data_25101 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; Solution NMR structure of tRNApro:MLV Nucleocapsid Protein (1:1) Complex ; _BMRB_accession_number 25101 _BMRB_flat_file_name bmr25101.str _Entry_type original _Submission_date 2014-07-19 _Accession_date 2014-07-19 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 D'Souza Victoria . . 2 Yildiz Zehra . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 4 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 250 "13C chemical shifts" 33 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2015-10-16 update BMRB 'update entry citation' 2014-09-08 original author 'original release' stop_ loop_ _Related_BMRB_accession_number _Relationship 25049 'RNA (68-MER)' 25052 'RNA (68-MER) and Nucleocapsid protein p10' 25100 'pf tRNApro:MLV-Nucleocapsid (1:2) Complex' stop_ _Original_release_date 2015-10-16 save_ ############################# # Citation for this entry # ############################# save_entry_citation _Saveframe_category entry_citation _Citation_full . _Citation_title ; A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing ; _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 25209668 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Miller Sarah B. . 2 Yildiz F. Zehra . 3 Lo Jennifer A. . 4 Wang Bo . . 5 D'Souza Victoria M. . stop_ _Journal_abbreviation Nature _Journal_volume 515 _Journal_issue 7528 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 591 _Page_last 595 _Year 2014 _Details . save_ ################################## # Molecular system description # ################################## save_assembly _Saveframe_category molecular_system _Mol_system_name 'tRNApro:MLV Nucleocapsid Protein (1:1) Complex' _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label entity_1 $entity_1 'RNA (71-MER)' $RNA_(71-MER) 'ZINC ION' $entity_ZN stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_entity_1 _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class protein _Name_common MLV_Nucleocapsid _Molecular_mass 6264.138 _Mol_thiol_state . _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 55 _Mol_residue_sequence ; ATVVSGQKQDRQGGERRRSQ LDRDQCAYCKEKGHWAKDCP KKPRGPRGPRPQTSL ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 1 ALA 2 2 THR 3 3 VAL 4 4 VAL 5 5 SER 6 6 GLY 7 7 GLN 8 8 LYS 9 9 GLN 10 10 ASP 11 11 ARG 12 12 GLN 13 13 GLY 14 14 GLY 15 15 GLU 16 16 ARG 17 17 ARG 18 18 ARG 19 19 SER 20 20 GLN 21 21 LEU 22 22 ASP 23 23 ARG 24 24 ASP 25 25 GLN 26 26 CYS 27 27 ALA 28 28 TYR 29 29 CYS 30 30 LYS 31 31 GLU 32 32 LYS 33 33 GLY 34 34 HIS 35 35 TRP 36 36 ALA 37 37 LYS 38 38 ASP 39 39 CYS 40 40 PRO 41 41 LYS 42 42 LYS 43 43 PRO 44 44 ARG 45 45 GLY 46 46 PRO 47 47 ARG 48 48 GLY 49 49 PRO 50 50 ARG 51 51 PRO 52 52 GLN 53 53 THR 54 54 SER 55 55 LEU stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date 2015-11-25 loop_ _Database_name _Database_accession_code _Database_entry_mol_name _Sequence_query_to_submitted_percentage _Sequence_subject_length _Sequence_identity _Sequence_positive _Sequence_homology_expectation_value BMRB 25052 entity_1 100.00 56 100.00 100.00 4.17e-30 BMRB 25100 MLV_Nucleocapsid 100.00 55 100.00 100.00 3.86e-30 PDB 1A6B "Nmr Structure Of The Complex Between The Zinc Finger Protein Ncp10 Of Moloney Murine Leukemia Virus And A Sequence Of The Psi-P" 72.73 40 100.00 100.00 3.29e-19 PDB 1U6P "Nmr Structure Of The Mlv Encapsidation Signal Bound To The Nucleocapsid Protein" 100.00 56 100.00 100.00 4.17e-30 PDB 1WWD "Nmr Structure Determined For Mlv Nc Complex With Rna Sequence Aacagu" 100.00 56 100.00 100.00 4.17e-30 PDB 1WWE "Nmr Structure Determined For Mlv Nc Complex With Rna Sequence Uuuugcu" 100.00 56 100.00 100.00 4.17e-30 PDB 1WWF "Nmr Structure Determined For Mlv Nc Complex With Rna Sequence Ccuccgu" 100.00 56 100.00 100.00 4.17e-30 PDB 1WWG "Nmr Structure Determined For Mlv Nc Complex With Rna Sequence Uaucug" 100.00 56 100.00 100.00 4.17e-30 PDB 2MQV "Solution Nmr Structure Of The U5-primer Binding Site (u5-pbs) Domain Of Murine Leukemia Virus Rna Genome Bound To The Retrovira" 100.00 56 100.00 100.00 4.17e-30 PDB 2MS0 "Solution Nmr Structure Pf Trnapro:mlv-nucleocapsid (1:2) Complex" 100.00 56 100.00 100.00 4.17e-30 PDB 2MS1 "Solution Nmr Structure Of Trnapro:mlv Nucleocapsid Protein (1:1) Complex" 100.00 56 100.00 100.00 4.17e-30 GB AAB59942 "gag polyprotein pr65 [Murine leukemia virus]" 100.00 538 100.00 100.00 2.04e-28 GB AAB64159 "Gag [synthetic construct]" 100.00 538 100.00 100.00 2.04e-28 GB AAC82566 "Pr65 [Moloney murine leukemia virus]" 100.00 538 100.00 100.00 2.04e-28 GB AAC82568 "Pr180 [Moloney murine leukemia virus]" 100.00 1737 100.00 100.00 4.87e-28 GB AAL69908 "gPr80 glycosylated gag polyprotein [Moloney murine leukemia virus]" 100.00 626 98.18 100.00 9.13e-28 PRF 0711245A "protein gag/pol/env" 100.00 2514 100.00 100.00 6.78e-28 REF NP_057933 "Pr180 [Moloney murine leukemia virus]" 100.00 1737 100.00 100.00 4.87e-28 REF NP_057934 "Pr65 [Moloney murine leukemia virus]" 100.00 538 100.00 100.00 2.04e-28 REF NP_955586 "p10 NC [Moloney murine leukemia virus]" 100.00 56 100.00 100.00 4.17e-30 SP P03332 "RecName: Full=Gag polyprotein; Short=Pr65gag; AltName: Full=Core polyprotein; Contains: RecName: Full=Matrix protein p15; Short" 100.00 538 100.00 100.00 2.04e-28 SP P03355 "RecName: Full=Gag-Pol polyprotein; Short=Pr180gag-pol; Contains: RecName: Full=Matrix protein p15; Short=MA; Contains: RecName:" 100.00 1738 100.00 100.00 4.88e-28 SP Q8UN02 "RecName: Full=Glycosylated Gag polyprotein; Short=Pr80gag; AltName: Full=Glyco-gag; AltName: Full=gp80gag; Contains: RecName: F" 100.00 626 98.18 100.00 9.13e-28 stop_ save_ save_RNA_(71-MER) _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common tRNApro _Molecular_mass . _Mol_thiol_state 'not present' _Details . _Residue_count 71 _Mol_residue_sequence ; GGCUCGUUGGUCUAGGGGUA UGAUUCUCGCUUAGGGUGCG AGAGGUCCCGGGUUCAAAUC CCGGACGAGCC ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 1 G 2 2 G 3 3 C 4 4 U 5 5 C 6 6 G 7 7 U 8 8 U 9 9 G 10 10 G 11 11 U 12 12 C 13 13 U 14 14 A 15 15 G 16 16 G 17 18 G 18 19 G 19 20 U 20 21 A 21 22 U 22 23 G 23 24 A 24 25 U 25 26 U 26 27 C 27 28 U 28 29 C 29 30 G 30 31 C 31 32 U 32 33 U 33 34 A 34 35 G 35 36 G 36 37 G 37 38 U 38 39 G 39 40 C 40 41 G 41 42 A 42 43 G 43 44 A 44 45 G 45 46 G 46 47 U 47 48 C 48 49 C 49 50 C 50 51 G 51 52 G 52 53 G 53 54 U 54 55 U 55 56 C 56 57 A 57 58 A 58 59 A 59 60 U 60 61 C 61 62 C 62 63 C 63 64 G 64 65 G 65 66 A 66 67 C 67 68 G 68 69 A 69 70 G 70 71 C 71 72 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ ############# # Ligands # ############# save_ZN _Saveframe_category ligand _Mol_type "non-polymer (NON-POLYMER)" _Name_common 'ZINC ION' _BMRB_code ZN _PDB_code ZN _Molecular_mass 65.409 _Mol_charge 2 _Mol_paramagnetic . _Mol_aromatic no _Details . loop_ _Atom_name _PDB_atom_name _Atom_type _Atom_chirality _Atom_charge _Atom_oxidation_number _Atom_unpaired_electrons ZN ZN ZN . 2 . ? stop_ _Mol_thiol_state . _Sequence_homology_query_date . save_ #################### # Natural source # #################### save_natural_source _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species $entity_1 'Murine Leukemia Virus' 11786 Viruses . Gammaretrovirus . $RNA_(71-MER) Human 9606 Eukaryota Metazoa Homo sapiens stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $entity_1 'recombinant technology' . Escherichia coli . pCNA $RNA_(71-MER) 'enzymatic semisynthesis' . homo sapiens . PUC19 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM 'natural abundance' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_2 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM '13C, 15N G-lab tRNA-pro' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_3 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM '13C, 15N G-lab tRNA-pro13C' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_4 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM '13C, 15N G-lab tRNA-pro' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_5 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM '13C, 15N G-lab tRNA-13C' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_6 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $entity_1 0.5 mM '13C, 15N G-lab tRNA-pro' MgCl2 1 mM 'natural abundance' NaCl 10 mM 'natural abundance' Tris 10 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_AMBER _Saveframe_category software _Name AMBER _Version . loop_ _Vendor _Address _Electronic_address 'Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 'Johnson, One Moon Scientific' . . stop_ loop_ _Task 'data