571 1 . G 108 108 25571 1 . C 109 109 25571 1 . C 110 110 25571 1 . A 111 111 25571 1 . A 112 112 25571 1 . A 113 113 25571 1 . A 114 114 25571 1 . A 115 115 25571 1 . U 116 116 25571 1 . U 117 117 25571 1 . U 118 118 25571 1 . U 119 119 25571 1 . G 120 120 25571 1 . A 121 121 25571 1 . C 122 122 25571 1 . U 123 123 25571 1 . A 124 124 25571 1 . G 125 125 25571 1 . C 126 126 25571 1 . G 127 127 25571 1 . G 128 128 25571 1 . A 129 129 25571 1 . G 130 130 25571 1 . G 131 131 25571 1 . C 132 132 25571 1 . U 133 133 25571 1 . A 134 134 25571 1 . G 135 135 25571 1 . A 136 136 25571 1 . A 137 137 25571 1 . G 138 138 25571 1 . G 139 139 25571 1 . A 140 140 25571 1 . G 141 141 25571 1 . A 142 142 25571 1 . G 143 143 25571 1 . A 144 144 25571 1 . G 145 145 25571 1 . A 146 146 25571 1 . U 147 147 25571 1 . G 148 148 25571 1 . G 149 149 25571 1 . G 150 150 25571 1 . U 151 151 25571 1 . G 152 152 25571 1 . C 153 153 25571 1 . C 154 154 25571 1 . C 155 155 25571 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 25571 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(155-MER) . 12721 organism . 'Human immunodeficiency virus' 'AIDS virus' . . Viruses . Lentivirus 'Human immunodeficiency virus' NL4-3 . . . . . . . . . . . . 25571 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 25571 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(155-MER) . 'enzymatic semisynthesis' HIV . . . . . . . . . . . pUC19 . . . 25571 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_ACGU _Sample.Sf_category sample _Sample.Sf_framecode ACGU _Sample.Entry_ID 25571 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'natural abundance' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 1 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 1 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 1 stop_ save_ save_A _Sample.Sf_category sample _Sample.Sf_framecode A _Sample.Entry_ID 25571 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-H, C-D, G-D, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 2 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 2 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 2 stop_ save_ save_G _Sample.Sf_category sample _Sample.Sf_framecode G _Sample.Entry_ID 25571 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-D, C-D, G-H, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 3 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 3 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 3 stop_ save_ save_C _Sample.Sf_category sample _Sample.Sf_framecode C _Sample.Entry_ID 25571 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-D, C-H, G-D, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 4 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 4 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 4 stop_ save_ save_U6r _Sample.Sf_category sample _Sample.Sf_framecode U6r _Sample.Entry_ID 25571 _Sample.ID 5 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-D, C-D, G-D, U-5D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 5 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 5 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 5 stop_ save_ save_A2rGr _Sample.Sf_category sample _Sample.Sf_framecode A2rGr _Sample.Entry_ID 25571 _Sample.ID 6 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-D, G-8D, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 6 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 6 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 6 stop_ save_ save_A2rCr _Sample.Sf_category sample _Sample.Sf_framecode A2rCr _Sample.Entry_ID 25571 _Sample.ID 7 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-5,6-D2, G-D, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 7 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 7 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 7 stop_ save_ save_A2rUr _Sample.Sf_category sample _Sample.Sf_framecode A2rUr _Sample.Entry_ID 25571 _Sample.ID 8 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-D, G-D, U-5,6-D2' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 8 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 8 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 8 stop_ save_ save_A2rGrCr _Sample.Sf_category sample _Sample.Sf_framecode A2rGrCr _Sample.Entry_ID 25571 _Sample.ID 9 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-5,6-D2, G-8D, U-D' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 9 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 9 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 9 stop_ save_ save_A2rGrUr _Sample.Sf_category sample _Sample.Sf_framecode A2rGrUr _Sample.Entry_ID 25571 _Sample.ID 10 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-D, G-8D, U-5,6-D2' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 10 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 10 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 10 stop_ save_ save_A2rCrUr _Sample.Sf_category sample _Sample.Sf_framecode A2rCrUr _Sample.Entry_ID 25571 _Sample.ID 11 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-8D, C-5,6-D2, G-D, U-5,6-D2' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 11 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 11 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 11 stop_ save_ save_A2Ur _Sample.Sf_category sample _Sample.Sf_framecode A2Ur _Sample.Entry_ID 25571 _Sample.ID 12 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-8,1',2',3',4',5',5 -D7, C-D, G-D, U-5,6-D2" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 12 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 12 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 12 stop_ save_ save_A2GrUr _Sample.Sf_category sample _Sample.Sf_framecode A2GrUr _Sample.Entry_ID 25571 _Sample.ID 13 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-8,1',2',3',4',5',5 -D7, C-D, G-8D, U-5,6-D2" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 13 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 13 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 13 stop_ save_ save_AG8 _Sample.Sf_category sample _Sample.Sf_framecode AG8 _Sample.Entry_ID 25571 _Sample.ID 14 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-H, C-D, G-1',2',3',4',5',5''-D6 , U-D" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 14 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 14 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 14 stop_ save_ save_GA8 _Sample.Sf_category sample _Sample.Sf_framecode GA8 _Sample.Entry_ID 25571 _Sample.ID 15 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-2,1',2',3',4',5',5-D7, C-D, G-H, U-D" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 15 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 15 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 15 stop_ save_ save_UA8 _Sample.Sf_category sample _Sample.Sf_framecode UA8 _Sample.Entry_ID 25571 _Sample.ID 16 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-2,1',2',3',4',5',5-D7, C-D, G-D, U-H" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 16 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 16 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 16 stop_ save_ save_GUr _Sample.Sf_category sample _Sample.Sf_framecode GUr _Sample.Entry_ID 25571 _Sample.ID 17 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' 'A-D, C-D, G-H, U-5,6-D2' . