data_18036 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; UNAC Tetraloops: To What Extent Can They Mimic GNRA Tetraloops ; _BMRB_accession_number 18036 _BMRB_flat_file_name bmr18036.str _Entry_type original _Submission_date 2011-11-01 _Accession_date 2011-11-01 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Zhao Q. . . 2 Huang H. . . 3 Nagaswamy U. . . 4 Xia Y. . . 5 Gao X. . . 6 Fox George E. . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 1 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 89 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2012-05-22 original author . stop_ save_ ############################# # Citation for this entry # ############################# save_entry_citation _Saveframe_category entry_citation _Citation_full . _Citation_title 'UNAC tetraloops: to what extent do they mimic GNRA tetraloops?' _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 22605553 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Zhao Qin . . 2 Huang Hung-Chung . . 3 Nagaswamy Uma . . 4 Xia Youlin . . 5 Gao Xiaolian . . 6 Fox George E. . stop_ _Journal_abbreviation Biopolymers _Journal_name_full Biopolymers _Journal_volume 97 _Journal_issue 8 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 617 _Page_last 628 _Year 2012 _Details . save_ ################################## # Molecular system description # ################################## save_assembly _Saveframe_category molecular_system _Mol_system_name 'UNAC Tetraloops' _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label UCAC $UCAC stop_ _System_molecular_weight 7093.17192 _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state 'not present' _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_UCAC _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common UCAC _Molecular_mass 7093.17192 _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 22 _Mol_residue_sequence ; GGACCCGGCUCACGCUGGGU CC ; loop_ _Residue_seq_code _Residue_label 1 G 2 G 3 A 4 C 5 C 6 C 7 G 8 G 9 C 10 U 11 C 12 A 13 C 14 G 15 C 16 U 17 G 18 G 19 G 20 U 21 C 22 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . loop_ _Database_name _Database_accession_code _Database_entry_mol_name _Sequence_query_to_submitted_percentage _Sequence_subject_length _Sequence_identity _Sequence_positive _Sequence_homology_expectation_value PDB 4A4S 4A4S . . . . . stop_ save_ #################### # Natural source # #################### save_natural_source _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species $UCAC 'Thermus thermophilus' 274 Bacteria . Thermus thermophilus stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name $UCAC 'chemical synthesis' . . . . . stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details '0.3 mM' loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $UCAC 0.3 mM '[U-13C; U-15N]' D2O 99.96 % 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_AutoDep _Saveframe_category software _Name AutoDep _Version 4.3 loop_ _Vendor _Address _Electronic_address AutoDep . . stop_ loop_ _Task 'chemical shift assignment' stop_ _Details . save_ save_CNS_software _Saveframe_category software _Name CNS _Version any loop_ _Vendor _Address _Electronic_address BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE- . . stop_ loop_ _Task 'chemical shift assignment' stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model Avance _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_experiment_1_1 _Saveframe_category NMR_applied_experiment _Experiment_name experiment_1 _Sample_label $sample_1 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details 'pH [7.0], temp [298], pressure [0.0], ionStrength [0.0]' loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units pH 7.000 . pH pressure 1 . atm temperature 298.000 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio HDO H 1 protons ppm 4.7 internal indirect . . . 