data_15857 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 15857 _Entry.Title ; NMR solution structure of the d3'-hairpin including EBS1 together with IBS1 of the group II intron Sc.ai5(gamma) ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2008-07-04 _Entry.Accession_date 2008-07-04 _Entry.Last_release_date 2009-10-13 _Entry.Original_release_date 2009-10-13 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.0.8.116 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Daniela Kruschel . . . 15857 2 Roland Sigel . 'K. O.' . 15857 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 15857 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID EBS1 . 15857 'exon binding site 1' . 15857 'group II intron' . 15857 hairpin . 15857 IBS1 . 15857 'intron binding site 1' . 15857 magnesium . 15857 'metal ion' . 15857 NMR . 15857 ribozyme . 15857 'RNA 29-mer' . 15857 'RNA 7-mer' . 15857 splicing . 15857 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 15857 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 77 15857 '15N chemical shifts' 13 15857 '1H chemical shifts' 306 15857 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2009-10-13 2008-07-04 original author . 15857 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 15856 'NMR data related to NMR solution structure of the d3'-hairpin including EBS1 of the group II intron Sc.ai5(gamma)' 15857 BMRB 15858 'NMR data related to NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)' 15857 BMRB 15859 'NMR data related to NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)' 15857 BMRB 5962 'NMR data related to solution structure of domain 5 from the ai5(gamma) group II intron' 15857 BMRB 6756 'NMR data related to solution structure of domain 6 from the ai5(gamma)group II intron' 15857 PDB 1KXK 'Crystal Structure of a RNA Molecule Containing Domain 5 and 6 of the Yeast ai5g Group II Self-splicing Intron' 15857 PDB 1R2P 'Solution structure of domain 5 from the ai5(gamma) group II intron' 15857 PDB 2AHT 'Solution structure of domain 6 from the ai5(gamma)group II intron' 15857 PDB 2K63 'NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5(gamma)' 15857 PDB 2K64 'BMRB Entry Tracking System' 15857 PDB 2K65 'NMR solution structure of the exon/intron binding site 1 (EBS1/IBS1) of the group II intron Sc.ai5(gamma)' 15857 PDB 2K66 'NMR solution structure of the d3'-stem closed by a GAAA tetraloop of the group II intron Sc.ai5(gamma)' 15857 PDB 3BWP 'Crystal structure of a self-spliced group II intron' 15857 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 15857 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title 'Solution structure of the 5'-splice site of a group II intron ribozyme' _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Not known' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Daniela Kruschel . . . 15857 1 2 Roland Sigel . 'K. O.' . 15857 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 15857 _Assembly.ID 1 _Assembly.Name 29-MER _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (29-MER)' 1 $RNA_(29-MER) A . yes native no no . . . 15857 1 2 'RNA (7-MER)' 2 $RNA_(7-MER) B . yes native no no . . . 15857 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(29-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(29-MER) _Entity.Entry_ID 15857 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(29-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGUAUGUAUUGGCACUGA GCAUACUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 29 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation 'A15C, A17C' _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 15857 1 2 . G . 15857 1 3 . A . 15857 1 4 . G . 15857 1 5 . U . 15857 1 6 . A . 15857 1 7 . U . 15857 1 8 . G . 15857 1 9 . U . 15857 1 10 . A . 15857 1 11 . U . 15857 1 12 . U . 15857 1 13 . G . 15857 1 14 . G . 15857 1 15 . C . 15857 1 16 . A . 15857 1 17 . C . 15857 1 18 . U . 15857 1 19 . G . 15857 1 20 . A . 15857 1 21 . G . 15857 1 22 . C . 15857 1 23 . A . 15857 1 24 . U . 15857 1 25 . A . 15857 1 26 . C . 15857 1 27 . U . 15857 1 28 . C . 15857 1 29 . C . 15857 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 15857 1 . G 2 2 15857 1 . A 3 3 15857 1 . G 4 4 15857 1 . U 5 5 15857 1 . A 6 6 15857 1 . U 7 7 15857 1 . G 8 8 15857 1 . U 9 9 15857 1 . A 10 10 15857 1 . U 11 11 15857 1 . U 12 12 15857 1 . G 13 13 15857 1 . G 14 14 15857 1 . C 15 15 15857 1 . A 16 16 15857 1 . C 17 17 15857 1 . U 18 18 15857 1 . G 19 19 15857 1 . A 20 20 15857 1 . G 21 21 15857 1 . C 22 22 15857 1 . A 23 23 15857 1 . U 24 24 15857 1 . A 25 25 15857 1 . C 26 26 15857 1 . U 27 27 15857 1 . C 28 28 15857 1 . C 29 29 15857 1 stop_ save_ save_RNA_(7-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(7-MER) _Entity.Entry_ID 15857 _Entity.ID 2 _Entity.BMRB_code . _Entity.Name RNA_(7-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID B _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code CAGUGUC _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 7 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation 'U61G, U63G' _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 59 C . 15857 2 2 60 A . 15857 2 3 61 G . 15857 2 4 62 U . 15857 2 5 63 G . 15857 2 6 64 U . 