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 17 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 17 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 17 stop_ save_ save_G8Ur _Sample.Sf_category sample _Sample.Sf_framecode G8Ur _Sample.Entry_ID 25571 _Sample.ID 18 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-D, C-D, G-1',2',3',4',5',5''-D6 , U-5,6-D2" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 18 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 18 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 18 stop_ save_ save_G8U6r _Sample.Sf_category sample _Sample.Sf_framecode G8U6r _Sample.Entry_ID 25571 _Sample.ID 19 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-D, C-D, G-1',2',3',4',5',5''-D6 , U-5D" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 19 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 19 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 19 stop_ save_ save_G8C6r _Sample.Sf_category sample _Sample.Sf_framecode G8C6r _Sample.Entry_ID 25571 _Sample.ID 20 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (155-MER)' "A-D, C-5D, G-1',2',3',4',5',5''-D6 , U-D" . . 1 $RNA_(155-MER) . . 300 . . mM . . . . 25571 20 2 TRIS [U-2H] . . . . . . 20 . . mM . . . . 25571 20 3 D2O 'natural abundance' . . . . . . 100 . . % . . . . 25571 20 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 25571 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 20 . mM 25571 1 pD 7.5 . pD 25571 1 pressure 1 . atm 25571 1 temperature 308 . K 25571 1 stop_ save_ ############################ # Computer software used # ############################ save_NMRPipe _Software.Sf_category software _Software.Sf_framecode NMRPipe _Software.Entry_ID 25571 _Software.ID 1 _Software.Name NMRPipe _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25571 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 25571 1 stop_ save_ save_NMRDraw _Software.Sf_category software _Software.Sf_framecode NMRDraw _Software.Entry_ID 25571 _Software.ID 2 _Software.Name NMRDraw _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 25571 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 25571 2 stop_ save_ save_NMRView _Software.Sf_category software _Software.Sf_framecode NMRView _Software.Entry_ID 25571 _Software.ID 3 _Software.Name NMRView _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Johnson, One Moon Scientific' . . 25571 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 25571 3 'data analysis' 25571 3 'peak picking' 25571 3 stop_ save_ save_CYANA _Software.Sf_category software _Software.Sf_framecode CYANA _Software.Entry_ID 25571 _Software.ID 4 _Software.Name CYANA _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 25571 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'geometry optimization' 25571 4 'structure solution' 25571 4 stop_ save_ save_AMBER _Software.Sf_category software _Software.Sf_framecode AMBER _Software.Entry_ID 25571 _Software.ID 5 _Software.Name AMBER _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 25571 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 25571 5 'structure solution' 25571 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 25571 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 25571 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 25571 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 800 . . . 25571 1 2 spectrometer_2 Bruker Avance . 600 . . . 25571 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 25571 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $ACGU isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $A isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 3 $G isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . 4 $C isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 5 '2D 1H-1H NOESY' no . . . . . . . . . . 5 $U6r isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 6 '2D 1H-1H NOESY' no . . . . . . . . . . 6 $A2rGr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 7 '2D 1H-1H NOESY' no . . . . . . . . . . 7 $A2rCr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 8 '2D 1H-1H NOESY' no . . . . . . . . . . 8 $A2rUr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 9 '2D 1H-1H NOESY' no . . . . . . . . . . 9 $A2rGrCr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 10 '2D 1H-1H NOESY' no . . . . . . . . . . 10 $A2rGrUr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 11 '2D 1H-1H NOESY' no . . . . . . . . . . 11 $A2rCrUr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 12 '2D 1H-1H NOESY' no . . . . . . . . . . 12 $A2Ur isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 13 '2D 1H-1H NOESY' no . . . . . . . . . . 13 $A2GrUr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 14 '2D 1H-1H NOESY' no . . . . . . . . . . 14 $AG8 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 15 '2D 1H-1H NOESY' no . . . . . . . . . . 15 $GA8 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 16 '2D 1H-1H NOESY' no . . . . . . . . . . 16 $UA8 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 17 '2D 1H-1H NOESY' no . . . . . . . . . . 17 $GUr isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 18 '2D 1H-1H NOESY' no . . . . . . . . . . 18 $G8Ur isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 19 '2D 1H-1H NOESY' no . . . . . . . . . . 19 $G8U6r isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 20 '2D 1H-1H NOESY' no . . . . . . . . . . 20 $G8C6r isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 25571 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 25571 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 water protons . . . . ppm 4.6588 internal direct 1 . . . . . 25571 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 25571 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 25571 1 2 '2D 1H-1H NOESY' . . . 25571 1 3 '2D 1H-1H NOESY' . . . 25571 1 4 '2D 1H-1H NOESY' . . . 25571 1 5 '2D 1H-1H NOESY' . . . 25571 1 6 '2D 1H-1H NOESY' . . . 25571 1 7 '2D 1H-1H NOESY' . . . 25571 1 8 '2D 1H-1H NOESY' . . . 25571 1 9 '2D 1H-1H NOESY' . . . 25571 1 10 '2D 1H-1H NOESY' . . . 25571 1 11 '2D 1H-1H NOESY' . . . 25571 1 12 '2D 1H-1H NOESY' . . . 25571 1 13 '2D 1H-1H NOESY' . . . 25571 1 14 '2D 1H-1H NOESY' . . . 25571 1 15 '2D 1H-1H NOESY' . . . 25571 1 16 '2D 1H-1H NOESY' . . . 25571 1 17 '2D 1H-1H NOESY' . . . 25571 1 18 '2D 1H-1H NOESY' . . . 25571 1 19 '2D 1H-1H NOESY' . . . 25571 1 20 '2D 1H-1H NOESY' . . . 25571 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.8994 . . . . . . A 105 G H1' . 25571 1 2 . 1 1 1 1 G H2' H 1 4.9101 . . . . . . A 105 G H2' . 25571 1 3 . 1 1 1 1 G H3' H 1 4.6744 . . . . . . A 105 G H3' . 25571 1 4 . 1 1 1 1 G H8 H 1 8.1465 . . . . . . A 105 G H8 . 25571 1 5 . 1 1 2 2 G H1' H 1 5.9023 . . . . . . A 106 G H1' . 25571 1 6 . 1 1 2 2 G H2' H 1 4.4743 . . . . . . A 106 G H2' . 25571 1 7 . 1 1 2 2 G H3' H 1 4.5283 . . . . . . A 106 G H3' . 25571 1 8 . 1 1 2 2 G H8 H 1 7.4791 . . . . . . A 106 G H8 . 25571 1 9 . 1 1 3 3 U H1' H 1 5.6473 . . . . . . A 107 U H1' . 25571 1 10 . 1 1 3 3 U H2' H 1 4.4544 . . . . . . A 107 U H2' . 25571 1 11 . 1 1 3 3 U H3' H 1 4.5489 . . . . . . A 107 U H3' . 25571 1 12 . 1 1 3 3 U H5 H 1 5.4928 . . . . . . A 107 U H5 . 25571 1 13 . 1 1 3 3 U H6 H 1 7.6848 . . . . . . A 107 U H6 . 25571 1 14 . 1 1 4 4 G H1' H 1 5.7222 . . . . . . A 108 G H1' . 25571 1 15 . 1 1 4 4 G H2' H 1 4.7147 . . . . . . A 108 G H2' . 25571 1 16 . 1 1 4 4 G H3' H 1 4.3984 . . . . . . A 108 G H3' . 25571 1 17 . 1 1 4 4 G H8 H 1 7.8203 . . . . . . A 108 G H8 . 25571 1 18 . 1 1 5 5 C H1' H 1 5.5039 . . . . . . A 109 C H1' . 25571 1 19 . 1 1 5 5 C H2' H 1 4.3485 . . . . . . A 109 C H2' . 25571 1 20 . 1 1 5 5 C H3' H 1 4.4841 . . . . . . A 109 C H3' . 