data_18902 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 18902 _Entry.Title ; Solution structure of the major G-quadruplex formed in the human VEGF promoter: Insights into loop interactions of the parallel G-quadruplexes ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2012-12-14 _Entry.Accession_date 2012-12-14 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Prashansa Agrawal . . . 18902 2 Emmanuel Hatzakis . . . 18902 3 Kexiao Guo . . . 18902 4 Megan Carver . . . 18902 5 Danzhou Yang . . . 18902 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 18902 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'anticancer drug target' . 18902 'loop interactions' . 18902 'NMR structure' . 18902 'parallel structure' . 18902 'VEGF promoter G-quadruplex' . 18902 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 18902 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 202 18902 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2013-12-11 2012-12-14 update BMRB 'update entry citation' 18902 1 . . 2013-09-16 2012-12-14 original author 'original release' 18902 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2M27 'BMRB Entry Tracking System' 18902 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 18902 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 24005038 _Citation.Full_citation . _Citation.Title 'Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 41 _Citation.Journal_issue 22 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 10584 _Citation.Page_last 10592 _Citation.Year 2013 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Prashansa Agrawal . . . 18902 1 2 Emmanuel Hatzakis . . . 18902 1 3 Kexiao Guo . . . 18902 1 4 Megan Carver . . . 18902 1 5 Danzhou Yang . . . 18902 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 18902 _Assembly.ID 1 _Assembly.Name 'major G-quadruplex' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 major_G-quadruplex 1 $major_G-quadruplex A . yes native no no . . . 18902 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_major_G-quadruplex _Entity.Sf_category entity _Entity.Sf_framecode major_G-quadruplex _Entity.Entry_ID 18902 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name major_G-quadruplex _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; CGGGGCGGGCCTTGGGCGGG GT ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6922.468 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DC . 18902 1 2 . DG . 18902 1 3 . DG . 18902 1 4 . DG . 18902 1 5 . DG . 18902 1 6 . DC . 18902 1 7 . DG . 18902 1 8 . DG . 18902 1 9 . DG . 18902 1 10 . DC . 18902 1 11 . DC . 18902 1 12 . DT . 18902 1 13 . DT . 18902 1 14 . DG . 