15857 2 7 65 C . 15857 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . C 1 1 15857 2 . A 2 2 15857 2 . G 3 3 15857 2 . U 4 4 15857 2 . G 5 5 15857 2 . U 6 6 15857 2 . C 7 7 15857 2 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 15857 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(29-MER) . 4932 organism . 'Saccharomyces cerevisiae' 'baker's yeast' . . Eukaryota Fungi Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . . 15857 1 2 2 $RNA_(7-MER) . 4932 organism . 'Saccharomyces cerevisiae' 'baker's yeast' . . Eukaryota Fungi Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . . 15857 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 15857 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(29-MER) . 'in vitro transcription' 'Saccharomyces cerevisiae' . . . Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . 'The sequence was synthesized in vitro using T7 polymerase and synthetic DNA oligonucleotides.' . . 15857 1 2 2 $RNA_(7-MER) . 'chemical synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15857 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 15857 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (29-MER)' 'natural abundance' . . 1 $RNA_(29-MER) . . 0.5-0.9 0.5 0.9 mM . . . . 15857 1 2 'RNA (7-MER)' 'natural abundance' . . 2 $RNA_(7-MER) . . 0.5-0.9 0.5 0.9 mM . . . . 15857 1 3 'potassium chloride' 'natural abundance' . . . . . . 110 . . mM . . . . 15857 1 4 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15857 1 5 MgCl2 'natural abundance' . . . . . . 0-10 0 10 mM . . . . 15857 1 6 D2O '[U-100% 2H]' . . . . . . 100 . . % . . . . 15857 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 15857 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (29-MER)' 'natural abundance' . . 1 $RNA_(29-MER) . . 0.5-0.9 0.5 0.9 mM . . . . 15857 2 2 'RNA (7-MER)' 'natural abundance' . . 2 $RNA_(7-MER) . . 0.5-0.9 0.5 0.9 mM . . . . 15857 2 3 'potassium chloride' 'natural abundance' . . . . . . 110 . . mM . . . . 15857 2 4 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15857 2 5 MgCl2 'natural abundance' . . . . . . 0-8 0 8 mM . . . . 15857 2 6 H2O 'natural abundance' . . . . . . 90 . . % . . . . 15857 2 7 D2O '[U-100% 2H]' . . . . . . 10 . . % . . . . 15857 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 15857 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (29-MER)' '[selectively deuterated at 3',4',5',5'',5]' . . 1 $RNA_(29-MER) . . 0.6 . . mM . . . . 15857 3 2 'RNA (7-MER)' 'natural abundance' . . 2 $RNA_(7-MER) . . 0.6 . . mM . . . . 15857 3 3 'potassium chloride' 'natural abundance' . . . . . . 110 . . mM . . . . 15857 3 4 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15857 3 5 D2O '[U-100% 2H]' . . . . . . 100 . . % . . . . 15857 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 15857 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (29-MER)' '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(29-MER) . . 0.5 . . mM . . . . 15857 4 2 'RNA (7-MER)' 'natural abundance' . . 2 $RNA_(7-MER) . . 0.5 . . mM . . . . 15857 4 3 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 15857 4 4 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15857 4 5 H2O 'natural abundance' . . . . . . 90 . . % . . . . 15857 4 6 D2O '[U-100% 2H]' . . . . . . 10 . . % . . . . 15857 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 15857 _Sample.ID 5 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (29-MER)' '[U-100% 13C; U-100% 15N]' . . 1 $RNA_(29-MER) . . 0.5 . . mM . . . . 15857 5 2 'RNA (7-MER)' 'natural abundance' . . 2 $RNA_(7-MER) . . 0.5 . . mM . . . . 15857 5 3 'potassium chloride' 'natural abundance' . . . . . . 50 . . uM . . . . 15857 5 4 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 15857 5 5 'Pf1 phage' 'natural abundance' . . . . . . 25.6 . . mg/ml . . . . 15857 5 6 H2O 'natural abundance' . . . . . . 90 . . % . . . . 15857 5 7 D2O '[U-100% 2H]' . . . . . . 10 . . % . . . . 15857 5 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 115 5 mM 15857 1 pD 6.8 . pH 15857 1 pressure 1 . atm 15857 1 temperature 288 . K 15857 1 stop_ save_ save_sample_conditions_5 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_5 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 115 5 mM 15857 2 pD 6.8 . pH 15857 2 pressure 1 . atm 15857 2 temperature 293 . K 15857 2 stop_ save_ save_sample_conditions_6 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_6 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 3 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 115 5 mM 15857 3 pD 6.8 . pH 15857 3 pressure 1 . atm 15857 3 temperature 298 . K 15857 3 stop_ save_ save_sample_conditions_7 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_7 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 4 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 1105 5 mM 15857 4 pD 6.8 . pH 15857 4 pressure 1 . atm 15857 4 temperature 303 . K 15857 4 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 5 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 114 4 mM 15857 5 pH 6.65 0.15 pH 15857 5 pressure 1 . atm 15857 5 temperature 278 . K 15857 5 stop_ save_ save_sample_conditions_8 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_8 