25571 1 21 . 1 1 5 5 C H5 H 1 5.3502 . . . . . . A 109 C H5 . 25571 1 22 . 1 1 5 5 C H6 H 1 7.7308 . . . . . . A 109 C H6 . 25571 1 23 . 1 1 6 6 C H1' H 1 5.532 . . . . . . A 110 C H1' . 25571 1 24 . 1 1 6 6 C H2' H 1 4.4345 . . . . . . A 110 C H2' . 25571 1 25 . 1 1 6 6 C H3' H 1 4.5104 . . . . . . A 110 C H3' . 25571 1 26 . 1 1 6 6 C H5 H 1 5.4976 . . . . . . A 110 C H5 . 25571 1 27 . 1 1 6 6 C H6 H 1 7.8208 . . . . . . A 110 C H6 . 25571 1 28 . 1 1 7 7 C H1' H 1 5.5943 . . . . . . A 111 C H1' . 25571 1 29 . 1 1 7 7 C H2' H 1 4.6123 . . . . . . A 111 C H2' . 25571 1 30 . 1 1 7 7 C H3' H 1 4.5182 . . . . . . A 111 C H3' . 25571 1 31 . 1 1 7 7 C H5 H 1 5.5967 . . . . . . A 111 C H5 . 25571 1 32 . 1 1 7 7 C H6 H 1 7.7483 . . . . . . A 111 C H6 . 25571 1 33 . 1 1 8 8 G H1' H 1 5.7165 . . . . . . A 112 G H1' . 25571 1 34 . 1 1 8 8 G H2' H 1 4.7284 . . . . . . A 112 G H2' . 25571 1 35 . 1 1 8 8 G H3' H 1 4.5222 . . . . . . A 112 G H3' . 25571 1 36 . 1 1 8 8 G H8 H 1 7.578 . . . . . . A 112 G H8 . 25571 1 37 . 1 1 9 9 U H1' H 1 5.5335 . . . . . . A 113 U H1' . 25571 1 38 . 1 1 9 9 U H2' H 1 4.4336 . . . . . . A 113 U H2' . 25571 1 39 . 1 1 9 9 U H3' H 1 4.5292 . . . . . . A 113 U H3' . 25571 1 40 . 1 1 9 9 U H5 H 1 5.1249 . . . . . . A 113 U H5 . 25571 1 41 . 1 1 9 9 U H6 H 1 7.7699 . . . . . . A 113 U H6 . 25571 1 42 . 1 1 10 10 C H1' H 1 5.6037 . . . . . . A 114 C H1' . 25571 1 43 . 1 1 10 10 C H2' H 1 4.2966 . . . . . . A 114 C H2' . 25571 1 44 . 1 1 10 10 C H3' H 1 4.4685 . . . . . . A 114 C H3' . 25571 1 45 . 1 1 10 10 C H5 H 1 5.6348 . . . . . . A 114 C H5 . 25571 1 46 . 1 1 10 10 C H6 H 1 7.8354 . . . . . . A 114 C H6 . 25571 1 47 . 1 1 11 11 U H1' H 1 5.676 . . . . . . A 115 U H1' . 25571 1 48 . 1 1 11 11 U H2' H 1 4.3399 . . . . . . A 115 U H2' . 25571 1 49 . 1 1 11 11 U H3' H 1 4.5622 . . . . . . A 115 U H3' . 25571 1 50 . 1 1 11 11 U H5 H 1 5.4317 . . . . . . A 115 U H5 . 25571 1 51 . 1 1 11 11 U H6 H 1 7.7389 . . . . . . A 115 U H6 . 25571 1 52 . 1 1 12 12 G H1' H 1 5.7342 . . . . . . A 116 G H1' . 25571 1 53 . 1 1 12 12 G H2' H 1 4.6018 . . . . . . A 116 G H2' . 25571 1 54 . 1 1 12 12 G H3' H 1 4.4534 . . . . . . A 116 G H3' . 25571 1 55 . 1 1 12 12 G H8 H 1 7.8 . . . . . . A 116 G H8 . 25571 1 56 . 1 1 13 13 U H1' H 1 5.7983 . . . . . . A 117 U H1' . 25571 1 57 . 1 1 13 13 U H2' H 1 4.3186 . . . . . . A 117 U H2' . 25571 1 58 . 1 1 13 13 U H3' H 1 4.6154 . . . . . . A 117 U H3' . 25571 1 59 . 1 1 13 13 U H5 H 1 5.6042 . . . . . . A 117 U H5 . 25571 1 60 . 1 1 13 13 U H6 H 1 7.7184 . . . . . . A 117 U H6 . 25571 1 61 . 1 1 14 14 U H1' H 1 5.7909 . . . . . . A 118 U H1' . 25571 1 62 . 1 1 14 14 U H2' H 1 4.2928 . . . . . . A 118 U H2' . 25571 1 63 . 1 1 14 14 U H3' H 1 4.589 . . . . . . A 118 U H3' . 25571 1 64 . 1 1 14 14 U H5 H 1 5.8151 . . . . . . A 118 U H5 . 25571 1 65 . 1 1 14 14 U H6 H 1 7.7381 . . . . . . A 118 U H6 . 25571 1 66 . 1 1 15 15 G H1' H 1 5.8474 . . . . . . A 119 G H1' . 25571 1 67 . 1 1 15 15 G H2' H 1 4.8126 . . . . . . A 119 G H2' . 25571 1 68 . 1 1 15 15 G H3' H 1 4.4762 . . . . . . A 119 G H3' . 25571 1 69 . 1 1 15 15 G H8 H 1 7.9636 . . . . . . A 119 G H8 . 25571 1 70 . 1 1 16 16 U H1' H 1 5.8122 . . . . . . A 120 U H1' . 25571 1 71 . 1 1 16 16 U H2' H 1 4.3124 . . . . . . A 120 U H2' . 25571 1 72 . 1 1 16 16 U H3' H 1 4.6108 . . . . . . A 120 U H3' . 25571 1 73 . 1 1 16 16 U H5 H 1 5.8007 . . . . . . A 120 U H5 . 25571 1 74 . 1 1 16 16 U H6 H 1 7.7312 . . . . . . A 120 U H6 . 25571 1 75 . 1 1 17 17 G H1' H 1 5.8217 . . . . . . A 121 G H1' . 25571 1 76 . 1 1 17 17 G H2' H 1 4.7909 . . . . . . A 121 G H2' . 25571 1 77 . 1 1 17 17 G H3' H 1 4.513 . . . . . . A 121 G H3' . 25571 1 78 . 1 1 17 17 G H8 H 1 7.9473 . . . . . . A 121 G H8 . 25571 1 79 . 1 1 18 18 U H1' H 1 5.8089 . . . . . . A 122 U H1' . 25571 1 80 . 1 1 18 18 U H2' H 1 4.614 . . . . . . A 122 U H2' . 25571 1 81 . 1 1 18 18 U H3' H 1 4.3135 . . . . . . A 122 U H3' . 25571 1 82 . 1 1 18 18 U H5 H 1 5.7355 . . . . . . A 122 U H5 . 25571 1 83 . 1 1 18 18 U H6 H 1 7.716 . . . . . . A 122 U H6 . 25571 1 84 . 1 1 19 19 G H1' H 1 5.7667 . . . . . . A 123 G H1' . 25571 1 85 . 1 1 19 19 G H2' H 1 4.8264 . . . . . . A 123 G H2' . 25571 1 86 . 1 1 19 19 G H3' H 1 4.7882 . . . . . . A 123 G H3' . 25571 1 87 . 1 1 19 19 G H4' H 1 4.4904 . . . . . . A 123 G H4' . 25571 1 88 . 1 1 19 19 G H5' H 1 4.2493 . . . . . . A 123 G H5' . 25571 1 89 . 1 1 19 19 G H5'' H 1 4.1944 . . . . . . A 123 G H5'' . 25571 1 90 . 1 1 19 19 G H8 H 1 7.9548 . . . . . . A 123 G H8 . 25571 1 91 . 1 1 20 20 A H1' H 1 5.9987 . . . . . . A 124 A H1' . 25571 1 92 . 1 1 20 20 A H2 H 1 8.1285 . . . . . . A 124 A H2 . 25571 1 93 . 1 1 20 20 A H2' H 1 4.8518 . . . . . . A 124 A H2' . 25571 1 94 . 1 1 20 20 A H3' H 1 4.6789 . . . . . . A 124 A H3' . 25571 1 95 . 1 1 20 20 A H8 H 1 8.2667 . . . . . . A 124 A H8 . 25571 1 96 . 1 1 21 21 C H1' H 1 5.2132 . . . . . . A 125 C H1' . 25571 1 97 . 1 1 21 21 C H2' H 1 4.3449 . . . . . . A 125 C H2' . 25571 1 98 . 1 1 21 21 C H3' H 1 4.4252 . . . . . . A 125 C H3' . 25571 1 99 . 1 1 21 21 C H5 H 1 5.8131 . . . . . . A 125 C H5 . 25571 1 100 . 1 1 21 21 C H6 H 1 7.774 . . . . . . A 125 C H6 . 25571 1 101 . 1 1 22 22 U H1' H 1 5.5397 . . . . . . A 126 U H1' . 25571 1 102 . 1 1 22 22 U H2' H 1 4.5649 . . . . . . A 126 U H2' . 25571 1 103 . 1 1 22 22 U H3' H 1 4.5356 . . . . . . A 126 U H3' . 25571 1 104 . 1 1 22 22 U H5 H 1 5.4784 . . . . . . A 126 U H5 . 25571 1 105 . 1 1 22 22 U H6 H 1 7.9384 . . . . . . A 126 U H6 . 25571 1 106 . 1 1 23 23 C H1' H 1 5.5359 . . . . . . A 127 C H1' . 25571 1 107 . 1 1 23 23 C H2' H 1 4.3197 . . . . . . A 127 C H2' . 25571 1 108 . 1 1 23 23 C H3' H 1 4.4567 . . . . . . A 127 C H3' . 25571 1 109 . 1 1 23 23 C H5 H 1 5.6833 . . . . . . A 127 C H5 . 25571 1 110 . 1 1 23 23 C H6 H 1 7.8458 . . . . . . A 127 C H6 . 25571 1 111 . 1 1 24 24 U H1' H 1 5.4932 . . . . . . A 128 U H1' . 25571 1 112 . 1 1 24 24 U H2' H 1 4.6111 . . . . . . A 128 U H2' . 25571 1 113 . 1 1 24 24 U H3' H 1 4.4377 . . . . . . A 128 U H3' . 25571 1 114 . 1 1 24 24 U H5 H 1 5.355 . . . . . . A 128 U H5 . 25571 1 115 . 1 1 24 24 U H6 H 1 7.8084 . . . . . . A 128 U H6 . 25571 1 116 . 1 1 25 25 G H1' H 1 5.7637 . . . . . . A 129 G H1' . 25571 1 117 . 1 1 25 25 G H2' H 1 4.5742 . . . . . . A 129 G H2' . 25571 1 118 . 1 1 25 25 G H3' H 1 4.5022 . . . . . . A 129 G H3' . 25571 1 119 . 1 1 25 25 G H8 H 1 7.7092 . . . . . . A 129 G H8 . 25571 1 120 . 1 1 26 26 G H1' H 1 5.6741 . . . . . . A 130 G H1' . 25571 1 121 . 1 1 26 26 G H2' H 1 4.4135 . . . . . . A 130 G H2' . 25571 1 122 . 1 1 26 26 G H3' H 1 4.5768 . . . . . . A 130 G H3' . 25571 1 123 . 1 1 26 26 G H8 H 1 7.1945 . . . . . . A 130 G H8 . 25571 1 124 . 1 1 27 27 U H1' H 1 5.5004 . . . . . . A 131 U H1' . 25571 1 125 . 1 1 27 27 U H2' H 1 4.3644 . . . . . . A 131 U H2' . 25571 1 126 . 1 1 27 27 U H3' H 1 4.5136 . . . . . . A 131 U H3' . 25571 1 127 . 1 1 27 27 U H5 H 1 5.346 . . . . . . A 131 U H5 . 25571 1 128 . 1 1 27 27 U H6 H 1 7.5083 . . . . . . A 131 U H6 . 25571 1 129 . 1 1 28 28 G H1' H 1 5.7017 . . . . . . A 132 G H1' . 25571 1 130 . 1 1 28 28 G H2' H 1 4.668 . . . . . . A 132 G H2' . 25571 1 131 . 1 1 28 28 G H3' H 1 4.4659 . . . . . . A 132 G H3' . 25571 1 132 . 1 1 28 28 G H8 H 1 7.6694 . . . . . . A 132 G H8 . 25571 1 133 . 1 1 29 29 A H1' H 1 5.7292 . . . . . . A 133 A H1' . 25571 1 134 . 1 1 29 29 A H2 H 1 7.9514 . . . . . . A 133 A H2 . 25571 1 135 . 1 1 29 29 A H2' H 1 4.6312 . . . . . . A 133 A H2' . 25571 1 136 . 