18902 1 15 . DG . 18902 1 16 . DG . 18902 1 17 . DC . 18902 1 18 . DG . 18902 1 19 . DG . 18902 1 20 . DG . 18902 1 21 . DG . 18902 1 22 . DT . 18902 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DC 1 1 18902 1 . DG 2 2 18902 1 . DG 3 3 18902 1 . DG 4 4 18902 1 . DG 5 5 18902 1 . DC 6 6 18902 1 . DG 7 7 18902 1 . DG 8 8 18902 1 . DG 9 9 18902 1 . DC 10 10 18902 1 . DC 11 11 18902 1 . DT 12 12 18902 1 . DT 13 13 18902 1 . DG 14 14 18902 1 . DG 15 15 18902 1 . DG 16 16 18902 1 . DC 17 17 18902 1 . DG 18 18 18902 1 . DG 19 19 18902 1 . DG 20 20 18902 1 . DG 21 21 18902 1 . DT 22 22 18902 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 18902 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $major_G-quadruplex . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . . . . . . . . . 18902 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 18902 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $major_G-quadruplex . 'recombinant technology' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18902 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 18902 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 major_G-quadruplex 'natural abundance' . . 1 $major_G-quadruplex . . 0.2 . . mM . . . . 18902 1 2 H2O 'natural abundance' . . . . . . 90 . . % . . . . 18902 1 3 D2O 'natural abundance' . . . . . . 10 . . % . . . . 18902 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 18902 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 100 . mM 18902 1 pH 7.0 . pH 18902 1 pressure 1 . atm 18902 1 temperature 298 . K 18902 1 stop_ save_ ############################ # Computer software used # ############################ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 18902 _Software.ID 1 _Software.Name 'X-PLOR NIH' _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Brunger . . 18902 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'geometry optimization' 18902 1 refinement 18902 1 'structure solution' 18902 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 18902 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 18902 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 600 . . . 18902 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 18902 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 18902 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 18902 1 3 '2D 1H-1H COSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 18902 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 18902 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.2 external direct 1.0 . . . . . . . . . 