data_17861 ####################### # Entry information # ####################### save_entry_information _Saveframe_category entry_information _Entry_title ; high resolution NMR solution structure of helix H1 of the human HAR1F RNA ; _BMRB_accession_number 17861 _BMRB_flat_file_name bmr17861.str _Entry_type original _Submission_date 2011-08-12 _Accession_date 2011-08-12 _Entry_origination author _NMR_STAR_version 2.1.1 _Experimental_method NMR _Details . loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Cevec Mirko . . 2 Koschinat Melanie . . 3 Richter Christian . . 4 Schwalbe Harald . . stop_ loop_ _Saveframe_category_type _Saveframe_category_type_count assigned_chemical_shifts 1 stop_ loop_ _Data_type _Data_type_count "1H chemical shifts" 277 stop_ loop_ _Revision_date _Revision_keyword _Revision_author _Revision_detail 2014-04-23 original author . stop_ _Original_release_date 2014-04-23 save_ ############################# # Citation for this entry # ############################# save_entry_citation _Saveframe_category entry_citation _Citation_full . _Citation_title 'NMR studies of HAR1 RNA secondary structures reveal conformational dynamics in the human RNA.' _Citation_status published _Citation_type journal _CAS_abstract_code . _MEDLINE_UI_code . _PubMed_ID 22961937 loop_ _Author_ordinal _Author_family_name _Author_given_name _Author_middle_initials _Author_family_title 1 Ziegeler Melanie . . 2 Cevec Mirko . . 3 Richter Christian . . 4 Schwalbe Harald . . stop_ _Journal_abbreviation Chembiochem _Journal_name_full 'Chembiochem : a European journal of chemical biology' _Journal_volume 13 _Journal_issue 14 _Journal_CSD . _Book_chapter_title . _Book_volume . _Book_series . _Book_ISBN . _Conference_state_province . _Conference_abstract_number . _Page_first 2100 _Page_last 2112 _Year 2012 _Details . save_ ################################## # Molecular system description # ################################## save_assembly _Saveframe_category molecular_system _Mol_system_name 'RNA (37-MER)' _Enzyme_commission_number . loop_ _Mol_system_component_name _Mol_label 'RNA (37-MER)' $RNA_(37-MER) stop_ _System_molecular_weight . _System_physical_state native _System_oligomer_state ? _System_paramagnetic no _System_thiol_state . _Database_query_date . _Details . save_ ######################## # Monomeric polymers # ######################## save_RNA_(37-MER) _Saveframe_category monomeric_polymer _Mol_type polymer _Mol_polymer_class RNA _Name_common RNA_(37-MER) _Molecular_mass 11887.177 _Mol_thiol_state 'not present' _Details . ############################## # Polymer residue sequence # ############################## _Residue_count 37 _Mol_residue_sequence ; GGGUGAAACGGAGGACUUCG GUCCUCAAGUUUCACCC ; loop_ _Residue_seq_code _Residue_author_seq_code _Residue_label 1 1 G 2 2 G 3 3 G 4 4 U 5 5 G 6 6 A 7 7 A 8 8 A 9 9 C 10 10 G 11 11 G 12 12 A 13 13 G 14 14 G 15 15 A 16 16 C 17 17 U 18 18 U 19 19 C 20 20 G 21 21 G 22 22 U 23 23 C 24 24 C 25 25 U 26 26 C 27 27 A 28 28 A 29 29 G 30 30 U 31 31 U 32 32 U 33 33 C 34 34 A 35 35 C 36 36 C 37 37 C stop_ _Sequence_homology_query_date . _Sequence_homology_query_revised_last_date . save_ #################### # Natural source # #################### save_natural_source _Saveframe_category natural_source loop_ _Mol_label _Organism_name_common _NCBI_taxonomy_ID _Superkingdom _Kingdom _Genus _Species $RNA_(37-MER) humans 9606 Eukaryota Metazoa Homo sapiens stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Saveframe_category experimental_source loop_ _Mol_label _Production_method _Host_organism_name_common _Genus _Species _Strain _Vector_name _Details $RNA_(37-MER) 'chemical synthesis' . Escherichia coli . pUC19 'RNA was prepared by in vitro transcription using T7 RNA polymerase and DNA oligonucleotide template' stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $RNA_(37-MER) 1 mM '[U-100% 15N]' 'potassium chloride' 50 mM 'natural abundance' 'potassium phosphate' 25 mM 'natural abundance' H2O 90 % 'natural abundance' D2O 10 % 'natural abundance' stop_ save_ save_sample_2 _Saveframe_category sample _Sample_type solution _Details . loop_ _Mol_label _Concentration_value _Concentration_value_units _Isotopic_labeling $RNA_(37-MER) 1 mM '[U-100% 15N]' 'potassium chloride' 50 mM 'natural abundance' 'potassium phosphate' 25 mM 'natural abundance' D2O 100 % 'natural abundance' stop_ save_ ############################ # Computer software used # ############################ save_ARIA _Saveframe_category software _Name ARIA _Version 1.2 loop_ _Vendor _Address _Electronic_address 'Linge, O'Donoghue and Nilges' . . stop_ loop_ _Task refinement stop_ _Details . save_ save_TOPSPIN _Saveframe_category software _Name TOPSPIN _Version 2.1 loop_ _Vendor _Address _Electronic_address 'Bruker Biospin' . . stop_ loop_ _Task collection processing stop_ _Details . save_ save_SPARKY _Saveframe_category software _Name SPARKY _Version 3.113 loop_ _Vendor _Address _Electronic_address Goddard . . stop_ loop_ _Task 'data analysis' stop_ _Details . save_ save_CNS _Saveframe_category software _Name CNS _Version 1.1 loop_ _Vendor _Address _Electronic_address 'Brunger, Adams, Clore, Gros, Nilges and Read' . . stop_ loop_ _Task refinement stop_ _Details . save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model Avance _Field_strength 900 _Details . save_ save_spectrometer_2 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model Avance _Field_strength 800 _Details . save_ save_spectrometer_3 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model Avance _Field_strength 700 _Details . save_ save_spectrometer_4 _Saveframe_category NMR_spectrometer _Manufacturer Bruker _Model Avance _Field_strength 600 _Details . save_ ############################# # NMR applied experiments # ############################# save_2D_1H-15N_HSQC_1 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-15N HSQC' _Sample_label $sample_1 save_ save_2D_HNN-COSY_2 _Saveframe_category NMR_applied_experiment _Experiment_name '2D HNN-COSY' _Sample_label $sample_1 save_ save_2D_1H-1H_NOESY_3 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-1H NOESY' _Sample_label $sample_1 save_ save_3D_1H-15N_NOESY_4 _Saveframe_category NMR_applied_experiment _Experiment_name '3D 1H-15N NOESY' _Sample_label $sample_1 save_ save_2D_1H-15N_CPMG-NOESY_5 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-15N CPMG-NOESY' _Sample_label $sample_1 save_ save_2D_1H-13C_HSQC_6 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-13C HSQC' _Sample_label $sample_2 save_ save_2D_1H-1H_NOESY_7 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-1H NOESY' _Sample_label $sample_2 save_ save_2D_DQF-COSY_8 _Saveframe_category NMR_applied_experiment _Experiment_name '2D DQF-COSY' _Sample_label $sample_2 save_ save_2D_1H-1H_TOCSY_9 _Saveframe_category NMR_applied_experiment _Experiment_name '2D 1H-1H TOCSY' _Sample_label $sample_2 save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 298 . K stop_ save_ save_sample_conditions_2 _Saveframe_category sample_conditions _Details . loop_ _Variable_type _Variable_value _Variable_value_error _Variable_value_units 'ionic strength' 75 . mM pH 6.2 . pH pressure 1 . atm temperature 278 . K stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Saveframe_category chemical_shift_reference _Details . loop_ _Mol_common_name _Atom_type _Atom_isotope_number _Atom_group _Chem_shift_units _Chem_shift_value _Reference_method _Reference_type _External_reference_sample_geometry _External_reference_location _External_reference_axis _Indirect_shift_ratio DSS H 1 'methyl protons' ppm 0 external direct . . . 