1 1 29 29 A H3' H 1 4.4601 . . . . . . A 133 A H3' . 25571 1 137 . 1 1 29 29 A H8 H 1 8.2365 . . . . . . A 133 A H8 . 25571 1 138 . 1 1 30 30 G H1' H 1 5.2717 . . . . . . A 134 G H1' . 25571 1 139 . 1 1 30 30 G H2' H 1 4.2602 . . . . . . A 134 G H2' . 25571 1 140 . 1 1 30 30 G H3' H 1 4.5813 . . . . . . A 134 G H3' . 25571 1 141 . 1 1 30 30 G H8 H 1 7.6235 . . . . . . A 134 G H8 . 25571 1 142 . 1 1 31 31 A H1' H 1 6.0836 . . . . . . A 135 A H1' . 25571 1 143 . 1 1 31 31 A H2 H 1 8.2115 . . . . . . A 135 A H2 . 25571 1 144 . 1 1 31 31 A H2' H 1 4.688 . . . . . . A 135 A H2' . 25571 1 145 . 1 1 31 31 A H3' H 1 4.9785 . . . . . . A 135 A H3' . 25571 1 146 . 1 1 31 31 A H8 H 1 8.1666 . . . . . . A 135 A H8 . 25571 1 147 . 1 1 32 32 G H1' H 1 4.2753 . . . . . . A 217 G H1' . 25571 1 148 . 1 1 32 32 G H2' H 1 4.4804 . . . . . . A 217 G H2' . 25571 1 149 . 1 1 32 32 G H3' H 1 4.3543 . . . . . . A 217 G H3' . 25571 1 150 . 1 1 32 32 G H8 H 1 7.8561 . . . . . . A 217 G H8 . 25571 1 151 . 1 1 33 33 C H1' H 1 5.4764 . . . . . . A 218 C H1' . 25571 1 152 . 1 1 33 33 C H2' H 1 4.3294 . . . . . . A 218 C H2' . 25571 1 153 . 1 1 33 33 C H3' H 1 4.4361 . . . . . . A 218 C H3' . 25571 1 154 . 1 1 33 33 C H5 H 1 5.3313 . . . . . . A 218 C H5 . 25571 1 155 . 1 1 33 33 C H6 H 1 7.6724 . . . . . . A 218 C H6 . 25571 1 156 . 1 1 34 34 C H1' H 1 5.4775 . . . . . . A 219 C H1' . 25571 1 157 . 1 1 34 34 C H2' H 1 4.3284 . . . . . . A 219 C H2' . 25571 1 158 . 1 1 34 34 C H3' H 1 4.4056 . . . . . . A 219 C H3' . 25571 1 159 . 1 1 34 34 C H5 H 1 5.5029 . . . . . . A 219 C H5 . 25571 1 160 . 1 1 34 34 C H6 H 1 7.7479 . . . . . . A 219 C H6 . 25571 1 161 . 1 1 35 35 A H1' H 1 5.9024 . . . . . . A 220 A H1' . 25571 1 162 . 1 1 35 35 A H2 H 1 6.9203 . . . . . . A 220 A H2 . 25571 1 163 . 1 1 35 35 A H2' H 1 4.686 . . . . . . A 220 A H2' . 25571 1 164 . 1 1 35 35 A H3' H 1 4.5051 . . . . . . A 220 A H3' . 25571 1 165 . 1 1 35 35 A H8 H 1 7.9451 . . . . . . A 220 A H8 . 25571 1 166 . 1 1 36 36 G H1' H 1 5.5201 . . . . . . A 221 G H1' . 25571 1 167 . 1 1 36 36 G H2' H 1 4.5087 . . . . . . A 221 G H2' . 25571 1 168 . 1 1 36 36 G H3' H 1 4.4256 . . . . . . A 221 G H3' . 25571 1 169 . 1 1 36 36 G H8 H 1 7.0625 . . . . . . A 221 G H8 . 25571 1 170 . 1 1 37 37 A H1' H 1 5.8875 . . . . . . A 222 A H1' . 25571 1 171 . 1 1 37 37 A H2 H 1 7.4591 . . . . . . A 222 A H2 . 25571 1 172 . 1 1 37 37 A H2' H 1 4.6285 . . . . . . A 222 A H2' . 25571 1 173 . 1 1 37 37 A H3' H 1 4.5725 . . . . . . A 222 A H3' . 25571 1 174 . 1 1 37 37 A H8 H 1 7.5719 . . . . . . A 222 A H8 . 25571 1 175 . 1 1 38 38 G H1' H 1 5.54 . . . . . . A 223 G H1' . 25571 1 176 . 1 1 38 38 G H2' H 1 4.3782 . . . . . . A 223 G H2' . 25571 1 177 . 1 1 38 38 G H3' H 1 4.2692 . . . . . . A 223 G H3' . 25571 1 178 . 1 1 38 38 G H8 H 1 7.0179 . . . . . . A 223 G H8 . 25571 1 179 . 1 1 39 39 G H1' H 1 5.6623 . . . . . . A 224 G H1' . 25571 1 180 . 1 1 39 39 G H2' H 1 4.5037 . . . . . . A 224 G H2' . 25571 1 181 . 1 1 39 39 G H3' H 1 4.4078 . . . . . . A 224 G H3' . 25571 1 182 . 1 1 39 39 G H8 H 1 7.6038 . . . . . . A 224 G H8 . 25571 1 183 . 1 1 40 40 A H1' H 1 5.7417 . . . . . . A 225 A H1' . 25571 1 184 . 1 1 40 40 A H2 H 1 7.9017 . . . . . . A 225 A H2 . 25571 1 185 . 1 1 40 40 A H2' H 1 4.6262 . . . . . . A 225 A H2' . 25571 1 186 . 1 1 40 40 A H3' H 1 4.5323 . . . . . . A 225 A H3' . 25571 1 187 . 1 1 40 40 A H8 H 1 7.9999 . . . . . . A 225 A H8 . 25571 1 188 . 1 1 41 41 G H1' H 1 5.5285 . . . . . . A 226 G H1' . 25571 1 189 . 1 1 41 41 G H2' H 1 4.5907 . . . . . . A 226 G H2' . 25571 1 190 . 1 1 41 41 G H3' H 1 4.6594 . . . . . . A 226 G H3' . 25571 1 191 . 1 1 41 41 G H8 H 1 7.6593 . . . . . . A 226 G H8 . 25571 1 192 . 1 1 42 42 A H1' H 1 5.9657 . . . . . . A 227 A H1' . 25571 1 193 . 1 1 42 42 A H2 H 1 8.0515 . . . . . . A 227 A H2 . 25571 1 194 . 1 1 42 42 A H2' H 1 4.6546 . . . . . . A 227 A H2' . 25571 1 195 . 1 1 42 42 A H3' H 1 4.5131 . . . . . . A 227 A H3' . 25571 1 196 . 1 1 42 42 A H4' H 1 4.3358 . . . . . . A 227 A H4' . 25571 1 197 . 1 1 42 42 A H8 H 1 8.2222 . . . . . . A 227 A H8 . 25571 1 198 . 1 1 43 43 U H1' H 1 5.6682 . . . . . . A 228 U H1' . 25571 1 199 . 1 1 43 43 U H2' H 1 4.2763 . . . . . . A 228 U H2' . 25571 1 200 . 1 1 43 43 U H3' H 1 4.5195 . . . . . . A 228 U H3' . 25571 1 201 . 1 1 43 43 U H5 H 1 5.5558 . . . . . . A 228 U H5 . 25571 1 202 . 1 1 43 43 U H6 H 1 7.6554 . . . . . . A 228 U H6 . 25571 1 203 . 1 1 44 44 C H1' H 1 5.855 . . . . . . A 229 C H1' . 25571 1 204 . 1 1 44 44 C H2' H 1 4.3535 . . . . . . A 229 C H2' . 25571 1 205 . 1 1 44 44 C H3' H 1 4.5388 . . . . . . A 229 C H3' . 25571 1 206 . 1 1 44 44 C H5 H 1 5.933 . . . . . . A 229 C H5 . 25571 1 207 . 1 1 44 44 C H6 H 1 7.8423 . . . . . . A 229 C H6 . 25571 1 208 . 1 1 45 45 U H1' H 1 5.7662 . . . . . . A 230 U H1' . 25571 1 209 . 1 1 45 45 U H2' H 1 4.3223 . . . . . . A 230 U H2' . 25571 1 210 . 1 1 45 45 U H3' H 1 4.5418 . . . . . . A 230 U H3' . 25571 1 211 . 1 1 45 45 U H5 H 1 5.5961 . . . . . . A 230 U H5 . 25571 1 212 . 1 1 45 45 U H6 H 1 7.8202 . . . . . . A 230 U H6 . 25571 1 213 . 1 1 46 46 C H1' H 1 5.894 . . . . . . A 231 C H1' . 25571 1 214 . 1 1 46 46 C H2' H 1 4.3917 . . . . . . A 231 C H2' . 25571 1 215 . 1 1 46 46 C H3' H 1 4.5657 . . . . . . A 231 C H3' . 25571 1 216 . 1 1 46 46 C H5 H 1 6.0165 . . . . . . A 231 C H5 . 25571 1 217 . 1 1 46 46 C H6 H 1 7.8949 . . . . . . A 231 C H6 . 25571 1 218 . 1 1 47 47 U H1' H 1 5.7992 . . . . . . A 232 U H1' . 25571 1 219 . 1 1 47 47 U H2' H 1 4.6022 . . . . . . A 232 U H2' . 25571 1 220 . 1 1 47 47 U H3' H 1 4.5416 . . . . . . A 232 U H3' . 25571 1 221 . 1 1 47 47 U H5 H 1 5.8012 . . . . . . A 232 U H5 . 25571 1 222 . 1 1 47 47 U H6 H 1 7.9745 . . . . . . A 232 U H6 . 25571 1 223 . 1 1 48 48 C H1' H 1 5.6488 . . . . . . A 233 C H1' . 25571 1 224 . 1 1 48 48 C H2' H 1 4.5792 . . . . . . A 233 C H2' . 25571 1 225 . 1 1 48 48 C H5 H 1 5.5073 . . . . . . A 233 C H5 . 25571 1 226 . 1 1 48 48 C H6 H 1 7.6743 . . . . . . A 233 C H6 . 25571 1 227 . 1 1 49 49 G H1' H 1 5.6645 . . . . . . A 234 G H1' . 25571 1 228 . 1 1 49 49 G H8 H 1 7.6608 . . . . . . A 234 G H8 . 25571 1 229 . 1 1 50 50 A H1' H 1 5.996 . . . . . . A 235 A H1' . 25571 1 230 . 1 1 50 50 A H2 H 1 8.0142 . . . . . . A 235 A H2 . 25571 1 231 . 1 1 50 50 A H2' H 1 4.5409 . . . . . . A 235 A H2' . 25571 1 232 . 1 1 50 50 A H8 H 1 8.0851 . . . . . . A 235 A H8 . 25571 1 233 . 1 1 51 51 C H1' H 1 5.4978 . . . . . . A 236 C H1' . 25571 1 234 . 1 1 51 51 C H2' H 1 4.4809 . . . . . . A 236 C H2' . 25571 1 235 . 1 1 51 51 C H3' H 1 4.4205 . . . . . . A 236 C H3' . 25571 1 236 . 1 1 51 51 C H5 H 1 5.5995 . . . . . . A 236 C H5 . 25571 1 237 . 1 1 51 51 C H6 H 1 7.6506 . . . . . . A 236 C H6 . 25571 1 238 . 1 1 52 52 G H1' H 1 5.6468 . . . . . . A 237 G H1' . 25571 1 239 . 1 1 52 52 G H2' H 1 4.3979 . . . . . . A 237 G H2' . 25571 1 240 . 1 1 52 52 G H3' H 1 4.4567 . . . . . . A 237 G H3' . 25571 1 241 . 1 1 52 52 G H8 H 1 7.4145 . . . . . . A 237 G H8 . 25571 1 242 . 1 1 53 53 C H1' H 1 5.3889 . . . . . . A 238 C H1' . 25571 1 243 . 1 1 53 53 C H2' H 1 4.2458 . . . . . . A 238 C H2' . 25571 1 244 . 1 1 53 53 C H3' H 1 4.3406 . . . . . . A 238 C H3' . 25571 1 245 . 1 1 53 53 C H5 H 1 5.1052 . . . . . . A 238 C H5 . 25571 1 246 . 1 1 53 53 C H6 H 1 7.4029 . . . . . . A 238 C H6 . 25571 1 247 . 1 1 54 54 A H1' H 1 5.8134 . . . . . . A 239 A H1' . 25571 1 248 . 1 1 54 54 A H2 H 1 7.0918 . . . . . . A 239 A H2 . 25571 1 249 . 1 1 54 54 A H2' H 1 4.1182 . . . . . . A 239 A H2' . 