analysis' stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model DMX _Field_strength 700 _Details . save_ ############################# # NMR applied experiments # ############################# save_2D_1H-15N_HSQC_1 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-15N HSQC' _Sample_label . save_ save_2D_1H-15N_HSQC_2 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-15N HSQC' _Sample_label . save_ save_2D_1H-13C_HSQC_3 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC' _Sample_label . save_ save_2D_1H-13C_HSQC_4 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC' _Sample_label . save_ save_2D_1H-13C_HSQC_5 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC' _Sample_label . save_ save_2D_1H-13C_HSQC_6 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC' _Sample_label . save_ save_2D_NOESY_7 _Saveframe_category NMR_applied_experiment _Experiment_name '2D NOESY' _Sample_label . save_ save_2D_NOESY_8 _Saveframe_category NMR_applied_experiment _Experiment_name '2D NOESY' _Sample_label . save_ save_2D_NOESY_9 _Saveframe_category NMR_applied_experiment _Experiment_name '2D NOESY' _Sample_label . save_ save_2D_NOESY_10 _Saveframe_category NMR_applied_experiment _Experiment_name '2D NOESY' _Sample_label . save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details '10mM Tris, 1mM MgCl2, 10mM NaCl' loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units pH 7.2 . pH pressure 1 . atm temperature 311 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS C 13 'methyl protons' ppm 0.00 na indirect . . . 0.251449530 DSS H 1 'methyl protons' ppm 0.00 internal direct . . . 1.000000000 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_2 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Experiment_label '2D NOESY' stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name entity_1 _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 2 2 THR HA H 4.3333125 0.0 1 2 2 2 THR HB H 4.06889666667 0.0 1 3 3 3 VAL HA H 3.89224 0.0 1 4 3 3 VAL HB H 1.801695 0.0 1 5 4 4 VAL HA H 3.93334 0.0 1 6 4 4 VAL HB H 1.83452 0.0 1 7 5 5 SER HA H 4.219625 0.0 1 8 5 5 SER HB2 H 3.700315 0.0 2 9 6 6 GLY HA2 H 3.831655 0.0 2 10 7 7 GLN HA H 4.14482 0.0 1 11 7 7 GLN HB2 H 1.7388 0.0 2 12 7 7 GLN HG2 H 2.15196666667 0.0 2 13 8 8 LYS HA H 3.15804 0.0 1 14 8 8 LYS HE2 H 2.72654 0.0 2 15 16 16 ARG HD2 H 2.86487 0.0 2 16 18 18 ARG HA H 4.04056 0.0 1 17 18 18 ARG HB2 H 1.51695 0.0 2 18 18 18 ARG HG2 H 1.35148 0.0 2 19 18 18 ARG HD2 H 2.87744 0.0 2 20 19 19 SER HA H 4.19504 0.0 1 21 19 19 SER HB2 H 3.62832 0.0 2 22 21 21 LEU HA H 4.20494 0.0 1 23 21 21 LEU HG H 1.30562 0.0 1 24 22 22 ASP HA H 4.39841 0.0 1 25 22 22 ASP HB2 H 2.63813 0.0 2 26 23 23 ARG HA H 4.11448 0.0 1 27 23 23 ARG HB2 H 1.7351 0.0 2 28 23 23 ARG HG2 H 1.6182 0.0 2 29 23 23 ARG HD2 H 3.06487 0.0 2 30 26 26 CYS HA H 4.278955 0.0 1 31 26 26 CYS HB2 H 1.850795 0.0 2 32 26 26 CYS HB3 