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 6 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 114 4 mM 15857 6 pH 6.65 0.15 pH 15857 6 pressure 1 . atm 15857 6 temperature 293 . K 15857 6 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 7 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 110 . mM 15857 7 pD 6.6 . pH 15857 7 pressure 1 . atm 15857 7 temperature 298 . K 15857 7 stop_ save_ save_sample_conditions_4 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_4 _Sample_condition_list.Entry_ID 15857 _Sample_condition_list.ID 8 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 15857 8 pH 6.6 . pH 15857 8 pressure 1 . atm 15857 8 temperature 278 . K 15857 8 stop_ save_ ############################ # Computer software used # ############################ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 15857 _Software.ID 1 _Software.Name TOPSPIN _Software.Version '1.3, 2.0, 2.1' _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 15857 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 15857 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 15857 _Software.ID 2 _Software.Name SPARKY _Software.Version 3.1 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 15857 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 15857 2 'data analysis' 15857 2 'peak picking' 15857 2 stop_ save_ save_DYANA _Software.Sf_category software _Software.Sf_framecode DYANA _Software.Entry_ID 15857 _Software.ID 3 _Software.Name DYANA _Software.Version 1.5 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Braun and Wuthrich' . . 15857 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 15857 3 stop_ save_ save_CNSSOLVE _Software.Sf_category software _Software.Sf_framecode CNSSOLVE _Software.Entry_ID 15857 _Software.ID 4 _Software.Name CNSSOLVE _Software.Version 1.2 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 15857 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 15857 4 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 15857 _Software.ID 5 _Software.Name 'X-PLOR NIH' _Software.Version 2.16 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 15857 5 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 15857 5 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 15857 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details 'equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil' _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 15857 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 700 'equipped with a CRYO TXI (1H; 13C; 15N) with an actively shielded z-gradient coil' . . 15857 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 15857 _Experiment_list.ID 1 _Experiment_list.Details 'The structure was determined with a combination of NOE and residual dipolar coupling data. In addition, magnesium titration from 0 - 10 mM MgCl2 were performed elucidating 4 specific metal ion binding sites.' loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $sample_2 isotropic . . 5 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . 3 $sample_3 isotropic . . 7 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 5 '2D 1H-13C HSQC' no . . . . . . . . . . 4 $sample_4 isotropic . . 7 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 6 '2D 1H-15N HSQC' no . . . . . . . . . . 4 $sample_4 isotropic . . 8 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 7 '2D 1H-13C HSQC' no . . . . . . . . . . 5 $sample_5 anisotropic . . 7 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 8 '2D 1H-15N HSQC' no . . . . . . . . . . 5 $sample_5 anisotropic . . 8 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 9 '2D JNN HNN-COSY' no . . . . . . . . . . 4 $sample_4 isotropic . . 8 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 10 '3D X filtered NOESY-15NHSQC' no . . . . . . . . . . 4 $sample_4 isotropic . . 8 $sample_conditions_4 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 11 '2D X filtered NOESY' no . . . . . . . . . . 4 $sample_4 isotropic . . 7 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 12 '2D X filtered TOCSY' no . . . . . . . . . . 4 $sample_4 isotropic . . 7 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 15857 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 15857 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.251449530 . . . . . . . . . 15857 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 15857 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.101329118 . . . . . . . . . 15857 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 15857 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 15857 1 3 '2D 1H-1H NOESY' . . . 15857 1 5 '2D 1H-13C HSQC' . . . 15857 1 6 '2D 1H-15N HSQC' . . . 15857 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 12.592 0.005 . 1 . . . . 1 G H1 . 15857 1 2 . 1 1 1 1 G H1' H 1 5.716 0.005 . 1 . . . . 1 G H1' . 15857 1 3 . 1 1 1 1 G H2' H 1 4.828 0.005 . 1 . . . . 1 G H2' . 15857 1 4 . 1 1 1 1 G H3' H 1 4.598 0.005 . 1 . . . . 1 G H3' . 15857 1 5 . 1 1 1 1 G H4' H 1 4.450 0.005 . 1 . . . . 1 G H4' . 15857 1 6 . 1 1 1 1 G H5' H 1 4.172 0.005 . 1 . . . . 1 G H5' . 15857 1 7 . 1 1 1 1 G H5'' H 1 4.060 0.005 . 1 . . . . 1 G H5'' . 15857 1 8 . 1 1 1 1 G H8 H 1 8.037 0.005 . 1 . . . . 1 G H8 . 15857 1 9 . 