25571 1 250 . 1 1 54 54 A H3' H 1 4.4918 . . . . . . A 239 A H3' . 25571 1 251 . 1 1 54 54 A H8 H 1 7.8253 . . . . . . A 239 A H8 . 25571 1 252 . 1 1 55 55 G H1' H 1 5.2593 . . . . . . A 240 G H1' . 25571 1 253 . 1 1 55 55 G H2' H 1 4.2045 . . . . . . A 240 G H2' . 25571 1 254 . 1 1 55 55 G H3' H 1 4.3287 . . . . . . A 240 G H3' . 25571 1 255 . 1 1 55 55 G H8 H 1 7.5722 . . . . . . A 240 G H8 . 25571 1 256 . 1 1 56 56 G H1' H 1 5.8335 . . . . . . A 241 G H1' . 25571 1 257 . 1 1 56 56 G H2' H 1 4.7607 . . . . . . A 241 G H2' . 25571 1 258 . 1 1 56 56 G H3' H 1 4.545 . . . . . . A 241 G H3' . 25571 1 259 . 1 1 56 56 G H8 H 1 7.9236 . . . . . . A 241 G H8 . 25571 1 260 . 1 1 57 57 A H1' H 1 5.9159 . . . . . . A 242 A H1' . 25571 1 261 . 1 1 57 57 A H2 H 1 7.9266 . . . . . . A 242 A H2 . 25571 1 262 . 1 1 57 57 A H2' H 1 4.8142 . . . . . . A 242 A H2' . 25571 1 263 . 1 1 57 57 A H3' H 1 4.5755 . . . . . . A 242 A H3' . 25571 1 264 . 1 1 57 57 A H8 H 1 8.2515 . . . . . . A 242 A H8 . 25571 1 265 . 1 1 58 58 C H1' H 1 5.1725 . . . . . . A 243 C H1' . 25571 1 266 . 1 1 58 58 C H2' H 1 4.2175 . . . . . . A 243 C H2' . 25571 1 267 . 1 1 58 58 C H3' H 1 4.4205 . . . . . . A 243 C H3' . 25571 1 268 . 1 1 58 58 C H5 H 1 5.4937 . . . . . . A 243 C H5 . 25571 1 269 . 1 1 58 58 C H6 H 1 7.6576 . . . . . . A 243 C H6 . 25571 1 270 . 1 1 59 59 U H1' H 1 5.4959 . . . . . . A 244 U H1' . 25571 1 271 . 1 1 59 59 U H2' H 1 4.4346 . . . . . . A 244 U H2' . 25571 1 272 . 1 1 59 59 U H3' H 1 4.6082 . . . . . . A 244 U H3' . 25571 1 273 . 1 1 59 59 U H5 H 1 5.3957 . . . . . . A 244 U H5 . 25571 1 274 . 1 1 59 59 U H6 H 1 7.8109 . . . . . . A 244 U H6 . 25571 1 275 . 1 1 60 60 C H1' H 1 5.5556 . . . . . . A 245 C H1' . 25571 1 276 . 1 1 60 60 C H2' H 1 4.4484 . . . . . . A 245 C H2' . 25571 1 277 . 1 1 60 60 C H3' H 1 4.5057 . . . . . . A 245 C H3' . 25571 1 278 . 1 1 60 60 C H5 H 1 5.6157 . . . . . . A 245 C H5 . 25571 1 279 . 1 1 60 60 C H6 H 1 7.7992 . . . . . . A 245 C H6 . 25571 1 280 . 1 1 61 61 G H1' H 1 5.6386 . . . . . . A 246 G H1' . 25571 1 281 . 1 1 61 61 G H2' H 1 4.6172 . . . . . . A 246 G H2' . 25571 1 282 . 1 1 61 61 G H8 H 1 7.5013 . . . . . . A 246 G H8 . 25571 1 283 . 1 1 62 62 G H1' H 1 5.738 . . . . . . A 247 G H1' . 25571 1 284 . 1 1 62 62 G H2' H 1 4.5623 . . . . . . A 247 G H2' . 25571 1 285 . 1 1 62 62 G H3' H 1 4.6458 . . . . . . A 247 G H3' . 25571 1 286 . 1 1 62 62 G H8 H 1 7.4914 . . . . . . A 247 G H8 . 25571 1 287 . 1 1 63 63 C H1' H 1 5.5125 . . . . . . A 248 C H1' . 25571 1 288 . 1 1 63 63 C H2' H 1 4.3756 . . . . . . A 248 C H2' . 25571 1 289 . 1 1 63 63 C H3' H 1 4.4592 . . . . . . A 248 C H3' . 25571 1 290 . 1 1 63 63 C H5 H 1 5.5196 . . . . . . A 248 C H5 . 25571 1 291 . 1 1 63 63 C H6 H 1 7.6991 . . . . . . A 248 C H6 . 25571 1 292 . 1 1 64 64 U H1' H 1 5.5323 . . . . . . A 249 U H1' . 25571 1 293 . 1 1 64 64 U H2' H 1 4.5397 . . . . . . A 249 U H2' . 25571 1 294 . 1 1 64 64 U H3' H 1 4.4346 . . . . . . A 249 U H3' . 25571 1 295 . 1 1 64 64 U H5 H 1 5.4458 . . . . . . A 249 U H5 . 25571 1 296 . 1 1 64 64 U H6 H 1 7.8747 . . . . . . A 249 U H6 . 25571 1 297 . 1 1 65 65 U H1' H 1 5.6321 . . . . . . A 250 U H1' . 25571 1 298 . 1 1 65 65 U H2' H 1 4.5167 . . . . . . A 250 U H2' . 25571 1 299 . 1 1 65 65 U H3' H 1 4.6139 . . . . . . A 250 U H3' . 25571 1 300 . 1 1 65 65 U H5 H 1 5.5953 . . . . . . A 250 U H5 . 25571 1 301 . 1 1 65 65 U H6 H 1 7.8985 . . . . . . A 250 U H6 . 25571 1 302 . 1 1 66 66 G H1' H 1 5.7477 . . . . . . A 251 G H1' . 25571 1 303 . 1 1 66 66 G H2' H 1 4.4804 . . . . . . A 251 G H2' . 25571 1 304 . 1 1 66 66 G H3' H 1 4.5242 . . . . . . A 251 G H3' . 25571 1 305 . 1 1 66 66 G H8 H 1 7.7748 . . . . . . A 251 G H8 . 25571 1 306 . 1 1 67 67 C H1' H 1 5.4494 . . . . . . A 252 C H1' . 25571 1 307 . 1 1 67 67 C H2' H 1 4.5402 . . . . . . A 252 C H2' . 25571 1 308 . 1 1 67 67 C H3' H 1 4.2837 . . . . . . A 252 C H3' . 25571 1 309 . 1 1 67 67 C H5 H 1 5.135 . . . . . . A 252 C H5 . 25571 1 310 . 1 1 67 67 C H6 H 1 7.5065 . . . . . . A 252 C H6 . 25571 1 311 . 1 1 68 68 U H1' H 1 5.6613 . . . . . . A 253 U H1' . 25571 1 312 . 1 1 68 68 U H2' H 1 4.2647 . . . . . . A 253 U H2' . 25571 1 313 . 1 1 68 68 U H3' H 1 4.5184 . . . . . . A 253 U H3' . 25571 1 314 . 1 1 68 68 U H5 H 1 5.658 . . . . . . A 253 U H5 . 25571 1 315 . 1 1 68 68 U H6 H 1 7.7256 . . . . . . A 253 U H6 . 25571 1 316 . 1 1 69 69 G H1' H 1 5.7267 . . . . . . A 254 G H1' . 25571 1 317 . 1 1 69 69 G H2' H 1 4.6205 . . . . . . A 254 G H2' . 25571 1 318 . 1 1 69 69 G H3' H 1 4.4198 . . . . . . A 254 G H3' . 25571 1 319 . 1 1 69 69 G H8 H 1 7.786 . . . . . . A 254 G H8 . 25571 1 320 . 1 1 70 70 G H1' H 1 5.6539 . . . . . . A 260 G H1' . 25571 1 321 . 1 1 70 70 G H2' H 1 4.345 . . . . . . A 260 G H2' . 25571 1 322 . 1 1 70 70 G H3' H 1 4.627 . . . . . . A 260 G H3' . 25571 1 323 . 1 1 70 70 G H8 H 1 7.2848 . . . . . . A 260 G H8 . 25571 1 324 . 1 1 71 71 A H1' H 1 5.7466 . . . . . . A 261 A H1' . 25571 1 325 . 1 1 71 71 A H2 H 1 7.9605 . . . . . . A 261 A H2 . 25571 1 326 . 1 1 71 71 A H2' H 1 4.6946 . . . . . . A 261 A H2' . 25571 1 327 . 1 1 71 71 A H3' H 1 4.4343 . . . . . . A 261 A H3' . 25571 1 328 . 1 1 71 71 A H8 H 1 8.2298 . . . . . . A 261 A H8 . 25571 1 329 . 1 1 72 72 G H1' H 1 5.1393 . . . . . . A 262 G H1' . 25571 1 330 . 1 1 72 72 G H2' H 1 4.3359 . . . . . . A 262 G H2' . 25571 1 331 . 1 1 72 72 G H3' H 1 4.5959 . . . . . . A 262 G H3' . 25571 1 332 . 1 1 72 72 G H8 H 1 7.5952 . . . . . . A 262 G H8 . 25571 1 333 . 1 1 73 73 A H1' H 1 6.0669 . . . . . . A 263 A H1' . 25571 1 334 . 1 1 73 73 A H2 H 1 8.23 . . . . . . A 263 A H2 . 25571 1 335 . 1 1 73 73 A H2' H 1 4.5966 . . . . . . A 263 A H2' . 25571 1 336 . 1 1 73 73 A H3' H 1 4.8585 . . . . . . A 263 A H3' . 25571 1 337 . 1 1 73 73 A H8 H 1 8.2305 . . . . . . A 263 A H8 . 25571 1 338 . 1 1 74 74 C H1' H 1 4.0968 . . . . . . A 264 C H1' . 25571 1 339 . 1 1 74 74 C H2' H 1 4.4657 . . . . . . A 264 C H2' . 25571 1 340 . 1 1 74 74 C H3' H 1 4.2306 . . . . . . A 264 C H3' . 25571 1 341 . 1 1 74 74 C H5 H 1 6.0254 . . . . . . A 264 C H5 . 25571 1 342 . 1 1 74 74 C H6 H 1 7.7836 . . . . . . A 264 C H6 . 25571 1 343 . 1 1 75 75 G H1' H 1 5.7238 . . . . . . A 265 G H1' . 25571 1 344 . 1 1 75 75 G H2' H 1 4.7748 . . . . . . A 265 G H2' . 25571 1 345 . 1 1 75 75 G H3' H 1 4.4495 . . . . . . A 265 G H3' . 25571 1 346 . 1 1 75 75 G H8 H 1 7.6136 . . . . . . A 265 G H8 . 25571 1 347 . 1 1 76 76 G H1' H 1 5.7013 . . . . . . A 266 G H1' . 25571 1 348 . 1 1 76 76 G H2' H 1 4.4668 . . . . . . A 266 G H2' . 25571 1 349 . 1 1 76 76 G H3' H 1 4.5227 . . . . . . A 266 G H3' . 25571 1 350 . 1 1 76 76 G H8 H 1 7.2362 . . . . . . A 266 G H8 . 25571 1 351 . 1 1 77 77 C H1' H 1 5.4863 . . . . . . A 267 C H1' . 25571 1 352 . 1 1 77 77 C H2' H 1 4.5514 . . . . . . A 267 C H2' . 25571 1 353 . 1 1 77 77 C H3' H 1 4.4432 . . . . . . A 267 C H3' . 25571 1 354 . 1 1 77 77 C H5 H 1 5.2045 . . . . . . A 267 C H5 . 25571 1 355 . 1 1 77 77 C H6 H 1 7.4942 . . . . . . A 267 C H6 . 25571 1 356 . 1 1 78 78 A H1' H 1 5.8702 . . . . . . A 268 A H1' . 25571 1 357 . 1 1 78 78 A H2 H 1 6.7079 . . . . . . A 268 A H2 . 25571 1 358 . 1 1 78 78 A H2' H 1 4.5733 . . . . . . A 268 A H2' . 25571 1 359 . 1 1 78 78 A H3' H 1 4.4939 . . . . . . A 268 A H3' . 25571 1 360 . 1 1 78 78 A H8 H 1 7.9192 . . . . . . A 268 A H8 . 25571 1 361 . 1 1 79 79 A H1' H 1 5.7499 . . . . . . A 269 A H1' . 25571 1 362 . 1 1 79 79 A H2 H 1 7.3916 . . . . . . A 269 A H2 . 25571 1 363 . 