18902 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 18902 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 18902 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 DC H1' H 1 5.665 . . . . . . A 1 DC H1' . 18902 1 2 . 1 1 1 1 DC H2' H 1 1.171 . . . . . . A 1 DC H2' . 18902 1 3 . 1 1 1 1 DC H2'' H 1 1.947 . . . . . . A 1 DC H2'' . 18902 1 4 . 1 1 1 1 DC H3' H 1 4.297 . . . . . . A 1 DC H3' . 18902 1 5 . 1 1 1 1 DC H4' H 1 4.225 . . . . . . A 1 DC H4' . 18902 1 6 . 1 1 1 1 DC H5 H 1 5.554 . . . . . . A 1 DC H5 . 18902 1 7 . 1 1 1 1 DC H5' H 1 3.373 . . . . . . A 1 DC H5' . 18902 1 8 . 1 1 1 1 DC H5'' H 1 3.768 . . . . . . A 1 DC H5'' . 18902 1 9 . 1 1 1 1 DC H6 H 1 7.239 . . . . . . A 1 DC H6 . 18902 1 10 . 1 1 2 2 DG H1' H 1 5.330 . . . . . . A 2 DG H1' . 18902 1 11 . 1 1 2 2 DG H2' H 1 2.477 . . . . . . A 2 DG H2' . 18902 1 12 . 1 1 2 2 DG H2'' H 1 2.508 . . . . . . A 2 DG H2'' . 18902 1 13 . 1 1 2 2 DG H3' H 1 4.753 . . . . . . A 2 DG H3' . 18902 1 14 . 1 1 2 2 DG H4' H 1 4.441 . . . . . . A 2 DG H4' . 18902 1 15 . 1 1 2 2 DG H5' H 1 3.777 . . . . . . A 2 DG H5' . 18902 1 16 . 1 1 2 2 DG H5'' H 1 4.068 . . . . . . A 2 DG H5'' . 18902 1 17 . 1 1 2 2 DG H8 H 1 7.567 . . . . . . A 2 DG H8 . 18902 1 18 . 1 1 3 3 DG H1 H 1 11.694 . . . . . . A 3 DG H1 . 18902 1 19 . 1 1 3 3 DG H1' H 1 6.055 . . . . . . A 3 DG H1' . 18902 1 20 . 1 1 3 3 DG H2' H 1 2.762 . . . . . . A 3 DG H2' . 18902 1 21 . 1 1 3 3 DG H2'' H 1 2.979 . . . . . . A 3 DG H2'' . 18902 1 22 . 1 1 3 3 DG H3' H 1 4.968 . . . . . . A 3 DG H3' . 18902 1 23 . 1 1 3 3 DG H4' H 1 4.401 . . . . . . A 3 DG H4' . 18902 1 24 . 1 1 3 3 DG H5' H 1 4.030 . . . . . . A 3 DG H5' . 18902 1 25 . 1 1 3 3 DG H5'' H 1 4.239 . . . . . . A 3 DG H5'' . 18902 1 26 . 1 1 3 3 DG H8 H 1 7.998 . . . . . . A 3 DG H8 . 18902 1 27 . 1 1 4 4 DG H1 H 1 11.188 . . . . . . A 4 DG H1 . 18902 1 28 . 1 1 4 4 DG H1' H 1 6.111 . . . . . . A 4 DG H1' . 18902 1 29 . 1 1 4 4 DG H2' H 1 2.583 . . . . . . A 4 DG H2' . 18902 1 30 . 1 1 4 4 DG H2'' H 1 2.879 . . . . . . A 4 DG H2'' . 18902 1 31 . 1 1 4 4 DG H3' H 1 4.957 . . . . . . A 4 DG H3' . 18902 1 32 . 1 1 4 4 DG H4' H 1 4.493 . . . . . . A 4 DG H4' . 18902 1 33 . 1 1 4 4 DG H5' H 1 4.232 . . . . . . A 4 DG H5' . 18902 1 34 . 1 1 4 4 DG H5'' H 1 4.264 . . . . . . A 4 DG H5'' . 18902 1 35 . 1 1 4 4 DG H8 H 1 7.673 . . . . . . A 4 DG H8 . 18902 1 36 . 1 1 5 5 DG H1 H 1 11.006 . . . . . . A 5 DG H1 . 18902 1 37 . 1 1 5 5 DG H1' H 1 6.362 . . . . . . A 5 DG H1' . 18902 1 38 . 1 1 5 5 DG H2' H 1 2.626 . . . . . . A 5 DG H2' . 18902 1 39 . 1 1 5 5 DG H2'' H 1 2.493 . . . . . . A 5 DG H2'' . 18902 1 40 . 1 1 5 5 DG H3' H 1 5.027 . . . . . . A 5 DG H3' . 18902 1 41 . 1 1 5 5 DG H4' H 1 4.559 . . . . . . A 5 DG H4' . 18902 1 42 . 