1 1 1 1 G C1' C 13 89.96 0.05 . 1 . . . . 1 G C1' . 15857 1 10 . 1 1 1 1 G C8 C 13 136.25 0.05 . 1 . . . . 1 G C8 . 15857 1 11 . 1 1 1 1 G N1 N 15 146.91 0.05 . 1 . . . . 1 G N1 . 15857 1 12 . 1 1 2 2 G H1 H 1 12.227 0.005 . 1 . . . . 2 G H1 . 15857 1 13 . 1 1 2 2 G H1' H 1 5.804 0.005 . 1 . . . . 2 G H1' . 15857 1 14 . 1 1 2 2 G H2' H 1 4.581 0.005 . 1 . . . . 2 G H2' . 15857 1 15 . 1 1 2 2 G H3' H 1 4.390 0.005 . 1 . . . . 2 G H3' . 15857 1 16 . 1 1 2 2 G H4' H 1 4.441 0.005 . 1 . . . . 2 G H4' . 15857 1 17 . 1 1 2 2 G H5' H 1 4.131 0.005 . 1 . . . . 2 G H5' . 15857 1 18 . 1 1 2 2 G H5'' H 1 4.013 0.005 . 1 . . . . 2 G H5'' . 15857 1 19 . 1 1 2 2 G H8 H 1 7.415 0.005 . 1 . . . . 2 G H8 . 15857 1 20 . 1 1 2 2 G H21 H 1 7.972 0.005 . 1 . . . . 2 G H21 . 15857 1 21 . 1 1 2 2 G H22 H 1 5.830 0.005 . 1 . . . . 2 G H22 . 15857 1 22 . 1 1 2 2 G C1' C 13 90.27 0.05 . 1 . . . . 2 G C1' . 15857 1 23 . 1 1 2 2 G C8 C 13 134.14 0.05 . 1 . . . . 2 G C8 . 15857 1 24 . 1 1 2 2 G N1 N 15 146.6 0.05 . 1 . . . . 2 G N1 . 15857 1 25 . 1 1 3 3 A H1' H 1 5.892 0.005 . 1 . . . . 3 A H1' . 15857 1 26 . 1 1 3 3 A H2 H 1 7.397 0.005 . 1 . . . . 3 A H2 . 15857 1 27 . 1 1 3 3 A H2' H 1 4.640 0.005 . 1 . . . . 3 A H2' . 15857 1 28 . 1 1 3 3 A H3' H 1 4.523 0.005 . 1 . . . . 3 A H3' . 15857 1 29 . 1 1 3 3 A H4' H 1 4.434 0.005 . 1 . . . . 3 A H4' . 15857 1 30 . 1 1 3 3 A H5' H 1 4.029 0.005 . 1 . . . . 3 A H5' . 15857 1 31 . 1 1 3 3 A H5'' H 1 3.956 0.005 . 1 . . . . 3 A H5'' . 15857 1 32 . 1 1 3 3 A H8 H 1 7.653 0.005 . 1 . . . . 3 A H8 . 15857 1 33 . 1 1 3 3 A H61 H 1 8.181 0.005 . 1 . . . . 3 A H61 . 15857 1 34 . 1 1 3 3 A H62 H 1 6.791 0.005 . 1 . . . . 3 A H62 . 15857 1 35 . 1 1 3 3 A C1' C 13 89.45 0.05 . 1 . . . . 3 A C1' . 15857 1 36 . 1 1 3 3 A C2 C 13 150.52 0.05 . 1 . . . . 3 A C2 . 15857 1 37 . 1 1 3 3 A C8 C 13 136.51 0.05 . 1 . . . . 3 A C8 . 15857 1 38 . 1 1 4 4 G H1 H 1 13.160 0.005 . 1 . . . . 4 G H1 . 15857 1 39 . 1 1 4 4 G H1' H 1 5.459 0.005 . 1 . . . . 4 G H1' . 15857 1 40 . 1 1 4 4 G H2' H 1 4.305 0.005 . 1 . . . . 4 G H2' . 15857 1 41 . 1 1 4 4 G H3' H 1 4.234 0.005 . 1 . . . . 4 G H3' . 15857 1 42 . 1 1 4 4 G H4' H 1 4.366 0.005 . 1 . . . . 4 G H4' . 15857 1 43 . 1 1 4 4 G H5' H 1 4.247 0.005 . 1 . . . . 4 G H5' . 15857 1 44 . 1 1 4 4 G H5'' H 1 3.936 0.005 . 1 . . . . 4 G H5'' . 15857 1 45 . 1 1 4 4 G H8 H 1 6.968 0.005 . 1 . . . . 4 G H8 . 15857 1 46 . 1 1 4 4 G H21 H 1 7.644 0.005 . 1 . . . . 4 G H21 . 15857 1 47 . 1 1 4 4 G H22 H 1 6.241 0.005 . 1 . . . . 4 G H22 . 15857 1 48 . 1 1 4 4 G C1' C 13 90.24 0.05 . 1 . . . . 4 G C1' . 15857 1 49 . 1 1 4 4 G C8 C 13 133.09 0.05 . 1 . . . . 4 G C8 . 15857 1 50 . 1 1 4 4 G N1 N 15 147.75 0.05 . 1 . . . . 4 G N1 . 15857 1 51 . 1 1 5 5 U H1' H 1 5.411 0.005 . 1 . . . . 5 U H1' . 15857 1 52 . 1 1 5 5 U H2' H 1 4.489 0.005 . 1 . . . . 5 U H2' . 15857 1 53 . 1 1 5 5 U H3 H 1 13.308 0.005 . 1 . . . . 5 U H3 . 15857 1 54 . 1 1 5 5 U H3' H 1 4.434 0.005 . 1 . . . . 5 U H3' . 15857 1 55 . 1 1 5 5 U H5 H 1 4.979 0.005 . 1 . . . . 5 U H5 . 15857 1 56 . 1 1 5 5 U H6 H 1 7.572 0.005 . 1 . . . . 5 U H6 . 15857 1 57 . 1 1 5 5 U C5 C 13 100.27 0.05 . 1 . . . . 5 U C5 . 15857 1 58 . 1 1 5 5 U C6 C 13 139.32 0.05 . 1 . . . . 5 U C6 . 15857 1 59 . 1 1 5 5 U N3 N 15 161.49 0.05 . 1 . . . . 5 U N3 . 15857 1 60 . 1 1 6 6 A H1' H 1 5.888 0.005 . 1 . . . . 6 A H1' . 15857 1 61 . 1 1 6 6 A H2 H 1 6.927 0.005 . 1 . . . . 6 A H2 . 15857 1 62 . 1 1 6 6 A H2' H 1 4.387 0.005 . 1 . . . . 6 A H2' . 15857 1 63 . 1 1 6 6 A H3' H 1 4.529 0.005 . 1 . . . . 6 A H3' . 15857 1 64 . 1 1 6 6 A H4' H 1 4.344 0.005 . 1 . . . . 6 A H4' . 15857 1 65 . 1 1 6 6 A H5' H 1 4.143 0.005 . 1 . . . . 6 A H5' . 15857 1 66 . 1 1 6 6 A H5'' H 1 4.063 0.005 . 1 . . . . 6 A H5'' . 15857 1 67 . 1 1 6 6 A H8 H 1 8.022 0.005 . 1 . . . . 6 A H8 . 15857 1 68 . 1 1 6 6 A H61 H 1 7.681 0.005 . 1 . . . . 6 A H61 . 15857 1 69 . 1 1 6 6 A H62 H 1 6.276 0.005 . 1 . . . . 6 A H62 . 15857 1 70 . 1 1 6 6 A C1' C 13 90.09 0.05 . 1 . . . . 6 A C1' . 15857 1 71 . 1 1 6 6 A C2 C 13 150.3 0.05 . 1 . . . . 6 A C2 . 15857 1 72 . 1 1 6 6 A C8 C 13 136.07 0.05 . 1 . . . . 6 A C8 . 15857 1 73 . 1 1 7 7 U H1' H 1 5.301 0.005 . 1 . . . . 7 U H1' . 15857 1 74 . 1 1 7 7 U H2' H 1 4.438 0.005 . 1 . . . . 7 U H2' . 15857 1 75 . 1 1 7 7 U H3 H 1 13.158 0.005 . 1 . . . . 7 U H3 . 15857 1 76 . 1 1 7 7 U H3' H 1 4.343 0.005 . 1 . . . . 7 U H3' . 15857 1 77 . 1 1 7 7 U H4' H 1 4.535 0.005 . 1 . . . . 7 U H4' . 15857 1 78 . 1 1 7 7 U H5 H 1 4.916 0.005 . 1 . . . . 7 U H5 . 15857 1 79 . 1 1 7 7 U H5'' H 1 3.784 0.005 . 1 . . . . 7 U H5'' . 15857 1 80 . 1 1 7 7 U H6 H 1 7.468 0.005 . 1 . . . . 7 U H6 . 15857 1 81 . 1 1 7 7 U C1' C 13 90.31 0.05 . 1 . . . . 7 U C1' . 15857 1 82 . 1 1 7 7 U C5 C 13 100.25 0.05 . 1 . . . . 7 U C5 . 15857 1 83 . 1 1 7 7 U C6 C 13 138.23 0.05 . 1 . . . . 7 U C6 . 15857 1 84 . 1 1 7 7 U N3 N 15 161.49 0.05 . 1 . . . . 7 U N3 . 15857 1 85 . 1 1 8 8 G H1 H 1 12.581 0.005 . 1 . . . . 8 G H1 . 15857 1 86 . 1 1 8 8 G H1' H 1 5.598 0.005 . 1 . . . . 8 G H1' . 15857 1 87 . 1 1 8 8 G H2' H 1 4.430 0.005 . 1 . . . . 8 G H2' . 15857 1 88 . 1 1 8 8 G H3' H 1 4.274 0.005 . 1 . . . . 8 G H3' . 15857 1 89 . 1 1 8 8 G H4' H 1 4.348 0.005 . 1 . . . . 8 G H4' . 