H 2.830545 0.0 2 33 27 27 ALA HA H 3.72154333333 0.0 1 34 28 28 TYR HA H 4.264765 0.0 1 35 28 28 TYR HB2 H 2.9862 0.0 2 36 28 28 TYR HB3 H 2.2891 0.0 2 37 28 28 TYR HD1 H 7.06900684211 0.0 3 38 28 28 TYR HE1 H 6.61197642857 0.0 3 39 28 28 TYR HE2 H 6.50904 0.0 3 40 29 29 CYS HA H 4.15013 0.0 1 41 29 29 CYS HB2 H 2.89038 0.0 2 42 30 30 LYS HA H 4.16732 0.0 1 43 30 30 LYS HE2 H 2.554864 0.0 2 44 31 31 GLU HA H 4.229175 0.0 1 45 31 31 GLU HG2 H 2.22803 0.0 2 46 34 34 HIS HA H 3.596725 0.0 1 47 34 34 HIS HB2 H 3.5374 0.0 2 48 34 34 HIS HD1 H 6.9744025 0.0 1 49 34 34 HIS HE1 H 7.47655 0.0 1 50 35 35 TRP HA H 5.049285 0.0 1 51 35 35 TRP HB2 H 3.3452175 0.0 2 52 35 35 TRP HB3 H 2.93862 0.0 2 53 35 35 TRP HD1 H 6.774681 0.0 1 54 35 35 TRP HE3 H 6.970178 0.0 1 55 35 35 TRP HZ2 H 7.237385 0.0 1 56 35 35 TRP HZ3 H 6.80545375 0.0 1 57 35 35 TRP HH2 H 7.052926 0.0 1 58 37 37 LYS HA H 3.98681 0.0 1 59 37 37 LYS HG2 H 1.5813425 0.0 2 60 38 38 ASP HA H 4.78504444444 0.0 1 61 38 38 ASP HB2 H 2.83356 0.0 2 62 39 39 CYS HB2 H 3.09207 0.0 2 63 39 39 CYS HB3 H 2.94741 0.0 2 64 41 41 LYS HB2 H 1.8018 0.0 2 65 42 42 LYS HA H 3.71094 0.0 1 66 42 42 LYS HG2 H 0.69359 0.0 2 67 42 42 LYS HD2 H 1.32293 0.0 2 68 42 42 LYS HE2 H 2.48154 0.0 2 69 45 45 GLY HA2 H 3.61512333333 0.0 2 70 46 46 PRO HA H 4.33253 0.0 1 71 54 54 SER HA H 4.25746 0.0 1 72 54 54 SER HB2 H 3.65088 0.0 2 73 55 55 LEU HA H 4.22908 0.0 1 74 55 55 LEU HG H 1.386685 0.0 1 stop_ save_ save_assigned_chem_shift_list_2_dup _Saveframe_category assigned_chemical_shifts _Details . loop_ _Experiment_label '2D NOESY' stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name 'RNA (71-MER)' _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 1 1 G H1' H 5.8549 0.0 1 2 1 1 G H2' H 4.84317 0.0 1 3 1 1 G H8 H 7.964975 0.0 1 4 2 2 G H8 H 7.46028 0.0 1 5 4 4 U H1' H 5.56974 0.0 1 6 4 4 U H5 H 5.44296 0.0 1 7 4 4 U H6 H 7.887685 0.0 1 8 6 6 G H1' H 5.70555 0.0 1 9 6 6 G H8 H 7.53632 0.0 1 10 7 7 U H1' H 5.64141 0.0 1 11 7 7 U H5 H 5.81165 0.0 1 12 7 7 U H6 H 7.86766333333 0.0 1 13 8 8 U H1' H 5.83657 0.0 1 14 8 8 U H5 H 5.80571 0.0 1 15 8 8 U H6 H 7.67588 0.0 1 16 9 9 G H1' H 5.75782 0.0 1 17 9 9 G H8 H 7.158305 0.0 1 18 10 10 G H1' H 5.779725 0.0 1 19 10 10 G H8 H 7.35231333333 0.0 1 20 11 11 U H1' H 5.552715 0.0 1 21 11 11 U H5 H 5.340205 0.0 1 22 11 11 U H6 H 7.5382375 0.0 1 23 12 12 C H1' H 5.53461 0.0 1 24 12 12 C H5 H 5.448055 0.0 1 25 12 12 C H6 H 7.656918 0.0 1 26 13 13 U H1' H 5.59061 0.0 1 27 13 13 U H5 H 5.5287 0.0 1 28 13 13 U H6 H 7.821782 0.0 1 29 14 14 A H1' H 5.85543 0.0 1 30 14 14 A H2 H 8.04324 0.0 1 31 14 14 A H8 H 8.11719 0.0 1 32 15 15 G H1' H 5.63222 0.0 1 33 15 15 G H8 H 7.87216333333 0.0 1 34 18 17 G H1' H 5.381325 0.0 1 35 18 17 G H8 H 7.219695 0.0 1 36 19 18 G H8 H 7.65396 0.0 1 37 20 19 U H1' H 5.537545 0.0 1 38 20 19 U H5 H 5.4088 0.0 1 39 20 19 U H6 H 7.520655 