1 1 5 5 DG H5' H 1 4.358 . . . . . . A 5 DG H5' . 18902 1 43 . 1 1 5 5 DG H5'' H 1 4.220 . . . . . . A 5 DG H5'' . 18902 1 44 . 1 1 5 5 DG H8 H 1 7.716 . . . . . . A 5 DG H8 . 18902 1 45 . 1 1 6 6 DC H1' H 1 6.393 . . . . . . A 6 DC H1' . 18902 1 46 . 1 1 6 6 DC H2' H 1 2.330 . . . . . . A 6 DC H2' . 18902 1 47 . 1 1 6 6 DC H2'' H 1 2.646 . . . . . . A 6 DC H2'' . 18902 1 48 . 1 1 6 6 DC H3' H 1 4.962 . . . . . . A 6 DC H3' . 18902 1 49 . 1 1 6 6 DC H4' H 1 4.507 . . . . . . A 6 DC H4' . 18902 1 50 . 1 1 6 6 DC H5 H 1 6.090 . . . . . . A 6 DC H5 . 18902 1 51 . 1 1 6 6 DC H5' H 1 4.218 . . . . . . A 6 DC H5' . 18902 1 52 . 1 1 6 6 DC H5'' H 1 4.275 . . . . . . A 6 DC H5'' . 18902 1 53 . 1 1 6 6 DC H6 H 1 7.911 . . . . . . A 6 DC H6 . 18902 1 54 . 1 1 7 7 DG H1 H 1 11.641 . . . . . . A 7 DG H1 . 18902 1 55 . 1 1 7 7 DG H1' H 1 6.082 . . . . . . A 7 DG H1' . 18902 1 56 . 1 1 7 7 DG H2' H 1 2.413 . . . . . . A 7 DG H2' . 18902 1 57 . 1 1 7 7 DG H2'' H 1 2.864 . . . . . . A 7 DG H2'' . 18902 1 58 . 1 1 7 7 DG H3' H 1 5.096 . . . . . . A 7 DG H3' . 18902 1 59 . 1 1 7 7 DG H4' H 1 4.394 . . . . . . A 7 DG H4' . 18902 1 60 . 1 1 7 7 DG H5' H 1 4.181 . . . . . . A 7 DG H5' . 18902 1 61 . 1 1 7 7 DG H5'' H 1 4.283 . . . . . . A 7 DG H5'' . 18902 1 62 . 1 1 7 7 DG H8 H 1 7.974 . . . . . . A 7 DG H8 . 18902 1 63 . 1 1 8 8 DG H1 H 1 11.487 . . . . . . A 8 DG H1 . 18902 1 64 . 1 1 8 8 DG H1' H 1 6.050 . . . . . . A 8 DG H1' . 18902 1 65 . 1 1 8 8 DG H2' H 1 2.638 . . . . . . A 8 DG H2' . 18902 1 66 . 1 1 8 8 DG H2'' H 1 2.804 . . . . . . A 8 DG H2'' . 18902 1 67 . 1 1 8 8 DG H3' H 1 4.998 . . . . . . A 8 DG H3' . 18902 1 68 . 1 1 8 8 DG H4' H 1 4.471 . . . . . . A 8 DG H4' . 18902 1 69 . 1 1 8 8 DG H5' H 1 4.237 . . . . . . A 8 DG H5' . 18902 1 70 . 1 1 8 8 DG H5'' H 1 4.313 . . . . . . A 8 DG H5'' . 18902 1 71 . 1 1 8 8 DG H8 H 1 7.937 . . . . . . A 8 DG H8 . 18902 1 72 . 1 1 9 9 DG H1 H 1 11.293 . . . . . . A 9 DG H1 . 18902 1 73 . 1 1 9 9 DG H1' H 1 6.342 . . . . . . A 9 DG H1' . 18902 1 74 . 1 1 9 9 DG H2' H 1 2.542 . . . . . . A 9 DG H2' . 18902 1 75 . 1 1 9 9 DG H2'' H 1 2.519 . . . . . . A 9 DG H2'' . 18902 1 76 . 1 1 9 9 DG H3' H 1 4.914 . . . . . . A 9 DG H3' . 18902 1 77 . 1 1 9 9 DG H4' H 1 4.405 . . . . . . A 9 DG H4' . 18902 1 78 . 1 1 9 9 DG H5' H 1 4.145 . . . . . . A 9 DG H5' . 18902 1 79 . 1 1 9 9 DG H5'' H 1 4.269 . . . . . . A 9 DG H5'' . 18902 1 80 . 1 1 9 9 DG H8 H 1 7.774 . . . . . . A 9 DG H8 . 18902 1 81 . 1 1 10 10 DC H1' H 1 6.258 . . . . . . A 10 DC H1' . 18902 1 82 . 1 1 10 10 DC H2' H 1 2.250 . . . . . . A 10 DC H2' . 18902 1 83 . 1 1 10 10 DC H2'' H 1 2.525 . . . . . . A 10 DC H2'' . 18902 1 84 . 