1 1 79 79 A H2' H 1 4.5411 . . . . . . A 269 A H2' . 25571 1 364 . 1 1 79 79 A H3' H 1 4.4648 . . . . . . A 269 A H3' . 25571 1 365 . 1 1 79 79 A H8 H 1 7.6347 . . . . . . A 269 A H8 . 25571 1 366 . 1 1 80 80 G H1' H 1 5.4512 . . . . . . A 270 G H1' . 25571 1 367 . 1 1 80 80 G H2' H 1 4.2568 . . . . . . A 270 G H2' . 25571 1 368 . 1 1 80 80 G H3' H 1 4.434 . . . . . . A 270 G H3' . 25571 1 369 . 1 1 80 80 G H8 H 1 7.1169 . . . . . . A 270 G H8 . 25571 1 370 . 1 1 81 81 A H1' H 1 5.8556 . . . . . . A 271 A H1' . 25571 1 371 . 1 1 81 81 A H2 H 1 7.7279 . . . . . . A 271 A H2 . 25571 1 372 . 1 1 81 81 A H2' H 1 4.3804 . . . . . . A 271 A H2' . 25571 1 373 . 1 1 81 81 A H3' H 1 4.5816 . . . . . . A 271 A H3' . 25571 1 374 . 1 1 81 81 A H8 H 1 7.7958 . . . . . . A 271 A H8 . 25571 1 375 . 1 1 82 82 G H1' H 1 5.5608 . . . . . . A 272 G H1' . 25571 1 376 . 1 1 82 82 G H2' H 1 4.5401 . . . . . . A 272 G H2' . 25571 1 377 . 1 1 82 82 G H3' H 1 4.6465 . . . . . . A 272 G H3' . 25571 1 378 . 1 1 82 82 G H8 H 1 7.5768 . . . . . . A 272 G H8 . 25571 1 379 . 1 1 83 83 G H1' H 1 5.7668 . . . . . . A 273 G H1' . 25571 1 380 . 1 1 83 83 G H2' H 1 4.7566 . . . . . . A 273 G H2' . 25571 1 381 . 1 1 83 83 G H3' H 1 4.6599 . . . . . . A 273 G H3' . 25571 1 382 . 1 1 83 83 G H8 H 1 7.8292 . . . . . . A 273 G H8 . 25571 1 383 . 1 1 84 84 C H1' H 1 5.6779 . . . . . . A 274 C H1' . 25571 1 384 . 1 1 84 84 C H5 H 1 5.5918 . . . . . . A 274 C H5 . 25571 1 385 . 1 1 84 84 C H6 H 1 7.7319 . . . . . . A 274 C H6 . 25571 1 386 . 1 1 85 85 G H1' H 1 5.7296 . . . . . . A 275 G H1' . 25571 1 387 . 1 1 85 85 G H2' H 1 4.504 . . . . . . A 275 G H2' . 25571 1 388 . 1 1 85 85 G H3' H 1 4.613 . . . . . . A 275 G H3' . 25571 1 389 . 1 1 85 85 G H8 H 1 7.6852 . . . . . . A 275 G H8 . 25571 1 390 . 1 1 86 86 A H1' H 1 5.899 . . . . . . A 276 A H1' . 25571 1 391 . 1 1 86 86 A H2 H 1 7.3897 . . . . . . A 276 A H2 . 25571 1 392 . 1 1 86 86 A H2' H 1 4.6427 . . . . . . A 276 A H2' . 25571 1 393 . 1 1 86 86 A H3' H 1 4.5946 . . . . . . A 276 A H3' . 25571 1 394 . 1 1 86 86 A H8 H 1 7.7106 . . . . . . A 276 A H8 . 25571 1 395 . 1 1 87 87 G H1' H 1 5.4651 . . . . . . A 277 G H1' . 25571 1 396 . 1 1 87 87 G H2' H 1 4.3488 . . . . . . A 277 G H2' . 25571 1 397 . 1 1 87 87 G H3' H 1 4.3902 . . . . . . A 277 G H3' . 25571 1 398 . 1 1 87 87 G H8 H 1 7.0241 . . . . . . A 277 G H8 . 25571 1 399 . 1 1 88 88 G H1' H 1 5.6515 . . . . . . A 278 G H1' . 25571 1 400 . 1 1 88 88 G H2' H 1 4.5578 . . . . . . A 278 G H2' . 25571 1 401 . 1 1 88 88 G H3' H 1 4.4182 . . . . . . A 278 G H3' . 25571 1 402 . 1 1 88 88 G H8 H 1 7.5937 . . . . . . A 278 G H8 . 25571 1 403 . 1 1 89 89 G H1' H 1 5.7144 . . . . . . A 279 G H1' . 25571 1 404 . 1 1 89 89 G H2' H 1 4.5966 . . . . . . A 279 G H2' . 25571 1 405 . 1 1 89 89 G H3' H 1 4.7487 . . . . . . A 279 G H3' . 25571 1 406 . 1 1 89 89 G H8 H 1 7.7351 . . . . . . A 279 G H8 . 25571 1 407 . 1 1 90 90 G H1' H 1 5.7676 . . . . . . A 280 G H1' . 25571 1 408 . 1 1 90 90 G H8 H 1 7.96 . . . . . . A 280 G H8 . 25571 1 409 . 1 1 91 91 C H1' H 1 5.4704 . . . . . . A 281 C H1' . 25571 1 410 . 1 1 91 91 C H2' H 1 4.4538 . . . . . . A 281 C H2' . 25571 1 411 . 1 1 91 91 C H3' H 1 4.392 . . . . . . A 281 C H3' . 25571 1 412 . 1 1 91 91 C H5 H 1 5.2455 . . . . . . A 281 C H5 . 25571 1 413 . 1 1 91 91 C H6 H 1 7.5702 . . . . . . A 281 C H6 . 25571 1 414 . 1 1 92 92 G H1' H 1 5.633 . . . . . . A 282 G H1' . 25571 1 415 . 1 1 92 92 G H2' H 1 4.5327 . . . . . . A 282 G H2' . 25571 1 416 . 1 1 92 92 G H3' H 1 4.3953 . . . . . . A 282 G H3' . 25571 1 417 . 1 1 92 92 G H8 H 1 7.5066 . . . . . . A 282 G H8 . 25571 1 418 . 1 1 93 93 G H1' H 1 5.6282 . . . . . . A 283 G H1' . 25571 1 419 . 1 1 93 93 G H2' H 1 4.6021 . . . . . . A 283 G H2' . 25571 1 420 . 1 1 93 93 G H3' H 1 4.5492 . . . . . . A 283 G H3' . 25571 1 421 . 1 1 93 93 G H8 H 1 7.4881 . . . . . . A 283 G H8 . 25571 1 422 . 1 1 94 94 C H1' H 1 5.6385 . . . . . . A 284 C H1' . 25571 1 423 . 1 1 94 94 C H5 H 1 5.5859 . . . . . . A 284 C H5 . 25571 1 424 . 1 1 94 94 C H6 H 1 7.709 . . . . . . A 284 C H6 . 25571 1 425 . 1 1 95 95 G H1' H 1 5.6565 . . . . . . A 285 G H1' . 25571 1 426 . 1 1 95 95 G H2' H 1 4.5562 . . . . . . A 285 G H2' . 25571 1 427 . 1 1 95 95 G H3' H 1 4.5184 . . . . . . A 285 G H3' . 25571 1 428 . 1 1 95 95 G H8 H 1 7.7212 . . . . . . A 285 G H8 . 25571 1 429 . 1 1 96 96 A H1' H 1 5.9251 . . . . . . A 286 A H1' . 25571 1 430 . 1 1 96 96 A H2 H 1 7.9026 . . . . . . A 286 A H2 . 25571 1 431 . 1 1 96 96 A H8 H 1 7.7445 . . . . . . A 286 A H8 . 25571 1 432 . 1 1 97 97 C H1' H 1 5.446 . . . . . . A 287 C H1' . 25571 1 433 . 1 1 97 97 C H6 H 1 7.5919 . . . . . . A 287 C H6 . 25571 1 434 . 1 1 98 98 U H1' H 1 5.5587 . . . . . . A 288 U H1' . 25571 1 435 . 1 1 98 98 U H2' H 1 4.2803 . . . . . . A 288 U H2' . 25571 1 436 . 1 1 98 98 U H3' H 1 4.5198 . . . . . . A 288 U H3' . 25571 1 437 . 1 1 98 98 U H5 H 1 5.4186 . . . . . . A 288 U H5 . 25571 1 438 . 1 1 98 98 U H6 H 1 7.5718 . . . . . . A 288 U H6 . 25571 1 439 . 1 1 99 99 G H1' H 1 5.6999 . . . . . . A 289 G H1' . 25571 1 440 . 1 1 99 99 G H8 H 1 7.737 . . . . . . A 289 G H8 . 25571 1 441 . 1 1 101 101 U H1' H 1 5.7545 . . . . . . A 291 U H1' . 25571 1 442 . 1 1 101 101 U H2' H 1 4.6156 . . . . . . A 291 U H2' . 25571 1 443 . 1 1 101 101 U H3' H 1 4.4081 . . . . . . A 291 U H3' . 25571 1 444 . 1 1 101 101 U H5 H 1 5.7638 . . . . . . A 291 U H5 . 25571 1 445 . 1 1 101 101 U H6 H 1 7.8423 . . . . . . A 291 U H6 . 25571 1 446 . 1 1 102 102 G H1' H 1 5.6826 . . . . . . A 292 G H1' . 25571 1 447 . 1 1 102 102 G H2' H 1 4.5327 . . . . . . A 292 G H2' . 25571 1 448 . 1 1 102 102 G H3' H 1 4.6606 . . . . . . A 292 G H3' . 25571 1 449 . 1 1 102 102 G H8 H 1 7.8907 . . . . . . A 292 G H8 . 25571 1 450 . 1 1 103 103 A H1' H 1 5.7445 . . . . . . A 293 A H1' . 25571 1 451 . 1 1 103 103 A H2 H 1 7.8135 . . . . . . A 293 A H2 . 25571 1 452 . 1 1 103 103 A H2' H 1 4.7141 . . . . . . A 293 A H2' . 25571 1 453 . 1 1 103 103 A H3' H 1 4.5484 . . . . . . A 293 A H3' . 25571 1 454 . 1 1 103 103 A H8 H 1 8.0717 . . . . . . A 293 A H8 . 25571 1 455 . 1 1 104 104 G H1' H 1 5.6641 . . . . . . A 294 G H1' . 25571 1 456 . 1 1 104 104 G H8 H 1 7.6388 . . . . . . A 294 G H8 . 25571 1 457 . 1 1 105 105 U H1' H 1 5.8472 . . . . . . A 295 U H1' . 25571 1 458 . 1 1 105 105 U H2' H 1 4.2688 . . . . . . A 295 U H2' . 25571 1 459 . 1 1 105 105 U H3' H 1 4.5904 . . . . . . A 295 U H3' . 25571 1 460 . 1 1 105 105 U H5 H 1 5.7671 . . . . . . A 295 U H5 . 25571 1 461 . 1 1 105 105 U H6 H 1 7.6822 . . . . . . A 295 U H6 . 25571 1 462 . 1 1 106 106 A H1' H 1 5.9995 . . . . . . A 296 A H1' . 25571 1 463 . 1 1 106 106 A H2 H 1 8.0681 . . . . . . A 296 A H2 . 25571 1 464 . 1 1 106 106 A H2' H 1 4.8122 . . . . . . A 296 A H2' . 25571 1 465 . 1 1 106 106 A H3' H 1 4.5502 . . . . . . A 296 A H3' . 25571 1 466 . 1 1 106 106 A H8 H 1 8.3584 . . . . . . A 296 A H8 . 25571 1 467 . 1 1 107 107 C H1' H 1 5.6584 . . . . . . A 297 C H1' . 25571 1 468 . 1 1 107 107 C H3' H 1 4.4959 . . . . . . A 297 C H3' . 25571 1 469 . 1 1 107 107 C H5 H 1 5.8086 . . . . . . A 297 C H5 . 25571 1 470 . 1 1 107 107 C H6 H 1 7.7167 . . . . . . A 297 C H6 . 25571 1 471 . 1 1 108 108 G H1' H 1 5.6562 . . . . . . A 298 G H1' . 25571 1 472 . 1 1 108 108 G H8 H 1 7.7701 . . . . . . A 298 G H8 . 25571 1 473 . 1 1 109 109 C H1' H 1 5.4845 . . . . . . A 299 C H1' . 25571 1 474 . 1 1 109 109 C H3' H 1 4.4711 . . . . . . A 299 C H3' . 25571 1 475 . 1 1 109 109 C H5 H 1 5.587 . . . . . . A 299 C H5 . 