0.0 1 40 21 20 A H1' H 5.86758 0.0 1 41 21 20 A H2 H 8.02888 0.0 1 42 21 20 A H8 H 8.19764666667 0.0 1 43 22 21 U H1' H 5.40791 0.0 1 44 22 21 U H5 H 5.41427333333 0.0 1 45 22 21 U H6 H 7.511415 0.0 1 46 24 23 A H8 H 8.19761 0.0 1 47 25 24 U H6 H 7.51847 0.0 1 48 26 25 U H1' H 5.60265 0.0 1 49 26 25 U H5 H 5.897365 0.0 1 50 26 25 U H6 H 8.0801225 0.0 1 51 27 26 C H1' H 5.62604 0.0 1 52 27 26 C H5 H 5.80499 0.0 1 53 27 26 C H6 H 8.03657333333 0.0 1 54 28 27 U H1' H 5.52756 0.0 1 55 28 27 U H5 H 5.42166 0.0 1 56 28 27 U H6 H 7.9582375 0.0 1 57 29 28 C H1' H 5.56539 0.0 1 58 29 28 C H5 H 5.65857 0.0 1 59 29 28 C H6 H 7.84813666667 0.0 1 60 30 29 G H1' H 5.671845 0.0 1 61 30 29 G H8 H 7.59902 0.0 1 62 31 30 C H1' H 5.53208 0.0 1 63 31 30 C H5 H 5.16256 0.0 1 64 31 30 C H6 H 7.46975 0.0 1 65 32 31 U H1' H 5.852635 0.0 1 66 32 31 U H6 H 7.8941 0.0 1 67 33 32 U H5 H 5.604405 0.0 1 68 33 32 U H6 H 7.746975 0.0 1 69 34 33 A H1' H 5.80995 0.0 1 70 34 33 A H2 H 8.061025 0.0 1 71 34 33 A H8 H 8.2191 0.0 1 72 35 34 G H1' H 5.73431 0.0 1 73 35 34 G H8 H 7.87415 0.0 1 74 36 35 G H1' H 5.67109 0.0 1 75 36 35 G H8 H 7.8436 0.0 1 76 37 36 G H1' H 5.80418 0.0 1 77 37 36 G H8 H 7.96688 0.0 1 78 38 37 U H1' H 5.58082 0.0 1 79 38 37 U H5 H 5.69087 0.0 1 80 38 37 U H6 H 7.713075 0.0 1 81 39 38 G H1' H 5.54674 0.0 1 82 39 38 G H8 H 7.78508 0.0 1 83 40 39 C H1' H 5.581175 0.0 1 84 40 39 C H5 H 5.30158 0.0 1 85 40 39 C H6 H 7.65534333333 0.0 1 86 41 40 G H1' H 5.754035 0.0 1 87 41 40 G H8 H 7.573215 0.0 1 88 42 41 A H1' H 5.9304 0.0 1 89 42 41 A H2 H 7.39625333333 0.0 1 90 42 41 A H8 H 7.74718 0.0 1 91 43 42 G H1' H 5.58054666667 0.0 1 92 43 42 G H8 H 7.09116 0.0 1 93 44 43 A H1' H 5.93344 0.0 1 94 44 43 A H2 H 7.67145 0.0 1 95 44 43 A H8 H 7.59865 0.0 1 96 45 44 G H1' H 5.852795 0.0 1 97 45 44 G H8 H 7.719785 0.0 1 98 46 45 G H1' H 5.76575 0.0 1 99 46 45 G H8 H 7.45647333333 0.0 1 100 48 47 C H1' H 6.09483 0.0 1 101 48 47 C H5 H 5.57618 0.0 1 102 48 47 C H6 H 7.75285 0.0 1 103 51 50 G H1' H 5.741685 0.0 1 104 51 50 G H8 H 7.23671 0.0 1 105 52 51 G H1' H 5.74222 0.0 1 106 52 51 G H8 H 7.70075 0.0 1 107 53 52 G H1' H 5.76514 0.0 1 108 53 52 G H8 H 7.146312 0.0 1 109 54 53 U H1' H 5.75039 0.0 1 110 54 53 U H5 H 5.24906 0.0 1 111 54 53 U H6 H 7.5380275 0.0 1 112 55 54 U H1' H 5.73517 0.0 1 113 55 54 U H5 H 5.72807 0.0 1 114 55 54 U H6 H 7.745795 0.0 1 115 56 55 C H1' H 5.83252 0.0 1 116 56 55 C H5 H 5.97473 0.0 1 117 56 55 C H6 H 7.91932333333 0.0 1 118 57 56 A H1' H 5.75172 0.0 1 119 57 56 A H2 H 7.98858 0.0 1 120 57 56 A H8 H 8.089726 0.0 1 121 58 57 A H1' H 6.152935 0.0 1 122 58 57 A H2 H 8.06238 0.0 1 123 58 57 A H8 H 8.46881 0.0 1 124 59 58 A H1' H 5.95892 0.0 1 125 59 58 A H2 H 7.928695 0.0 1 126 59 58 A H8 H 8.27152 0.0 1 127 60 59 U H1' H 6.01073 0.0 1 128 60 59 U H5 H 5.91826 0.0 1 129 60 59 U H6 H 7.8681525 0.0 1 130 61 60 C H1' H 5.32931 