15857 1 90 . 1 1 8 8 G H5'' H 1 3.990 0.005 . 1 . . . . 8 G H5'' . 15857 1 91 . 1 1 8 8 G H8 H 1 7.431 0.005 . 1 . . . . 8 G H8 . 15857 1 92 . 1 1 8 8 G H21 H 1 7.634 0.005 . 1 . . . . 8 G H21 . 15857 1 93 . 1 1 8 8 G H22 H 1 5.754 0.005 . 1 . . . . 8 G H22 . 15857 1 94 . 1 1 8 8 G C1' C 13 90.46 0.05 . 1 . . . . 8 G C1' . 15857 1 95 . 1 1 8 8 G C8 C 13 133.19 0.05 . 1 . . . . 8 G C8 . 15857 1 96 . 1 1 8 8 G N1 N 15 147.34 0.05 . 1 . . . . 8 G N1 . 15857 1 97 . 1 1 9 9 U H1' H 1 5.361 0.005 . 1 . . . . 9 U H1' . 15857 1 98 . 1 1 9 9 U H2' H 1 3.731 0.005 . 1 . . . . 9 U H2' . 15857 1 99 . 1 1 9 9 U H3 H 1 11.752 0.005 . 1 . . . . 9 U H3 . 15857 1 100 . 1 1 9 9 U H3' H 1 4.437 0.005 . 1 . . . . 9 U H3' . 15857 1 101 . 1 1 9 9 U H5 H 1 5.234 0.005 . 1 . . . . 9 U H5 . 15857 1 102 . 1 1 9 9 U H6 H 1 7.486 0.005 . 1 . . . . 9 U H6 . 15857 1 103 . 1 1 9 9 U C1' C 13 90.44 0.05 . 1 . . . . 9 U C1' . 15857 1 104 . 1 1 9 9 U C6 C 13 134.55 0.05 . 1 . . . . 9 U C6 . 15857 1 105 . 1 1 9 9 U N3 N 15 157.76 0.05 . 1 . . . . 9 U N3 . 15857 1 106 . 1 1 10 10 A H1' H 1 5.900 0.005 . 1 . . . . 10 A H1' . 15857 1 107 . 1 1 10 10 A H2 H 1 7.696 0.005 . 1 . . . . 10 A H2 . 15857 1 108 . 1 1 10 10 A H2' H 1 4.586 0.005 . 1 . . . . 10 A H2' . 15857 1 109 . 1 1 10 10 A H3' H 1 4.648 0.005 . 1 . . . . 10 A H3' . 15857 1 110 . 1 1 10 10 A H4' H 1 4.655 0.005 . 1 . . . . 10 A H4' . 15857 1 111 . 1 1 10 10 A H5' H 1 4.233 0.005 . 1 . . . . 10 A H5' . 15857 1 112 . 1 1 10 10 A H5'' H 1 4.047 0.005 . 1 . . . . 10 A H5'' . 15857 1 113 . 1 1 10 10 A H8 H 1 8.247 0.005 . 1 . . . . 10 A H8 . 15857 1 114 . 1 1 10 10 A H61 H 1 7.889 0.005 . 1 . . . . 10 A H61 . 15857 1 115 . 1 1 10 10 A H62 H 1 5.242 0.005 . 1 . . . . 10 A H62 . 15857 1 116 . 1 1 10 10 A C1' C 13 87 0.05 . 1 . . . . 10 A C1' . 15857 1 117 . 1 1 10 10 A C2 C 13 152.55 0.05 . 1 . . . . 10 A C2 . 15857 1 118 . 1 1 10 10 A C8 C 13 138.71 0.05 . 1 . . . . 10 A C8 . 15857 1 119 . 1 1 11 11 U H1' H 1 5.837 0.005 . 1 . . . . 11 U H1' . 15857 1 120 . 1 1 11 11 U H2' H 1 4.251 0.005 . 1 . . . . 11 U H2' . 15857 1 121 . 1 1 11 11 U H3' H 1 4.584 0.005 . 1 . . . . 11 U H3' . 15857 1 122 . 1 1 11 11 U H4' H 1 4.367 0.005 . 1 . . . . 11 U H4' . 15857 1 123 . 1 1 11 11 U H5 H 1 5.634 0.005 . 1 . . . . 11 U H5 . 15857 1 124 . 1 1 11 11 U H5' H 1 4.058 0.005 . 1 . . . . 11 U H5' . 15857 1 125 . 1 1 11 11 U H5'' H 1 4.015 0.005 . 1 . . . . 11 U H5'' . 15857 1 126 . 1 1 11 11 U H6 H 1 7.662 0.005 . 1 . . . . 11 U H6 . 15857 1 127 . 1 1 11 11 U C1' C 13 88.07 0.05 . 1 . . . . 11 U C1' . 15857 1 128 . 1 1 11 11 U C5 C 13 102.39 0.05 . 1 . . . . 11 U C5 . 15857 1 129 . 1 1 11 11 U C6 C 13 140.55 0.05 . 1 . . . . 11 U C6 . 15857 1 130 . 1 1 12 12 U H1' H 1 5.877 0.005 . 1 . . . . 12 U H1' . 15857 1 131 . 1 1 12 12 U H2' H 1 4.403 0.005 . 1 . . . . 12 U H2' . 15857 1 132 . 1 1 12 12 U H3' H 1 4.369 0.005 . 1 . . . . 12 U H3' . 15857 1 133 . 1 1 12 12 U H4' H 1 4.115 0.005 . 1 . . . . 12 U H4' . 15857 1 134 . 1 1 12 12 U H5 H 1 5.823 0.005 . 1 . . . . 12 U H5 . 15857 1 135 . 1 1 12 12 U H5'' H 1 3.784 0.005 . 1 . . . . 12 U H5'' . 15857 1 136 . 1 1 12 12 U H6 H 1 7.702 0.005 . 1 . . . . 12 U H6 . 15857 1 137 . 1 1 12 12 U C1' C 13 90.23 0.05 . 1 . . . . 12 U C1' . 15857 1 138 . 1 1 12 12 U C5 C 13 102.57 0.05 . 1 . . . . 12 U C5 . 15857 1 139 . 1 1 12 12 U C6 C 13 141.18 0.05 . 1 . . . . 12 U C6 . 15857 1 140 . 1 1 13 13 G H1 H 1 12.121 0.005 . 1 . . . . 13 G H1 . 15857 1 141 . 1 1 13 13 G H1' H 1 5.666 0.005 . 1 . . . . 13 G H1' . 15857 1 142 . 1 1 13 13 G H2' H 1 4.678 0.005 . 1 . . . . 13 G H2' . 15857 1 143 . 1 1 13 13 G H3' H 1 4.390 0.005 . 1 . . . . 13 G H3' . 15857 1 144 . 1 1 13 13 G H8 H 1 7.937 0.005 . 1 . . . . 13 G H8 . 15857 1 145 . 1 1 13 13 G C1' C 13 90.02 0.05 . 1 . . . . 13 G C1' . 15857 1 146 . 1 1 13 13 G C8 C 13 137.78 0.05 . 1 . . . . 13 G C8 . 15857 1 147 . 1 1 14 14 G H1 H 1 11.460 0.005 . 1 . . . . 14 G H1 . 15857 1 148 . 1 1 14 14 G H1' H 1 5.781 0.005 . 1 . . . . 14 G H1' . 15857 1 149 . 1 1 14 14 G H2' H 1 4.532 0.005 . 1 . . . . 14 G H2' . 15857 1 150 . 1 1 14 14 G H3' H 1 4.413 0.005 . 1 . . . . 14 G H3' . 15857 1 151 . 1 1 14 14 G H8 H 1 7.446 0.005 . 1 . . . . 14 G H8 . 15857 1 152 . 1 1 14 14 G H21 H 1 8.135 0.005 . 1 . . . . 14 G H21 . 15857 1 153 . 1 1 14 14 G H22 H 1 6.087 0.005 . 1 . . . . 14 G H22 . 15857 1 154 . 1 1 14 14 G C1' C 13 90.14 0.05 . 1 . . . . 14 G C1' . 15857 1 155 . 1 1 14 14 G C8 C 13 138.4 0.05 . 1 . . . . 14 G C8 . 15857 1 156 . 1 1 14 14 G N1 N 15 145.08 0.05 . 1 . . . . 14 G N1 . 15857 1 157 . 1 1 15 15 C H1' H 1 5.382 0.005 . 1 . . . . 15 C H1' . 15857 1 158 . 1 1 15 15 C H2' H 1 4.215 0.005 . 1 . . . . 15 C H2' . 15857 1 159 . 1 1 15 15 C H3' H 1 4.526 0.005 . 1 . . . . 15 C H3' . 15857 1 160 . 1 1 15 15 C H4' H 1 4.334 0.005 . 1 . . . . 15 C H4' . 15857 1 161 . 1 1 15 15 C H5 H 1 5.422 0.005 . 1 . . . . 15 C H5 . 15857 1 162 . 1 1 15 15 C H5' H 1 4.048 0.005 . 1 . . . . 15 C H5' . 15857 1 163 . 1 1 15 15 C H5'' H 1 4.027 0.005 . 1 . . . . 15 C H5'' . 15857 1 164 . 1 1 15 15 C H6 H 1 7.643 0.005 . 1 . . . . 15 C H6 . 15857 1 165 . 1 1 15 15 C H41 H 1 8.139 0.005 . 1 . . . . 15 C H41 . 15857 1 166 . 1 1 15 15 C H42 H 1 6.769 0.005 . 1 . . . . 15 C H42 . 