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list _Saveframe_category assigned_chemical_shifts _Details 'Origin nmrStar file /ebi/msd/pdb_root/Processing/prepare/4a4s/ebi/UCAC.ppm.csh' loop_ _Experiment_label experiment_1 stop_ loop_ _Sample_label $sample_1 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name UCAC _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 1 1 G H1' H 5.545 . 1 2 1 1 G H8 H 8.039 . 1 3 2 2 G H1' H 5.181 0.008 1 4 2 2 G H8 H 7.451 . 1 5 3 3 A H1' H 5.946 0.007 1 6 3 3 A H2' H 4.511 . 1 7 3 3 A H3' H 4.460 . 1 8 3 3 A H8 H 7.866 0.002 1 9 4 4 C H1' H 5.319 0.006 1 10 4 4 C H2' H 4.262 0.012 1 11 4 4 C H3' H 4.311 0.008 1 12 4 4 C H5 H 5.179 0.005 1 13 4 4 C H6 H 7.363 0.004 1 14 5 5 C H2' H 3.888 0.003 1 15 5 5 C H5 H 5.415 0.012 1 16 5 5 C H6 H 7.722 0.015 1 17 6 6 C H1' H 5.440 . 1 18 6 6 C H2' H 4.008 0.004 1 19 6 6 C H5 H 5.431 0.004 1 20 6 6 C H6 H 7.690 0.014 1 21 7 7 G H1' H 5.652 0.001 1 22 7 7 G H2' H 4.010 . 1 23 7 7 G H3' H 4.530 0.004 1 24 7 7 G H8 H 7.438 0.005 1 25 8 8 G H1' H 5.684 0.004 1 26 8 8 G H2' H 4.355 0.005 1 27 8 8 G H3' H 4.302 . 1 28 8 8 G H4' H 4.015 . 1 29 8 8 G H8 H 7.199 0.006 1 30 9 9 C H1' H 5.570 0.843 1 31 9 9 C H2' H 4.342 0.003 1 32 9 9 C H3' H 4.472 . 1 33 9 9 C H5 H 5.046 0.009 1 34 9 9 C H6 H 7.365 0.003 1 35 10 10 U H1' H 5.515 0.003 1 36 10 10 U H2' H 4.362 0.013 1 37 10 10 U H3' H 4.742 0.001 1 38 10 10 U H5 H 5.568 0.034 1 39 10 10 U H6 H 7.513 0.008 1 40 11 11 C H1' H 5.472 0.034 1 41 11 11 C H2' H 4.281 0.013 1 42 11 11 C H3' H 4.371 . 1 43 11 11 C H5 H 5.506 . 1 44 11 11 C H6 H 7.719 0.008 1 45 12 12 A H1' H 5.752 0.009 1 46 12 12 A H2' H 4.152 0.004 1 47 12 12 A H3' H 4.241 0.003 1 48 12 12 A H4' H 4.211 0.007 1 49 12 12 A H8 H 8.153 0.004 1 50 13 13 C H1' H 5.218 . 1 51 13 13 C H2' H 4.406 0.008 1 52 13 13 C H3' H 4.450 . 1 53 13 13 C H5 H 5.248 0.005 1 54 13 13 C H6 H 7.640 0.003 1 55 14 14 G H1' H 5.006 0.123 1 56 14 14 G H2' H 4.219 . 1 57 14 14 G H3' H 4.711 0.006 1 58 14 14 G H4' H 4.265 . 1 59 14 14 G H8 H 7.817 0.007 1 60 15 15 C H1' H 5.359 0.203 1 61 15 15 C H2' H 4.260 0.003 1 62 15 15 C H5 H 5.144 0.121 1 63 15 15 C H6 H 7.528 0.004 1 64 16 16 U H1' H 5.701 . 1 65 16 16 U H2' H 4.383 0.003 1 66 16 16 U H5 H 5.645 0.01 1 67 16 16 U H6 H 7.718 0.007 1 68 17 17 G H1' H 5.707 0.009 1 69 17 17 G H2' H 4.417 . 1 70 17 17 G H3' H 4.409 . 1 71 17 17 G H8 H 7.146 0.012 1 72 18 18 G H1' H 5.681 . 1 73 18 18 G H8 H 7.857 0.004 1 74 19 19 G H1' H 5.718 0.008 1 75 19 19 G H2' H 4.425 . 1 76 19 19 G H8 H 7.575 0.002 1 77 20 20 U H1' H 5.568 . 1 78 20 20 U H2' H 4.354 0.015 1 79 20 20 U H5 H 5.027 0.005 1 80 20 20 U H6 H 7.714 0.002 1 81 21 21 C H1' H 5.430 . 1 82 21 21 C H2' H 4.360 0.007 1 83 21 21 C H5 H 5.610 0.004 1 84 21 21 C H6 H 7.816 0.005 1 85 22 22 C H1' H 5.663 0.005 1 86 22 22 C H2' H 3.900 . 1 87 22 22 C H3' H 4.132 . 1 88 22 22 C H5 H 5.528 . 1 89 22 22 C H6 H 7.624 0.007 1 stop_ save_