25571 1 476 . 1 1 109 109 C H6 H 1 7.5661 . . . . . . A 299 C H6 . 25571 1 477 . 1 1 110 110 C H1' H 1 5.6604 . . . . . . A 300 C H1' . 25571 1 478 . 1 1 110 110 C H2' H 1 4.1897 . . . . . . A 300 C H2' . 25571 1 479 . 1 1 110 110 C H5 H 1 5.5837 . . . . . . A 300 C H5 . 25571 1 480 . 1 1 110 110 C H6 H 1 7.5771 . . . . . . A 300 C H6 . 25571 1 481 . 1 1 111 111 A H1' H 1 6.0187 . . . . . . A 301 A H1' . 25571 1 482 . 1 1 111 111 A H2 H 1 7.0904 . . . . . . A 301 A H2 . 25571 1 483 . 1 1 112 112 A H1' H 1 5.5031 . . . . . . A 302 A H1' . 25571 1 484 . 1 1 112 112 A H2 H 1 7.6833 . . . . . . A 302 A H2 . 25571 1 485 . 1 1 112 112 A H2' H 1 4.4806 . . . . . . A 302 A H2' . 25571 1 486 . 1 1 112 112 A H3' H 1 4.4105 . . . . . . A 302 A H3' . 25571 1 487 . 1 1 113 113 A H1' H 1 5.5061 . . . . . . A 303 A H1' . 25571 1 488 . 1 1 113 113 A H2 H 1 7.7502 . . . . . . A 303 A H2 . 25571 1 489 . 1 1 113 113 A H2' H 1 4.4889 . . . . . . A 303 A H2' . 25571 1 490 . 1 1 113 113 A H3' H 1 4.4147 . . . . . . A 303 A H3' . 25571 1 491 . 1 1 113 113 A H8 H 1 7.8201 . . . . . . A 303 A H8 . 25571 1 492 . 1 1 114 114 A H1' H 1 5.5699 . . . . . . A 304 A H1' . 25571 1 493 . 1 1 114 114 A H2 H 1 7.8217 . . . . . . A 304 A H2 . 25571 1 494 . 1 1 114 114 A H2' H 1 4.466 . . . . . . A 304 A H2' . 25571 1 495 . 1 1 114 114 A H3' H 1 4.423 . . . . . . A 304 A H3' . 25571 1 496 . 1 1 114 114 A H8 H 1 7.8451 . . . . . . A 304 A H8 . 25571 1 497 . 1 1 115 115 A H1' H 1 5.7691 . . . . . . A 305 A H1' . 25571 1 498 . 1 1 115 115 A H2 H 1 8.0798 . . . . . . A 305 A H2 . 25571 1 499 . 1 1 115 115 A H2' H 1 4.4264 . . . . . . A 305 A H2' . 25571 1 500 . 1 1 115 115 A H3' H 1 4.5944 . . . . . . A 305 A H3' . 25571 1 501 . 1 1 115 115 A H8 H 1 7.9692 . . . . . . A 305 A H8 . 25571 1 502 . 1 1 116 116 U H1' H 1 5.7003 . . . . . . A 306 U H1' . 25571 1 503 . 1 1 116 116 U H2' H 1 4.2246 . . . . . . A 306 U H2' . 25571 1 504 . 1 1 116 116 U H3' H 1 4.5293 . . . . . . A 306 U H3' . 25571 1 505 . 1 1 116 116 U H5 H 1 5.5045 . . . . . . A 306 U H5 . 25571 1 506 . 1 1 116 116 U H6 H 1 7.5839 . . . . . . A 306 U H6 . 25571 1 507 . 1 1 117 117 U H1' H 1 5.9077 . . . . . . A 307 U H1' . 25571 1 508 . 1 1 117 117 U H2' H 1 4.3728 . . . . . . A 307 U H2' . 25571 1 509 . 1 1 117 117 U H3' H 1 4.6129 . . . . . . A 307 U H3' . 25571 1 510 . 1 1 117 117 U H5 H 1 5.8252 . . . . . . A 307 U H5 . 25571 1 511 . 1 1 117 117 U H6 H 1 7.8012 . . . . . . A 307 U H6 . 25571 1 512 . 1 1 118 118 U H1' H 1 5.9068 . . . . . . A 308 U H1' . 25571 1 513 . 1 1 118 118 U H2' H 1 4.4037 . . . . . . A 308 U H2' . 25571 1 514 . 1 1 118 118 U H3' H 1 4.6224 . . . . . . A 308 U H3' . 25571 1 515 . 1 1 118 118 U H5 H 1 5.8718 . . . . . . A 308 U H5 . 25571 1 516 . 1 1 118 118 U H6 H 1 7.8302 . . . . . . A 308 U H6 . 25571 1 517 . 1 1 119 119 U H1' H 1 5.8226 . . . . . . A 309 U H1' . 25571 1 518 . 1 1 119 119 U H2' H 1 4.3126 . . . . . . A 309 U H2' . 25571 1 519 . 1 1 119 119 U H3' H 1 4.6079 . . . . . . A 309 U H3' . 25571 1 520 . 1 1 119 119 U H4' H 1 4.0699 . . . . . . A 309 U H4' . 25571 1 521 . 1 1 119 119 U H5 H 1 5.828 . . . . . . A 309 U H5 . 25571 1 522 . 1 1 119 119 U H6 H 1 7.7493 . . . . . . A 309 U H6 . 25571 1 523 . 1 1 120 120 G H1' H 1 5.7259 . . . . . . A 310 G H1' . 25571 1 524 . 1 1 120 120 G H2' H 1 4.7065 . . . . . . A 310 G H2' . 25571 1 525 . 1 1 120 120 G H3' H 1 4.8325 . . . . . . A 310 G H3' . 25571 1 526 . 1 1 120 120 G H4' H 1 4.4514 . . . . . . A 310 G H4' . 25571 1 527 . 1 1 120 120 G H5' H 1 4.2219 . . . . . . A 310 G H5' . 25571 1 528 . 1 1 120 120 G H5'' H 1 4.1623 . . . . . . A 310 G H5'' . 25571 1 529 . 1 1 120 120 G H8 H 1 7.9218 . . . . . . A 310 G H8 . 25571 1 530 . 1 1 121 121 A H1' H 1 6.1093 . . . . . . A 311 A H1' . 25571 1 531 . 1 1 121 121 A H2 H 1 8.1411 . . . . . . A 311 A H2 . 25571 1 532 . 1 1 121 121 A H2' H 1 4.8798 . . . . . . A 311 A H2' . 25571 1 533 . 1 1 121 121 A H3' H 1 4.8096 . . . . . . A 311 A H3' . 25571 1 534 . 1 1 121 121 A H5'' H 1 4.2823 . . . . . . A 311 A H5'' . 25571 1 535 . 1 1 121 121 A H8 H 1 8.3734 . . . . . . A 311 A H8 . 25571 1 536 . 1 1 122 122 C H1' H 1 5.5122 . . . . . . A 312 C H1' . 25571 1 537 . 1 1 122 122 C H2' H 1 4.428 . . . . . . A 312 C H2' . 25571 1 538 . 1 1 122 122 C H3' H 1 4.4823 . . . . . . A 312 C H3' . 25571 1 539 . 1 1 122 122 C H5 H 1 5.8613 . . . . . . A 312 C H5 . 25571 1 540 . 1 1 122 122 C H6 H 1 7.8658 . . . . . . A 312 C H6 . 25571 1 541 . 1 1 123 123 U H1' H 1 5.5157 . . . . . . A 313 U H1' . 25571 1 542 . 1 1 123 123 U H2' H 1 4.5415 . . . . . . A 313 U H2' . 25571 1 543 . 1 1 123 123 U H3' H 1 4.6739 . . . . . . A 313 U H3' . 25571 1 544 . 1 1 123 123 U H5 H 1 5.5186 . . . . . . A 313 U H5 . 25571 1 545 . 1 1 123 123 U H6 H 1 7.9164 . . . . . . A 313 U H6 . 25571 1 546 . 1 1 124 124 A H1' H 1 5.9489 . . . . . . A 314 A H1' . 25571 1 547 . 1 1 124 124 A H2 H 1 6.7252 . . . . . . A 314 A H2 . 25571 1 548 . 1 1 124 124 A H2' H 1 4.5596 . . . . . . A 314 A H2' . 25571 1 549 . 1 1 124 124 A H3' H 1 4.7536 . . . . . . A 314 A H3' . 25571 1 550 . 1 1 124 124 A H8 H 1 8.1162 . . . . . . A 314 A H8 . 25571 1 551 . 1 1 125 125 G H1' H 1 5.5782 . . . . . . A 315 G H1' . 25571 1 552 . 1 1 125 125 G H2' H 1 4.3038 . . . . . . A 315 G H2' . 25571 1 553 . 1 1 125 125 G H3' H 1 4.4126 . . . . . . A 315 G H3' . 25571 1 554 . 1 1 125 125 G H8 H 1 7.2928 . . . . . . A 315 G H8 . 25571 1 555 . 1 1 126 126 C H1' H 1 5.4583 . . . . . . A 316 C H1' . 25571 1 556 . 1 1 126 126 C H2' H 1 4.4403 . . . . . . A 316 C H2' . 25571 1 557 . 1 1 126 126 C H3' H 1 4.3021 . . . . . . A 316 C H3' . 25571 1 558 . 1 1 126 126 C H5 H 1 4.9943 . . . . . . A 316 C H5 . 25571 1 559 . 1 1 126 126 C H6 H 1 7.2796 . . . . . . A 316 C H6 . 25571 1 560 . 1 1 127 127 G H1' H 1 5.5796 . . . . . . A 317 G H1' . 25571 1 561 . 1 1 127 127 G H2' H 1 4.5383 . . . . . . A 317 G H2' . 25571 1 562 . 1 1 127 127 G H3' H 1 4.394 . . . . . . A 317 G H3' . 25571 1 563 . 1 1 127 127 G H8 H 1 7.602 . . . . . . A 317 G H8 . 25571 1 564 . 1 1 128 128 G H1' H 1 5.3908 . . . . . . A 318 G H1' . 25571 1 565 . 1 1 128 128 G H2' H 1 4.5686 . . . . . . A 318 G H2' . 25571 1 566 . 1 1 128 128 G H3' H 1 4.5485 . . . . . . A 318 G H3' . 25571 1 567 . 1 1 128 128 G H5' H 1 4.0322 . . . . . . A 318 G H5' . 25571 1 568 . 1 1 128 128 G H5'' H 1 3.9463 . . . . . . A 318 G H5'' . 25571 1 569 . 1 1 128 128 G H8 H 1 7.7469 . . . . . . A 318 G H8 . 25571 1 570 . 1 1 129 129 A H1' H 1 5.9522 . . . . . . A 319 A H1' . 25571 1 571 . 1 1 129 129 A H2 H 1 8.0195 . . . . . . A 319 A H2 . 25571 1 572 . 1 1 129 129 A H2' H 1 4.8365 . . . . . . A 319 A H2' . 25571 1 573 . 1 1 129 129 A H3' H 1 4.883 . . . . . . A 319 A H3' . 25571 1 574 . 1 1 129 129 A H4' H 1 4.3841 . . . . . . A 319 A H4' . 25571 1 575 . 1 1 129 129 A H5' H 1 4.0461 . . . . . . A 319 A H5' . 25571 1 576 . 1 1 129 129 A H5'' H 1 3.9285 . . . . . . A 319 A H5'' . 25571 1 577 . 1 1 129 129 A H8 H 1 8.1984 . . . . . . A 319 A H8 . 25571 1 578 . 1 1 130 130 G H1' H 1 5.9756 . . . . . . A 320 G H1' . 25571 1 579 . 1 1 130 130 G H2' H 1 4.8842 . . . . . . A 320 G H2' . 25571 1 580 . 1 1 130 130 G H3' H 1 4.637 . . . . . . A 320 G H3' . 25571 1 581 . 1 1 130 130 G H8 H 1 7.9562 . . . . . . A 320 G H8 . 25571 1 582 . 1 1 131 131 G H1' H 1 5.153 . . . . . . A 321 G H1' . 25571 1 583 . 1 1 131 131 G H2' H 1 4.5997 . . . . . . A 321 G H2' . 25571 1 584 . 1 1 131 131 G H3' H 1 4.4317 . . . . . . A 321 G H3' . 25571 1 585 . 1 1 131 131 G H8 H 1 7.9426 . . . . . . A 321 G H8 . 