1 1 10 10 DC H3' H 1 4.773 . . . . . . A 10 DC H3' . 18902 1 85 . 1 1 10 10 DC H4' H 1 4.407 . . . . . . A 10 DC H4' . 18902 1 86 . 1 1 10 10 DC H5 H 1 6.102 . . . . . . A 10 DC H5 . 18902 1 87 . 1 1 10 10 DC H5' H 1 3.991 . . . . . . A 10 DC H5' . 18902 1 88 . 1 1 10 10 DC H5'' H 1 4.130 . . . . . . A 10 DC H5'' . 18902 1 89 . 1 1 10 10 DC H6 H 1 7.846 . . . . . . A 10 DC H6 . 18902 1 90 . 1 1 11 11 DC H1' H 1 6.268 . . . . . . A 11 DC H1' . 18902 1 91 . 1 1 11 11 DC H2' H 1 2.303 . . . . . . A 11 DC H2' . 18902 1 92 . 1 1 11 11 DC H2'' H 1 2.564 . . . . . . A 11 DC H2'' . 18902 1 93 . 1 1 11 11 DC H3' H 1 4.810 . . . . . . A 11 DC H3' . 18902 1 94 . 1 1 11 11 DC H4' H 1 4.329 . . . . . . A 11 DC H4' . 18902 1 95 . 1 1 11 11 DC H5 H 1 6.078 . . . . . . A 11 DC H5 . 18902 1 96 . 1 1 11 11 DC H5' H 1 4.046 . . . . . . A 11 DC H5' . 18902 1 97 . 1 1 11 11 DC H5'' H 1 4.114 . . . . . . A 11 DC H5'' . 18902 1 98 . 1 1 11 11 DC H6 H 1 7.855 . . . . . . A 11 DC H6 . 18902 1 99 . 1 1 12 12 DT H1' H 1 6.275 . . . . . . A 12 DT H1' . 18902 1 100 . 1 1 12 12 DT H2' H 1 2.357 . . . . . . A 12 DT H2' . 18902 1 101 . 1 1 12 12 DT H2'' H 1 2.513 . . . . . . A 12 DT H2'' . 18902 1 102 . 1 1 12 12 DT H3' H 1 4.853 . . . . . . A 12 DT H3' . 18902 1 103 . 1 1 12 12 DT H4' H 1 4.323 . . . . . . A 12 DT H4' . 18902 1 104 . 1 1 12 12 DT H5' H 1 4.235 . . . . . . A 12 DT H5' . 18902 1 105 . 1 1 12 12 DT H5'' H 1 4.101 . . . . . . A 12 DT H5'' . 18902 1 106 . 1 1 12 12 DT H6 H 1 7.711 . . . . . . A 12 DT H6 . 18902 1 107 . 1 1 12 12 DT H71 H 1 1.872 . . . . . . A 12 DT H71 . 18902 1 108 . 1 1 12 12 DT H72 H 1 1.872 . . . . . . A 12 DT H71 . 18902 1 109 . 1 1 12 12 DT H73 H 1 1.872 . . . . . . A 12 DT H71 . 18902 1 110 . 1 1 13 13 DT H1' H 1 5.992 . . . . . . A 13 DT H1' . 18902 1 111 . 1 1 13 13 DT H2' H 1 2.210 . . . . . . A 13 DT H2' . 18902 1 112 . 1 1 13 13 DT H2'' H 1 2.386 . . . . . . A 13 DT H2'' . 18902 1 113 . 1 1 13 13 DT H3' H 1 4.858 . . . . . . A 13 DT H3' . 18902 1 114 . 1 1 13 13 DT H4' H 1 4.195 . . . . . . A 13 DT H4' . 18902 1 115 . 1 1 13 13 DT H5' H 1 3.931 . . . . . . A 13 DT H5' . 18902 1 116 . 1 1 13 13 DT H5'' H 1 4.007 . . . . . . A 13 DT H5'' . 18902 1 117 . 1 1 13 13 DT H6 H 1 7.513 . . . . . . A 13 DT H6 . 18902 1 118 . 1 1 13 13 DT H71 H 1 1.567 . . . . . . A 13 DT H71 . 18902 1 119 . 1 1 13 13 DT H72 H 1 1.567 . . . . . . A 13 DT H71 . 18902 1 120 . 1 1 13 13 DT H73 H 1 1.567 . . . . . . A 13 DT H71 . 18902 1 121 . 1 1 14 14 DG H1 H 1 11.940 . . . . . . A 14 DG H1 . 18902 1 122 . 1 1 14 14 DG H1' H 1 6.082 . . . . . . A 14 DG H1' . 18902 1 123 . 1 1 14 14 DG H2' H 1 2.766 . . . . . . A 14 DG H2' . 18902 1 124 . 