15857 1 167 . 1 1 15 15 C C1' C 13 90.96 0.05 . 1 . . . . 15 C C1' . 15857 1 168 . 1 1 15 15 C C5 C 13 95.22 0.05 . 1 . . . . 15 C C5 . 15857 1 169 . 1 1 15 15 C C6 C 13 138.76 0.05 . 1 . . . . 15 C C6 . 15857 1 170 . 1 1 16 16 A H1' H 1 5.832 0.005 . 1 . . . . 16 A H1' . 15857 1 171 . 1 1 16 16 A H2 H 1 7.314 0.005 . 1 . . . . 16 A H2 . 15857 1 172 . 1 1 16 16 A H2' H 1 4.385 0.005 . 1 . . . . 16 A H2' . 15857 1 173 . 1 1 16 16 A H3' H 1 4.244 0.005 . 1 . . . . 16 A H3' . 15857 1 174 . 1 1 16 16 A H4' H 1 4.431 0.005 . 1 . . . . 16 A H4' . 15857 1 175 . 1 1 16 16 A H5' H 1 4.042 0.005 . 1 . . . . 16 A H5' . 15857 1 176 . 1 1 16 16 A H5'' H 1 3.928 0.005 . 1 . . . . 16 A H5'' . 15857 1 177 . 1 1 16 16 A H8 H 1 7.882 0.005 . 1 . . . . 16 A H8 . 15857 1 178 . 1 1 16 16 A C1' C 13 90.14 0.05 . 1 . . . . 16 A C1' . 15857 1 179 . 1 1 16 16 A C2 C 13 150.72 0.05 . 1 . . . . 16 A C2 . 15857 1 180 . 1 1 16 16 A C8 C 13 136.51 0.05 . 1 . . . . 16 A C8 . 15857 1 181 . 1 1 17 17 C H1' H 1 5.262 0.005 . 1 . . . . 17 C H1' . 15857 1 182 . 1 1 17 17 C H2' H 1 4.077 0.005 . 1 . . . . 17 C H2' . 15857 1 183 . 1 1 17 17 C H3' H 1 4.601 0.005 . 1 . . . . 17 C H3' . 15857 1 184 . 1 1 17 17 C H4' H 1 4.272 0.005 . 1 . . . . 17 C H4' . 15857 1 185 . 1 1 17 17 C H5 H 1 5.123 0.005 . 1 . . . . 17 C H5 . 15857 1 186 . 1 1 17 17 C H5'' H 1 3.950 0.005 . 1 . . . . 17 C H5'' . 15857 1 187 . 1 1 17 17 C H6 H 1 7.375 0.005 . 1 . . . . 17 C H6 . 15857 1 188 . 1 1 17 17 C H41 H 1 8.128 0.005 . 1 . . . . 17 C H41 . 15857 1 189 . 1 1 17 17 C H42 H 1 6.725 0.005 . 1 . . . . 17 C H42 . 15857 1 190 . 1 1 17 17 C C1' C 13 90.76 0.05 . 1 . . . . 17 C C1' . 15857 1 191 . 1 1 17 17 C C5 C 13 94.64 0.05 . 1 . . . . 17 C C5 . 15857 1 192 . 1 1 17 17 C C6 C 13 137.99 0.05 . 1 . . . . 17 C C6 . 15857 1 193 . 1 1 18 18 U H1' H 1 5.430 0.005 . 1 . . . . 18 U H1' . 15857 1 194 . 1 1 18 18 U H2' H 1 4.546 0.005 . 1 . . . . 18 U H2' . 15857 1 195 . 1 1 18 18 U H3 H 1 13.381 0.005 . 1 . . . . 18 U H3 . 15857 1 196 . 1 1 18 18 U H3' H 1 4.419 0.005 . 1 . . . . 18 U H3' . 15857 1 197 . 1 1 18 18 U H4' H 1 4.271 0.005 . 1 . . . . 18 U H4' . 15857 1 198 . 1 1 18 18 U H5 H 1 5.222 0.005 . 1 . . . . 18 U H5 . 15857 1 199 . 1 1 18 18 U H6 H 1 7.658 0.005 . 1 . . . . 18 U H6 . 15857 1 200 . 1 1 18 18 U C1' C 13 90.96 0.05 . 1 . . . . 18 U C1' . 15857 1 201 . 1 1 18 18 U C5 C 13 101.07 0.05 . 1 . . . . 18 U C5 . 15857 1 202 . 1 1 18 18 U C6 C 13 141.14 0.05 . 1 . . . . 18 U C6 . 15857 1 203 . 1 1 18 18 U N3 N 15 161.11 0.05 . 1 . . . . 18 U N3 . 15857 1 204 . 1 1 19 19 G H1 H 1 11.688 0.005 . 1 . . . . 19 G H1 . 15857 1 205 . 1 1 19 19 G H1' H 1 5.537 0.005 . 1 . . . . 19 G H1' . 15857 1 206 . 1 1 19 19 G H2' H 1 4.438 0.005 . 1 . . . . 19 G H2' . 15857 1 207 . 1 1 19 19 G H3' H 1 4.348 0.005 . 1 . . . . 19 G H3' . 15857 1 208 . 1 1 19 19 G H4' H 1 4.387 0.005 . 1 . . . . 19 G H4' . 15857 1 209 . 1 1 19 19 G H5' H 1 4.033 0.005 . 1 . . . . 19 G H5' . 15857 1 210 . 1 1 19 19 G H5'' H 1 3.984 0.005 . 1 . . . . 19 G H5'' . 15857 1 211 . 1 1 19 19 G H8 H 1 7.477 0.005 . 1 . . . . 19 G H8 . 15857 1 212 . 1 1 19 19 G H21 H 1 7.534 0.005 . 1 . . . . 19 G H21 . 15857 1 213 . 1 1 19 19 G H22 H 1 5.732 0.005 . 1 . . . . 19 G H22 . 15857 1 214 . 1 1 19 19 G C1' C 13 90 0.05 . 1 . . . . 19 G C1' . 15857 1 215 . 1 1 19 19 G C8 C 13 133.45 0.05 . 1 . . . . 19 G C8 . 15857 1 216 . 1 1 19 19 G N1 N 15 146.29 0.05 . 1 . . . . 19 G N1 . 15857 1 217 . 1 1 20 20 A H1' H 1 5.799 0.005 . 1 . . . . 20 A H1' . 15857 1 218 . 1 1 20 20 A H2 H 1 7.567 0.005 . 1 . . . . 20 A H2 . 15857 1 219 . 1 1 20 20 A H2' H 1 4.513 0.005 . 1 . . . . 20 A H2' . 15857 1 220 . 1 1 20 20 A H3' H 1 4.401 0.005 . 1 . . . . 20 A H3' . 15857 1 221 . 1 1 20 20 A H4' H 1 4.391 0.005 . 1 . . . . 20 A H4' . 15857 1 222 . 1 1 20 20 A H5'' H 1 4.011 0.005 . 1 . . . . 20 A H5'' . 15857 1 223 . 1 1 20 20 A H8 H 1 7.590 0.005 . 1 . . . . 20 A H8 . 15857 1 224 . 1 1 20 20 A H61 H 1 7.472 0.005 . 1 . . . . 20 A H61 . 15857 1 225 . 1 1 20 20 A H62 H 1 5.375 0.005 . 1 . . . . 20 A H62 . 15857 1 226 . 1 1 20 20 A C1' C 13 90.16 0.05 . 1 . . . . 20 A C1' . 15857 1 227 . 1 1 20 20 A C2 C 13 151.47 0.05 . 1 . . . . 20 A C2 . 15857 1 228 . 1 1 20 20 A C8 C 13 136.54 0.05 . 1 . . . . 20 A C8 . 15857 1 229 . 1 1 21 21 G H1 H 1 10.741 0.005 . 1 . . . . 21 G H1 . 15857 1 230 . 1 1 21 21 G H1' H 1 5.415 0.005 . 1 . . . . 21 G H1' . 15857 1 231 . 1 1 21 21 G H2' H 1 4.447 0.005 . 1 . . . . 21 G H2' . 15857 1 232 . 1 1 21 21 G H3' H 1 4.207 0.005 . 1 . . . . 21 G H3' . 15857 1 233 . 1 1 21 21 G H4' H 1 4.351 0.005 . 1 . . . . 21 G H4' . 15857 1 234 . 1 1 21 21 G H5' H 1 4.340 0.005 . 1 . . . . 21 G H5' . 15857 1 235 . 1 1 21 21 G H5'' H 1 3.968 0.005 . 1 . . . . 21 G H5'' . 15857 1 236 . 1 1 21 21 G H8 H 1 7.127 0.005 . 1 . . . . 21 G H8 . 15857 1 237 . 1 1 21 21 G H21 H 1 7.631 0.005 . 1 . . . . 21 G H21 . 15857 1 238 . 1 1 21 21 G H22 H 1 5.841 0.005 . 1 . . . . 21 G H22 . 15857 1 239 . 1 1 21 21 G C1' C 13 90.85 0.05 . 1 . . . . 21 G C1' . 15857 1 240 . 1 1 21 21 G C8 C 13 133.7 0.05 . 1 . . . . 21 G C8 . 15857 1 241 . 1 1 21 21 G N1 N 15 144.6 0.05 . 1 . . . . 21 G N1 . 15857 1 242 . 1 1 22 22 C H1' H 1 5.253 0.005 . 1 . . . . 22 C H1' . 15857 1 243 . 