25571 1 586 . 1 1 132 132 C H1' H 1 5.548 . . . . . . A 322 C H1' . 25571 1 587 . 1 1 132 132 C H2' H 1 4.4421 . . . . . . A 322 C H2' . 25571 1 588 . 1 1 132 132 C H3' H 1 4.4231 . . . . . . A 322 C H3' . 25571 1 589 . 1 1 132 132 C H5 H 1 5.3043 . . . . . . A 322 C H5 . 25571 1 590 . 1 1 132 132 C H6 H 1 7.6584 . . . . . . A 322 C H6 . 25571 1 591 . 1 1 133 133 U H1' H 1 5.5188 . . . . . . A 323 U H1' . 25571 1 592 . 1 1 133 133 U H2' H 1 4.5531 . . . . . . A 323 U H2' . 25571 1 593 . 1 1 133 133 U H3' H 1 4.6285 . . . . . . A 323 U H3' . 25571 1 594 . 1 1 133 133 U H5 H 1 5.4734 . . . . . . A 323 U H5 . 25571 1 595 . 1 1 133 133 U H6 H 1 7.8757 . . . . . . A 323 U H6 . 25571 1 596 . 1 1 134 134 A H1' H 1 5.9271 . . . . . . A 324 A H1' . 25571 1 597 . 1 1 134 134 A H2 H 1 6.7337 . . . . . . A 324 A H2 . 25571 1 598 . 1 1 134 134 A H2' H 1 4.5742 . . . . . . A 324 A H2' . 25571 1 599 . 1 1 134 134 A H3' H 1 4.6955 . . . . . . A 324 A H3' . 25571 1 600 . 1 1 134 134 A H8 H 1 8.0835 . . . . . . A 324 A H8 . 25571 1 601 . 1 1 135 135 G H1' H 1 5.4706 . . . . . . A 325 G H1' . 25571 1 602 . 1 1 135 135 G H2' H 1 4.3228 . . . . . . A 325 G H2' . 25571 1 603 . 1 1 135 135 G H3' H 1 4.4173 . . . . . . A 325 G H3' . 25571 1 604 . 1 1 135 135 G H8 H 1 7.0857 . . . . . . A 325 G H8 . 25571 1 605 . 1 1 136 136 A H1' H 1 5.7817 . . . . . . A 326 A H1' . 25571 1 606 . 1 1 136 136 A H2 H 1 7.7387 . . . . . . A 326 A H2 . 25571 1 607 . 1 1 136 136 A H2' H 1 4.4672 . . . . . . A 326 A H2' . 25571 1 608 . 1 1 136 136 A H3' H 1 4.5579 . . . . . . A 326 A H3' . 25571 1 609 . 1 1 136 136 A H8 H 1 7.7226 . . . . . . A 326 A H8 . 25571 1 610 . 1 1 137 137 A H1' H 1 5.6417 . . . . . . A 327 A H1' . 25571 1 611 . 1 1 137 137 A H2 H 1 7.8951 . . . . . . A 327 A H2 . 25571 1 612 . 1 1 137 137 A H2' H 1 4.3998 . . . . . . A 327 A H2' . 25571 1 613 . 1 1 137 137 A H3' H 1 4.5636 . . . . . . A 327 A H3' . 25571 1 614 . 1 1 137 137 A H8 H 1 7.8842 . . . . . . A 327 A H8 . 25571 1 615 . 1 1 138 138 G H1' H 1 5.5164 . . . . . . A 328 G H1' . 25571 1 616 . 1 1 138 138 G H2' H 1 4.5203 . . . . . . A 328 G H2' . 25571 1 617 . 1 1 138 138 G H3' H 1 4.3258 . . . . . . A 328 G H3' . 25571 1 618 . 1 1 138 138 G H8 H 1 7.6258 . . . . . . A 328 G H8 . 25571 1 619 . 1 1 139 139 G H1' H 1 5.6069 . . . . . . A 329 G H1' . 25571 1 620 . 1 1 139 139 G H2' H 1 4.5904 . . . . . . A 329 G H2' . 25571 1 621 . 1 1 139 139 G H3' H 1 4.3764 . . . . . . A 329 G H3' . 25571 1 622 . 1 1 139 139 G H8 H 1 7.7898 . . . . . . A 329 G H8 . 25571 1 623 . 1 1 140 140 A H1' H 1 5.88 . . . . . . A 330 A H1' . 25571 1 624 . 1 1 140 140 A H2 H 1 7.9932 . . . . . . A 330 A H2 . 25571 1 625 . 1 1 140 140 A H2' H 1 4.6296 . . . . . . A 330 A H2' . 25571 1 626 . 1 1 140 140 A H3' H 1 4.7259 . . . . . . A 330 A H3' . 25571 1 627 . 1 1 140 140 A H8 H 1 8.1446 . . . . . . A 330 A H8 . 25571 1 628 . 1 1 141 141 G H1' H 1 5.5915 . . . . . . A 331 G H1' . 25571 1 629 . 1 1 141 141 G H2' H 1 4.5766 . . . . . . A 331 G H2' . 25571 1 630 . 1 1 141 141 G H3' H 1 4.6996 . . . . . . A 331 G H3' . 25571 1 631 . 1 1 141 141 G H8 H 1 7.7566 . . . . . . A 331 G H8 . 25571 1 632 . 1 1 142 142 A H1' H 1 5.7726 . . . . . . A 332 A H1' . 25571 1 633 . 1 1 142 142 A H2 H 1 7.947 . . . . . . A 332 A H2 . 25571 1 634 . 1 1 142 142 A H2' H 1 4.5518 . . . . . . A 332 A H2' . 25571 1 635 . 1 1 142 142 A H3' H 1 4.5504 . . . . . . A 332 A H3' . 25571 1 636 . 1 1 142 142 A H8 H 1 8.0944 . . . . . . A 332 A H8 . 25571 1 637 . 1 1 143 143 G H1' H 1 5.7253 . . . . . . A 333 G H1' . 25571 1 638 . 1 1 143 143 G H2' H 1 4.7278 . . . . . . A 333 G H2' . 25571 1 639 . 1 1 143 143 G H3' H 1 4.5481 . . . . . . A 333 G H3' . 25571 1 640 . 1 1 143 143 G H8 H 1 7.8225 . . . . . . A 333 G H8 . 25571 1 641 . 1 1 144 144 A H1' H 1 5.9419 . . . . . . A 334 A H1' . 25571 1 642 . 1 1 144 144 A H2 H 1 7.4482 . . . . . . A 334 A H2 . 25571 1 643 . 1 1 144 144 A H2' H 1 4.8015 . . . . . . A 334 A H2' . 25571 1 644 . 1 1 144 144 A H3' H 1 4.6875 . . . . . . A 334 A H3' . 25571 1 645 . 1 1 144 144 A H8 H 1 8.2559 . . . . . . A 334 A H8 . 25571 1 646 . 1 1 145 145 G H1' H 1 5.6379 . . . . . . A 335 G H1' . 25571 1 647 . 1 1 145 145 G H2' H 1 4.6245 . . . . . . A 335 G H2' . 25571 1 648 . 1 1 145 145 G H3' H 1 4.4446 . . . . . . A 335 G H3' . 25571 1 649 . 1 1 145 145 G H8 H 1 7.3309 . . . . . . A 335 G H8 . 25571 1 650 . 1 1 146 146 A H1' H 1 5.9727 . . . . . . A 336 A H1' . 25571 1 651 . 1 1 146 146 A H2 H 1 7.8544 . . . . . . A 336 A H2 . 25571 1 652 . 1 1 146 146 A H2' H 1 4.6372 . . . . . . A 336 A H2' . 25571 1 653 . 1 1 146 146 A H3' H 1 4.5148 . . . . . . A 336 A H3' . 25571 1 654 . 1 1 146 146 A H8 H 1 7.6048 . . . . . . A 336 A H8 . 25571 1 655 . 1 1 147 147 U H1' H 1 5.3139 . . . . . . A 337 U H1' . 25571 1 656 . 1 1 147 147 U H2' H 1 4.2743 . . . . . . A 337 U H2' . 25571 1 657 . 1 1 147 147 U H3' H 1 4.4645 . . . . . . A 337 U H3' . 25571 1 658 . 1 1 147 147 U H5 H 1 5.3197 . . . . . . A 337 U H5 . 25571 1 659 . 1 1 147 147 U H6 H 1 7.3897 . . . . . . A 337 U H6 . 25571 1 660 . 1 1 148 148 G H1' H 1 5.8022 . . . . . . A 338 G H1' . 25571 1 661 . 1 1 148 148 G H2' H 1 4.7356 . . . . . . A 338 G H2' . 25571 1 662 . 1 1 148 148 G H3' H 1 4.5385 . . . . . . A 338 G H3' . 25571 1 663 . 1 1 148 148 G H8 H 1 7.836 . . . . . . A 338 G H8 . 25571 1 664 . 1 1 149 149 G H1' H 1 5.7554 . . . . . . A 339 G H1' . 25571 1 665 . 1 1 149 149 G H2' H 1 4.7149 . . . . . . A 339 G H2' . 25571 1 666 . 1 1 149 149 G H3' H 1 4.4548 . . . . . . A 339 G H3' . 25571 1 667 . 1 1 149 149 G H8 H 1 7.2599 . . . . . . A 339 G H8 . 25571 1 668 . 1 1 150 150 G H1' H 1 5.7989 . . . . . . A 340 G H1' . 25571 1 669 . 1 1 150 150 G H2' H 1 4.6399 . . . . . . A 340 G H2' . 25571 1 670 . 1 1 150 150 G H3' H 1 4.4472 . . . . . . A 340 G H3' . 25571 1 671 . 1 1 150 150 G H8 H 1 7.2136 . . . . . . A 340 G H8 . 25571 1 672 . 1 1 151 151 U H1' H 1 5.6554 . . . . . . A 341 U H1' . 25571 1 673 . 1 1 151 151 U H2' H 1 4.4575 . . . . . . A 341 U H2' . 25571 1 674 . 1 1 151 151 U H3' H 1 4.5492 . . . . . . A 341 U H3' . 25571 1 675 . 1 1 151 151 U H5 H 1 5.4471 . . . . . . A 341 U H5 . 25571 1 676 . 1 1 151 151 U H6 H 1 7.6518 . . . . . . A 341 U H6 . 25571 1 677 . 1 1 152 152 G H1' H 1 5.8199 . . . . . . A 342 G H1' . 25571 1 678 . 1 1 152 152 G H2' H 1 4.7184 . . . . . . A 342 G H2' . 25571 1 679 . 1 1 152 152 G H3' H 1 4.3899 . . . . . . A 342 G H3' . 25571 1 680 . 1 1 152 152 G H8 H 1 7.8378 . . . . . . A 342 G H8 . 25571 1 681 . 1 1 153 153 C H1' H 1 5.48 . . . . . . A 343 C H1' . 25571 1 682 . 1 1 153 153 C H2' H 1 4.3212 . . . . . . A 343 C H2' . 25571 1 683 . 1 1 153 153 C H3' H 1 4.4516 . . . . . . A 343 C H3' . 25571 1 684 . 1 1 153 153 C H5 H 1 5.3313 . . . . . . A 343 C H5 . 25571 1 685 . 1 1 153 153 C H6 H 1 7.6731 . . . . . . A 343 C H6 . 25571 1 686 . 1 1 154 154 C H1' H 1 5.6001 . . . . . . A 344 C H1' . 25571 1 687 . 1 1 154 154 C H2' H 1 4.381 . . . . . . A 344 C H2' . 25571 1 688 . 1 1 154 154 C H3' H 1 4.319 . . . . . . A 344 C H3' . 25571 1 689 . 1 1 154 154 C H5 H 1 5.4573 . . . . . . A 344 C H5 . 25571 1 690 . 1 1 154 154 C H6 H 1 7.6779 . . . . . . A 344 C H6 . 25571 1 691 . 1 1 155 155 C H1' H 1 5.6998 . . . . . . A 345 C H1' . 25571 1 692 . 1 1 155 155 C H2' H 1 3.9363 . . . . . . A 345 C H2' . 25571 1 693 . 1 1 155 155 C H3' H 1 4.1483 . . . . . . A 345 C H3' . 25571 1 694 . 1 1 155 155 C H5 H 1 5.656 . . . . . . A 345 C H5 . 25571 1 695 . 1 1 155 155 C H6 H 1 7.7138 . . . . . . A 345 C H6 . 25571 1 stop_ save_