0.0 1 131 61 60 C H5 H 5.684595 0.0 1 132 61 60 C H6 H 7.790755 0.0 1 133 62 61 C H1' H 5.59603 0.0 1 134 62 61 C H5 H 5.5388 0.0 1 135 62 61 C H6 H 7.89030333333 0.0 1 136 64 63 G H1' H 5.70305 0.0 1 137 65 64 G H1' H 5.69597666667 0.0 1 138 65 64 G H8 H 7.2041 0.0 1 139 66 65 A H1' H 5.95888666667 0.0 1 140 66 65 A H2 H 7.80721 0.0 1 141 66 65 A H8 H 7.76927 0.0 1 142 67 66 C H1' H 5.470735 0.0 1 143 67 66 C H5 H 5.28384 0.0 1 144 67 66 C H6 H 7.498345 0.0 1 145 71 70 C H5 H 5.48187 0.0 1 146 71 70 C H6 H 7.65959 0.0 1 147 72 71 C H5 H 5.47057 0.0 1 148 72 71 C H6 H 7.83234 0.0 1 stop_ save_ save_assigned_chem_shift_list_2_dup_dup _Saveframe_category assigned_chemical_shifts _Details . loop_ _Experiment_label '2D NOESY' stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name 'RNA (71-MER)' _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 1 1 G C8 C 139.3 0 1 2 4 4 U C1' C 96.3 0 1 3 9 9 G C8 C 135.59 0 1 4 10 10 G C8 C 135.6 0 1 5 11 11 U C1' C 95.93 0 1 6 13 13 U C1' C 96.15 0 1 7 15 15 G C8 C 136.96 0 1 8 16 16 G C8 C 140.63 0 1 9 18 17 G C8 C 138.05 0 1 10 22 21 U C1' C 94.22 0 1 11 25 24 U C1' C 93.5 0 1 12 26 25 U C1' C 96.18 0 1 13 28 27 U C1' C 96.27 0 1 14 30 29 G C8 C 135.98 0 1 15 32 31 U C1' C 94.45 0 1 16 33 32 U C1' C 95.39 0 1 17 35 34 G C8 C 140.07 0 1 18 36 35 G C8 C 139.76 0 1 19 37 36 G C8 C 140.1 0 1 20 38 37 U C1' C 96.26 0 1 21 39 38 G C8 C 137.11 0 1 22 43 42 G C8 C 135.61 0 1 23 45 44 G C8 C 138.32 0 1 24 46 45 G C8 C 137.33 0 1 25 47 46 U C1' C 93.76 0 1 26 51 50 G C8 C 136.02 0 1 27 53 52 G C8 C 135.96 0 1 28 54 53 U C1' C 94.49 0 1 29 55 54 U C1' C 93.32 0 1 30 60 59 U C1' C 93.07 0 1 31 65 64 G C8 C 135.99 0 1 32 68 67 G C8 C 136.01 0 1 33 70 69 G C8 C 135.96 0 1 stop_ save_ save_assigned_chem_shift_list_2_dup_dup_dup _Saveframe_category assigned_chemical_shifts _Details . loop_ _Experiment_label '2D NOESY' stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name 'RNA (71-MER)' _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 6 6 G H1' H 5.55020625 0.0 1 2 6 6 G H2' H 3.53274 0.0 1 3 6 6 G H3' H 4.268976 0.0 1 4 6 6 G H5' H 3.82485 0.0 2 5 6 6 G H5'' H 4.03537 0.0 2 6 6 6 G H8 H 7.72087 0.0 1 7 7 7 U H1' H 5.78417722222 0.0 1 8 7 7 U H2' H 4.1024125 0.0 1 9 7 7 U H3' H 4.3081375 0.0 1 10 7 7 U H4' H 4.57903 0.0 1 11 7 7 U H5 H 5.84887818182 0.0 1 12 7 7 U H5' H 3.834744 0.0 2 13 7 7 U H5'' H 3.92492 0.0 2 14 7 7 U H6 H 7.76035214286 0.0 1 15 8 8 U H1' H 5.713719 0.0 1 16 8 8 U H2' H 4.061845 0.0 1 17 8 8 U H3' H 4.23449666667 0.0 1 18 8 8 U H4' H 4.23824666667 0.0 1 19 8 8 U H5 H 5.616590625 0.0 1 20 8 8 U H5' H 3.83183 0.0 2 21 8 8 U H6 H 7.5198025 0.0 1 22 9 9 G H1' H 5.286549 0.0 1 23 9 9 G H2' H 4.27899 0.0 1 24 9 9 G H3' H 4.24854 0.0 1 25 9 9 G H4' H 3.93692 0.0 1 26 9 9 G H5' H 3.80757 0.0 2 27 9 9 G H5'' H 3.89628 0.0 2 28 9 9 G H8 H 7.6518565 0.0 1 stop_ save_