1 1 22 22 C H2' H 1 4.254 0.005 . 1 . . . . 22 C H2' . 15857 1 244 . 1 1 22 22 C H3' H 1 4.440 0.005 . 1 . . . . 22 C H3' . 15857 1 245 . 1 1 22 22 C H4' H 1 4.424 0.005 . 1 . . . . 22 C H4' . 15857 1 246 . 1 1 22 22 C H5 H 1 5.251 0.005 . 1 . . . . 22 C H5 . 15857 1 247 . 1 1 22 22 C H6 H 1 7.566 0.005 . 1 . . . . 22 C H6 . 15857 1 248 . 1 1 22 22 C H41 H 1 8.079 0.005 . 1 . . . . 22 C H41 . 15857 1 249 . 1 1 22 22 C H42 H 1 6.677 0.005 . 1 . . . . 22 C H42 . 15857 1 250 . 1 1 22 22 C C1' C 13 90.98 0.05 . 1 . . . . 22 c C1' . 15857 1 251 . 1 1 22 22 C C5 C 13 94.86 0.05 . 1 . . . . 22 c C5 . 15857 1 252 . 1 1 22 22 C C6 C 13 138.74 0.05 . 1 . . . . 22 c C6 . 15857 1 253 . 1 1 23 23 A H1' H 1 5.807 0.005 . 1 . . . . 23 A H1' . 15857 1 254 . 1 1 23 23 A H2 H 1 7.185 0.005 . 1 . . . . 23 A H2 . 15857 1 255 . 1 1 23 23 A H2' H 1 4.356 0.005 . 1 . . . . 23 A H2' . 15857 1 256 . 1 1 23 23 A H3' H 1 4.600 0.005 . 1 . . . . 23 A H3' . 15857 1 257 . 1 1 23 23 A H4' H 1 4.385 0.005 . 1 . . . . 23 A H4' . 15857 1 258 . 1 1 23 23 A H5'' H 1 4.027 0.005 . 1 . . . . 23 A H5'' . 15857 1 259 . 1 1 23 23 A H8 H 1 7.885 0.005 . 1 . . . . 23 A H8 . 15857 1 260 . 1 1 23 23 A H61 H 1 7.697 0.005 . 1 . . . . 23 A H61 . 15857 1 261 . 1 1 23 23 A H62 H 1 6.265 0.005 . 1 . . . . 23 A H62 . 15857 1 262 . 1 1 23 23 A C1' C 13 90.08 0.05 . 1 . . . . 23 A C1' . 15857 1 263 . 1 1 23 23 A C2 C 13 150.39 0.05 . 1 . . . . 23 A C2 . 15857 1 264 . 1 1 23 23 A C8 C 13 136.68 0.05 . 1 . . . . 23 A C8 . 15857 1 265 . 1 1 24 24 U H1' H 1 5.350 0.005 . 1 . . . . 24 U H1' . 15857 1 266 . 1 1 24 24 U H2' H 1 4.271 0.005 . 1 . . . . 24 U H2' . 15857 1 267 . 1 1 24 24 U H3 H 1 13.018 0.005 . 1 . . . . 24 U H3 . 15857 1 268 . 1 1 24 24 U H3' H 1 4.352 0.005 . 1 . . . . 24 U H3' . 15857 1 269 . 1 1 24 24 U H4' H 1 4.587 0.005 . 1 . . . . 24 U H4' . 15857 1 270 . 1 1 24 24 U H5 H 1 4.972 0.005 . 1 . . . . 24 U H5 . 15857 1 271 . 1 1 24 24 U H6 H 1 7.564 0.005 . 1 . . . . 24 U H6 . 15857 1 272 . 1 1 24 24 U C1' C 13 90.35 0.05 . 1 . . . . 24 U C1' . 15857 1 273 . 1 1 24 24 U C5 C 13 100.03 0.05 . 1 . . . . 24 U C5 . 15857 1 274 . 1 1 24 24 U C6 C 13 140.07 0.05 . 1 . . . . 24 U C6 . 15857 1 275 . 1 1 24 24 U N3 N 15 161.07 0.05 . 1 . . . . 24 U N3 . 15857 1 276 . 1 1 25 25 A H1' H 1 5.889 0.005 . 1 . . . . 25 A H1' . 15857 1 277 . 1 1 25 25 A H2 H 1 7.028 0.005 . 1 . . . . 25 A H2 . 15857 1 278 . 1 1 25 25 A H2' H 1 4.402 0.005 . 1 . . . . 25 A H2' . 15857 1 279 . 1 1 25 25 A H3' H 1 4.570 0.005 . 1 . . . . 25 A H3' . 15857 1 280 . 1 1 25 25 A H8 H 1 8.040 0.005 . 1 . . . . 25 A H8 . 15857 1 281 . 1 1 25 25 A H61 H 1 7.715 0.005 . 1 . . . . 25 A H61 . 15857 1 282 . 1 1 25 25 A H62 H 1 6.253 0.005 . 1 . . . . 25 A H62 . 15857 1 283 . 1 1 25 25 A C1' C 13 87.2 0.05 . 1 . . . . 25 A C1' . 15857 1 284 . 1 1 25 25 A C2 C 13 150.62 0.05 . 1 . . . . 25 A C2 . 15857 1 285 . 1 1 25 25 A C8 C 13 136.96 0.05 . 1 . . . . 25 A C8 . 15857 1 286 . 1 1 26 26 C H1' H 1 5.266 0.005 . 1 . . . . 26 C H1' . 15857 1 287 . 1 1 26 26 C H2' H 1 4.069 0.005 . 1 . . . . 26 C H2' . 15857 1 288 . 1 1 26 26 C H3' H 1 4.268 0.005 . 1 . . . . 26 C H3' . 15857 1 289 . 1 1 26 26 C H4' H 1 4.291 0.005 . 1 . . . . 26 C H4' . 15857 1 290 . 1 1 26 26 C H5 H 1 5.095 0.005 . 1 . . . . 26 C H5 . 15857 1 291 . 1 1 26 26 C H5'' H 1 3.964 0.005 . 1 . . . . 26 C H5'' . 15857 1 292 . 1 1 26 26 C H6 H 1 7.454 0.005 . 1 . . . . 26 C H6 . 15857 1 293 . 1 1 26 26 C H41 H 1 8.165 0.005 . 1 . . . . 26 C H41 . 15857 1 294 . 1 1 26 26 C H42 H 1 6.783 0.005 . 1 . . . . 26 C H42 . 15857 1 295 . 1 1 26 26 C C1' C 13 90.9 0.05 . 1 . . . . 26 C C1' . 15857 1 296 . 1 1 26 26 C C5 C 13 94.42 0.05 . 1 . . . . 26 C C5 . 15857 1 297 . 1 1 26 26 C C6 C 13 137.89 0.05 . 1 . . . . 26 C C6 . 15857 1 298 . 1 1 27 27 U H1' H 1 5.428 0.005 . 1 . . . . 27 U H1' . 15857 1 299 . 1 1 27 27 U H2' H 1 4.385 0.005 . 1 . . . . 27 U H2' . 15857 1 300 . 1 1 27 27 U H3 H 1 13.903 0.005 . 1 . . . . 27 U H3 . 15857 1 301 . 1 1 27 27 U H3' H 1 4.419 0.005 . 1 . . . . 27 U H3' . 15857 1 302 . 1 1 27 27 U H4' H 1 4.312 0.005 . 1 . . . . 27 U H4' . 15857 1 303 . 1 1 27 27 U H5 H 1 5.207 0.005 . 1 . . . . 27 U H5 . 15857 1 304 . 1 1 27 27 U H5'' H 1 3.971 0.005 . 1 . . . . 27 U H5'' . 15857 1 305 . 1 1 27 27 U H6 H 1 7.806 0.005 . 1 . . . . 27 U H6 . 15857 1 306 . 1 1 27 27 U C1' C 13 90.49 0.005 . 1 . . . . 27 U C1' . 15857 1 307 . 1 1 27 27 U C5 C 13 100.48 0.05 . 1 . . . . 27 U C5 . 15857 1 308 . 1 1 27 27 U C6 C 13 139.67 0.05 . 1 . . . . 27 U C6 . 15857 1 309 . 1 1 27 27 U N3 N 15 162.4 0.05 . 1 . . . . 27 U N3 . 15857 1 310 . 1 1 28 28 C H1' H 1 5.485 0.005 . 1 . . . . 28 C H1' . 15857 1 311 . 1 1 28 28 C H2' H 1 4.108 0.005 . 1 . . . . 28 C H2' . 15857 1 312 . 1 1 28 28 C H3' H 1 4.355 0.005 . 1 . . . . 28 C H3' . 15857 1 313 . 1 1 28 28 C H4' H 1 4.315 0.005 . 1 . . . . 28 C H4' . 15857 1 314 . 1 1 28 28 C H5 H 1 5.529 0.005 . 1 . . . . 28 C H5 . 15857 1 315 . 1 1 28 28 C H5'' H 1 3.962 0.005 . 1 . . . . 28 C H5'' . 15857 1 316 . 1 1 28 28 C H6 H 1 7.810 0.005 . 1 . . . . 28 C H6 . 15857 1 317 . 1 1 28 28 C H41 H 1 8.192 0.005 . 1 . . . . 28 C H41 . 15857 1 318 . 1 1 28 28 C H42 H 1 6.792 0.005 . 1 . . . . 28 C H42 . 15857 1 319 . 