1 1 14 14 DG H2'' H 1 3.009 . . . . . . A 14 DG H2'' . 18902 1 125 . 1 1 14 14 DG H3' H 1 4.958 . . . . . . A 14 DG H3' . 18902 1 126 . 1 1 14 14 DG H4' H 1 4.391 . . . . . . A 14 DG H4' . 18902 1 127 . 1 1 14 14 DG H5' H 1 4.024 . . . . . . A 14 DG H5' . 18902 1 128 . 1 1 14 14 DG H5'' H 1 4.268 . . . . . . A 14 DG H5'' . 18902 1 129 . 1 1 14 14 DG H8 H 1 8.125 . . . . . . A 14 DG H8 . 18902 1 130 . 1 1 15 15 DG H1 H 1 11.257 . . . . . . A 15 DG H1 . 18902 1 131 . 1 1 15 15 DG H1' H 1 6.157 . . . . . . A 15 DG H1' . 18902 1 132 . 1 1 15 15 DG H2' H 1 2.669 . . . . . . A 15 DG H2' . 18902 1 133 . 1 1 15 15 DG H2'' H 1 2.888 . . . . . . A 15 DG H2'' . 18902 1 134 . 1 1 15 15 DG H3' H 1 4.954 . . . . . . A 15 DG H3' . 18902 1 135 . 1 1 15 15 DG H4' H 1 4.515 . . . . . . A 15 DG H4' . 18902 1 136 . 1 1 15 15 DG H5' H 1 4.157 . . . . . . A 15 DG H5' . 18902 1 137 . 1 1 15 15 DG H5'' H 1 4.282 . . . . . . A 15 DG H5'' . 18902 1 138 . 1 1 15 15 DG H8 H 1 7.771 . . . . . . A 15 DG H8 . 18902 1 139 . 1 1 16 16 DG H1 H 1 11.030 . . . . . . A 16 DG H1 . 18902 1 140 . 1 1 16 16 DG H1' H 1 6.393 . . . . . . A 16 DG H1' . 18902 1 141 . 1 1 16 16 DG H2' H 1 2.601 . . . . . . A 16 DG H2' . 18902 1 142 . 1 1 16 16 DG H2'' H 1 2.525 . . . . . . A 16 DG H2'' . 18902 1 143 . 1 1 16 16 DG H3' H 1 5.031 . . . . . . A 16 DG H3' . 18902 1 144 . 1 1 16 16 DG H4' H 1 4.578 . . . . . . A 16 DG H4' . 18902 1 145 . 1 1 16 16 DG H5' H 1 4.222 . . . . . . A 16 DG H5' . 18902 1 146 . 1 1 16 16 DG H5'' H 1 4.335 . . . . . . A 16 DG H5'' . 18902 1 147 . 1 1 16 16 DG H8 H 1 7.748 . . . . . . A 16 DG H8 . 18902 1 148 . 1 1 17 17 DC H1' H 1 6.417 . . . . . . A 17 DC H1' . 18902 1 149 . 1 1 17 17 DC H2' H 1 2.332 . . . . . . A 17 DC H2' . 18902 1 150 . 1 1 17 17 DC H2'' H 1 2.671 . . . . . . A 17 DC H2'' . 18902 1 151 . 1 1 17 17 DC H3' H 1 5.029 . . . . . . A 17 DC H3' . 18902 1 152 . 1 1 17 17 DC H4' H 1 4.561 . . . . . . A 17 DC H4' . 18902 1 153 . 1 1 17 17 DC H5 H 1 6.106 . . . . . . A 17 DC H5 . 18902 1 154 . 1 1 17 17 DC H5' H 1 4.223 . . . . . . A 17 DC H5' . 18902 1 155 . 1 1 17 17 DC H5'' H 1 4.301 . . . . . . A 17 DC H5'' . 18902 1 156 . 1 1 17 17 DC H6 H 1 7.936 . . . . . . A 17 DC H6 . 18902 1 157 . 1 1 18 18 DG H1 H 1 11.155 . . . . . . A 18 DG H1 . 18902 1 158 . 1 1 18 18 DG H1' H 1 6.070 . . . . . . A 18 DG H1' . 18902 1 159 . 1 1 18 18 DG H2' H 1 2.347 . . . . . . A 18 DG H2' . 18902 1 160 . 1 1 18 18 DG H2'' H 1 2.812 . . . . . . A 18 DG H2'' . 18902 1 161 . 1 1 18 18 DG H3' H 1 5.091 . . . . . . A 18 DG H3' . 18902 1 162 . 1 1 18 18 DG H4' H 1 4.397 . . . . . . A 18 DG H4' . 18902 1 163 . 1 1 18 18 DG H5' H 1 4.185 . . . . . . A 18 DG H5' . 