1 1 28 28 C C1' C 13 91.32 0.05 . 1 . . . . 28 C C1' . 15857 1 320 . 1 1 28 28 C C5 C 13 94.61 0.05 . 1 . . . . 28 C C5 . 15857 1 321 . 1 1 28 28 C C6 C 13 138.88 0.05 . 1 . . . . 28 C C6 . 15857 1 322 . 1 1 29 29 C H1' H 1 5.611 0.005 . 1 . . . . 29 C H1' . 15857 1 323 . 1 1 29 29 C H2' H 1 3.881 0.005 . 1 . . . . 29 C H2' . 15857 1 324 . 1 1 29 29 C H3' H 1 3.910 0.005 . 1 . . . . 29 C H3' . 15857 1 325 . 1 1 29 29 C H4' H 1 4.061 0.005 . 1 . . . . 29 C H4' . 15857 1 326 . 1 1 29 29 C H5 H 1 5.367 0.005 . 1 . . . . 29 C H5 . 15857 1 327 . 1 1 29 29 C H6 H 1 7.555 0.005 . 1 . . . . 29 C H6 . 15857 1 328 . 1 1 29 29 C H41 H 1 8.177 0.005 . 1 . . . . 29 C H41 . 15857 1 329 . 1 1 29 29 C H42 H 1 6.747 0.005 . 1 . . . . 29 C H42 . 15857 1 330 . 1 1 29 29 C C1' C 13 90.09 0.05 . 1 . . . . 29 C C1' . 15857 1 331 . 1 1 29 29 C C5 C 13 95.3 0.05 . 1 . . . . 29 C C5 . 15857 1 332 . 1 1 29 29 C C6 C 13 138.22 0.05 . 1 . . . . 29 C C6 . 15857 1 333 . 2 2 1 1 C H1' H 1 5.299 0.005 . 1 . . . . 59 C H1' . 15857 1 334 . 2 2 1 1 C H2' H 1 4.431 0.005 . 1 . . . . 59 C H2' . 15857 1 335 . 2 2 1 1 C H3' H 1 4.517 0.005 . 1 . . . . 59 C H3' . 15857 1 336 . 2 2 1 1 C H4' H 1 4.249 0.005 . 1 . . . . 59 C H4' . 15857 1 337 . 2 2 1 1 C H5 H 1 5.052 0.005 . 1 . . . . 59 C H5 . 15857 1 338 . 2 2 1 1 C H5' H 1 4.006 0.005 . 1 . . . . 59 C H5' . 15857 1 339 . 2 2 1 1 C H5'' H 1 3.784 0.005 . 1 . . . . 59 C H5'' . 15857 1 340 . 2 2 1 1 C H6 H 1 7.414 0.005 . 1 . . . . 59 C H6 . 15857 1 341 . 2 2 1 1 C H41 H 1 7.885 0.005 . 1 . . . . 59 C H41 . 15857 1 342 . 2 2 1 1 C H42 H 1 6.583 0.005 . 1 . . . . 59 C H42 . 15857 1 343 . 2 2 2 2 A H1' H 1 5.776 0.005 . 1 . . . . 60 A H1' . 15857 1 344 . 2 2 2 2 A H2 H 1 6.935 0.005 . 1 . . . . 60 A H2 . 15857 1 345 . 2 2 2 2 A H2' H 1 4.599 0.005 . 1 . . . . 60 A H2' . 15857 1 346 . 2 2 2 2 A H3' H 1 4.654 0.005 . 1 . . . . 60 A H3' . 15857 1 347 . 2 2 2 2 A H4' H 1 4.503 0.005 . 1 . . . . 60 A H4' . 15857 1 348 . 2 2 2 2 A H5' H 1 4.478 0.005 . 1 . . . . 60 A H5' . 15857 1 349 . 2 2 2 2 A H5'' H 1 4.099 0.005 . 1 . . . . 60 A H5'' . 15857 1 350 . 2 2 2 2 A H8 H 1 7.940 0.005 . 1 . . . . 60 A H8 . 15857 1 351 . 2 2 2 2 A H61 H 1 8.124 0.005 . 1 . . . . 60 A H61 . 15857 1 352 . 2 2 2 2 A H62 H 1 6.732 0.005 . 1 . . . . 60 A H62 . 15857 1 353 . 2 2 3 3 G H1 H 1 13.148 0.005 . 1 . . . . 61 G H1 . 15857 1 354 . 2 2 3 3 G H1' H 1 5.548 0.005 . 1 . . . . 61 G H1' . 15857 1 355 . 2 2 3 3 G H2' H 1 4.430 0.005 . 1 . . . . 61 G H2' . 15857 1 356 . 2 2 3 3 G H3' H 1 4.409 0.005 . 1 . . . . 61 G H3' . 15857 1 357 . 2 2 3 3 G H4' H 1 4.191 0.005 . 1 . . . . 61 G H4' . 15857 1 358 . 2 2 3 3 G H5'' H 1 4.015 0.005 . 1 . . . . 61 G H5'' . 15857 1 359 . 2 2 3 3 G H8 H 1 7.272 0.005 . 1 . . . . 61 G H8 . 15857 1 360 . 2 2 3 3 G H21 H 1 8.141 0.005 . 1 . . . . 61 G H21 . 15857 1 361 . 2 2 3 3 G H22 H 1 6.020 0.005 . 1 . . . . 61 G H22 . 15857 1 362 . 2 2 4 4 U H1' H 1 5.415 0.005 . 1 . . . . 62 U H1' . 15857 1 363 . 2 2 4 4 U H2' H 1 4.500 0.005 . 1 . . . . 62 U H2' . 15857 1 364 . 2 2 4 4 U H3 H 1 13.315 0.005 . 1 . . . . 62 U H3 . 15857 1 365 . 2 2 4 4 U H3' H 1 4.388 0.005 . 1 . . . . 62 U H3' . 15857 1 366 . 2 2 4 4 U H4' H 1 4.192 0.005 . 1 . . . . 62 U H4' . 15857 1 367 . 2 2 4 4 U H5 H 1 4.913 0.005 . 1 . . . . 62 U H5 . 15857 1 368 . 2 2 4 4 U H5'' H 1 3.986 0.005 . 1 . . . . 62 U H5'' . 15857 1 369 . 2 2 4 4 U H6 H 1 7.562 0.005 . 1 . . . . 62 U H6 . 15857 1 370 . 2 2 5 5 G H1 H 1 12.666 0.005 . 1 . . . . 63 G H1 . 15857 1 371 . 2 2 5 5 G H1' H 1 5.665 0.005 . 1 . . . . 63 G H1' . 15857 1 372 . 2 2 5 5 G H2' H 1 4.471 0.005 . 1 . . . . 63 G H2' . 15857 1 373 . 2 2 5 5 G H3' H 1 4.303 0.005 . 1 . . . . 63 G H3' . 15857 1 374 . 2 2 5 5 G H4' H 1 4.374 0.005 . 1 . . . . 63 G H4' . 15857 1 375 . 2 2 5 5 G H5' H 1 4.010 0.005 . 1 . . . . 63 G H5' . 15857 1 376 . 2 2 5 5 G H5'' H 1 3.963 0.005 . 1 . . . . 63 G H5'' . 15857 1 377 . 2 2 5 5 G H8 H 1 7.428 0.005 . 1 . . . . 63 G H8 . 15857 1 378 . 2 2 5 5 G H21 H 1 7.651 0.005 . 1 . . . . 63 G H21 . 15857 1 379 . 2 2 5 5 G H22 H 1 5.762 0.005 . 1 . . . . 63 G H22 . 15857 1 380 . 2 2 6 6 U H1' H 1 5.287 0.005 . 1 . . . . 64 U H1' . 15857 1 381 . 2 2 6 6 U H2' H 1 3.975 0.005 . 1 . . . . 64 U H2' . 15857 1 382 . 2 2 6 6 U H3 H 1 12.121 0.005 . 1 . . . . 64 U H3 . 15857 1 383 . 2 2 6 6 U H3' H 1 4.382 0.005 . 1 . . . . 64 U H3' . 15857 1 384 . 2 2 6 6 U H4' H 1 4.268 0.005 . 1 . . . . 64 U H4' . 15857 1 385 . 2 2 6 6 U H5 H 1 5.321 0.005 . 1 . . . . 64 U H5 . 15857 1 386 . 2 2 6 6 U H6 H 1 7.659 0.005 . 1 . . . . 64 U H6 . 15857 1 387 . 2 2 7 7 C H1' H 1 5.764 0.005 . 1 . . . . 65 C H1' . 15857 1 388 . 2 2 7 7 C H2' H 1 3.868 0.005 . 1 . . . . 65 C H2' . 15857 1 389 . 2 2 7 7 C H3' H 1 4.008 0.005 . 1 . . . . 65 C H3' . 15857 1 390 . 2 2 7 7 C H4' H 1 4.115 0.005 . 1 . . . . 65 C H4' . 15857 1 391 . 2 2 7 7 C H5 H 1 5.537 0.005 . 1 . . . . 65 C H5 . 15857 1 392 . 2 2 7 7 C H5' H 1 4.399 0.005 . 1 . . . . 65 C H5' . 15857 1 393 . 2 2 7 7 C H5'' H 1 3.922 0.005 . 1 . . . . 65 C H5'' . 15857 1 394 . 2 2 7 7 C H6 H 1 7.640 0.005 . 1 . . . . 65 C H6 . 15857 1 395 . 2 2 7 7 C H41 H 1 8.302 0.005 . 1 . . . . 65 C H41 . 15857 1 396 . 2 2 7 7 C H42 H 1 6.759 0.005 . 1 . . . . 65 C H42 . 15857 1 stop_ save_