18902 1 164 . 1 1 18 18 DG H5'' H 1 4.278 . . . . . . A 18 DG H5'' . 18902 1 165 . 1 1 18 18 DG H8 H 1 7.957 . . . . . . A 18 DG H8 . 18902 1 166 . 1 1 19 19 DG H1 H 1 11.317 . . . . . . A 19 DG H1 . 18902 1 167 . 1 1 19 19 DG H1' H 1 5.928 . . . . . . A 19 DG H1' . 18902 1 168 . 1 1 19 19 DG H2' H 1 2.620 . . . . . . A 19 DG H2' . 18902 1 169 . 1 1 19 19 DG H2'' H 1 2.620 . . . . . . A 19 DG H2'' . 18902 1 170 . 1 1 19 19 DG H3' H 1 4.999 . . . . . . A 19 DG H3' . 18902 1 171 . 1 1 19 19 DG H4' H 1 4.446 . . . . . . A 19 DG H4' . 18902 1 172 . 1 1 19 19 DG H5' H 1 4.128 . . . . . . A 19 DG H5' . 18902 1 173 . 1 1 19 19 DG H5'' H 1 4.186 . . . . . . A 19 DG H5'' . 18902 1 174 . 1 1 19 19 DG H8 H 1 7.900 . . . . . . A 19 DG H8 . 18902 1 175 . 1 1 20 20 DG H1 H 1 10.968 . . . . . . A 20 DG H1 . 18902 1 176 . 1 1 20 20 DG H1' H 1 5.972 . . . . . . A 20 DG H1' . 18902 1 177 . 1 1 20 20 DG H2' H 1 2.342 . . . . . . A 20 DG H2' . 18902 1 178 . 1 1 20 20 DG H2'' H 1 2.715 . . . . . . A 20 DG H2'' . 18902 1 179 . 1 1 20 20 DG H3' H 1 4.870 . . . . . . A 20 DG H3' . 18902 1 180 . 1 1 20 20 DG H4' H 1 4.418 . . . . . . A 20 DG H4' . 18902 1 181 . 1 1 20 20 DG H5' H 1 4.125 . . . . . . A 20 DG H5' . 18902 1 182 . 1 1 20 20 DG H5'' H 1 4.199 . . . . . . A 20 DG H5'' . 18902 1 183 . 1 1 20 20 DG H8 H 1 7.420 . . . . . . A 20 DG H8 . 18902 1 184 . 1 1 21 21 DG H1' H 1 5.604 . . . . . . A 21 DG H1' . 18902 1 185 . 1 1 21 21 DG H2' H 1 2.257 . . . . . . A 21 DG H2' . 18902 1 186 . 1 1 21 21 DG H2'' H 1 2.360 . . . . . . A 21 DG H2'' . 18902 1 187 . 1 1 21 21 DG H3' H 1 4.726 . . . . . . A 21 DG H3' . 18902 1 188 . 1 1 21 21 DG H4' H 1 4.424 . . . . . . A 21 DG H4' . 18902 1 189 . 1 1 21 21 DG H5' H 1 4.117 . . . . . . A 21 DG H5' . 18902 1 190 . 1 1 21 21 DG H5'' H 1 4.188 . . . . . . A 21 DG H5'' . 18902 1 191 . 1 1 21 21 DG H8 H 1 7.628 . . . . . . A 21 DG H8 . 18902 1 192 . 1 1 22 22 DT H1' H 1 5.826 . . . . . . A 22 DT H1' . 18902 1 193 . 1 1 22 22 DT H2' H 1 1.972 . . . . . . A 22 DT H2' . 18902 1 194 . 1 1 22 22 DT H2'' H 1 2.017 . . . . . . A 22 DT H2'' . 18902 1 195 . 1 1 22 22 DT H3' H 1 4.306 . . . . . . A 22 DT H3' . 18902 1 196 . 1 1 22 22 DT H4' H 1 3.922 . . . . . . A 22 DT H4' . 18902 1 197 . 1 1 22 22 DT H5' H 1 3.655 . . . . . . A 22 DT H5' . 18902 1 198 . 1 1 22 22 DT H5'' H 1 3.829 . . . . . . A 22 DT H5'' . 18902 1 199 . 1 1 22 22 DT H6 H 1 7.180 . . . . . . A 22 DT H6 . 18902 1 200 . 1 1 22 22 DT H71 H 1 1.401 . . . . . . A 22 DT H71 . 18902 1 201 . 1 1 22 22 DT H72 H 1 1.401 . . . . . . A 22 DT H71 . 18902 1 202 . 1 1 22 22 DT H73 H 1 1.401 . . . . . . A 22 DT H71 . 18902 1 stop_ save_