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Saveframe_category assigned_chemical_shifts _Details . loop_ _Experiment_label '2D 1H-1H NOESY' stop_ loop_ _Sample_label $sample_2 stop_ _Sample_conditions_label $sample_conditions_1 _Chem_shift_reference_set_label $chemical_shift_reference_1 _Mol_system_component_name 'RNA (37-MER)' _Text_data_format . _Text_data . loop_ _Atom_shift_assign_ID _Residue_author_seq_code _Residue_seq_code _Residue_label _Atom_name _Atom_type _Chem_shift_value _Chem_shift_value_error _Chem_shift_ambiguity_code 1 1 1 G H1 H 12.902 0.02 1 2 1 1 G H1' H 5.857 0.02 1 3 1 1 G H2' H 4.953 0.02 1 4 1 1 G H3' H 4.757 0.02 1 5 1 1 G H4' H 4.582 0.02 1 6 1 1 G H5' H 4.487 0.02 1 7 1 1 G H5'' H 4.308 0.02 1 8 1 1 G H8 H 8.188 0.02 1 9 2 2 G H1 H 12.902 0.02 1 10 2 2 G H1' H 5.976 0.02 1 11 2 2 G H2' H 4.763 0.02 1 12 2 2 G H3' H 4.580 0.02 1 13 2 2 G H5' H 4.521 0.02 1 14 2 2 G H5'' H 4.279 0.02 1 15 2 2 G H8 H 7.589 0.02 1 16 2 2 G H22 H 6.058 0.02 1 17 3 3 G H1 H 13.236 0.02 1 18 3 3 G H1' H 5.816 0.02 1 19 3 3 G H2' H 4.515 0.02 1 20 3 3 G H3' H 4.443 0.02 1 21 3 3 G H8 H 7.215 0.02 1 22 3 3 G H21 H 8.475 0.02 1 23 3 3 G H22 H 6.072 0.02 1 24 3 3 G HO2' H 7.016 0.02 1 25 4 4 U H1' H 5.564 0.02 1 26 4 4 U H2' H 4.695 0.02 1 27 4 4 U H3 H 13.683 0.02 1 28 4 4 U H3' H 4.520 0.02 1 29 4 4 U H5 H 5.083 0.02 1 30 4 4 U H6 H 7.673 0.02 1 31 5 5 G H1 H 11.700 0.02 1 32 5 5 G H1' H 5.755 0.02 1 33 5 5 G H2' H 4.620 0.02 1 34 5 5 G H3' H 4.586 0.02 1 35 5 5 G H8 H 7.679 0.02 1 36 6 6 A H1' H 5.810 0.02 1 37 6 6 A H2 H 7.021 0.02 1 38 6 6 A H2' H 4.560 0.02 1 39 6 6 A H3' H 4.669 0.02 1 40 6 6 A H8 H 7.742 0.02 1 41 6 6 A H61 H 7.778 0.02 1 42 6 6 A H62 H 6.638 0.02 1 43 7 7 A H1' H 5.754 0.02 1 44 7 7 A H2 H 7.119 0.02 1 45 7 7 A H2' H 4.446 0.02 1 46 7 7 A H3' H 4.500 0.02 1 47 7 7 A H8 H 7.646 0.02 1 48 7 7 A H61 H 7.924 0.02 1 49 7 7 A H62 H 6.712 0.02 1 50 7 7 A HO2' H 6.806 0.02 1 51 8 8 A H1' H 5.895 0.02 1 52 8 8 A H2 H 7.759 0.02 1 53 8 8 A H2' H 4.456 0.02 1 54 8 8 A H3' H 4.589 0.02 1 55 8 8 A H8 H 7.651 0.02 1 56 8 8 A H61 H 8.114 0.02 1 57 8 8 A H62 H 6.611 0.02 1 58 8 8 A HO2' H 6.899 0.02 1 59 9 9 C H1' H 5.349 0.02 1 60 9 9 C H2' H 4.362 0.02 1 61 9 9 C H3' H 4.330 0.02 1 62 9 9 C H5 H 5.162 0.02 1 63 9 9 C H5'' H 4.053 0.02 1 64 9 9 C H6 H 7.258 0.02 1 65 9 9 C H41 H 8.087 0.02 1 66 9 9 C H42 H 6.856 0.02 1 67 10 10 G H1' H 5.767 0.02 1 68 10 10 G H2' H 4.405 0.02 1 69 10 10 G H3' H 4.697 0.02 1 70 10 10 G H5'' H 4.145 0.02 1 71 10 10 G H8 H 7.662 0.02 1 72 11 11 G H1 H 11.747 0.02 1 73 11 11 G H1' H 5.612 0.02 1 74 11 11 G H2' H 4.708 0.02 1 75 11 11 G H8 H 7.735 0.02 1 76 11 11 G H21 H 7.692 0.02 1 77 11 11 G H22 H 5.816 0.02 1 78 12 12 A H1' H 5.913 0.02 1 79 12 12 A H2 H 7.376 0.02 1 80 12 12 A H2' H 4.664 0.02 1 81 12 12 A H8 H 7.803 0.02 1 82 12 12 A H62 H 6.388 0.02 1 83 13 13 G H1 H 12.785 0.02 1 84 13 13 G H1' H 5.619 0.02 1 85 13 13 G H2' H 4.526 0.02 1 86 13 13 G H3' H 4.453 0.02 1 87 13 13 G H5'' H 4.066 0.02 1 88 13 13 G H8 H 7.084 0.02 1 89 13 13 G H21 H 8.341 0.02 1 90 13 13 G H22 H 6.082 0.02 1 91 14 14 G H1 H 12.516 0.02 1 92 14 14 G H1' H 5.720 0.02 1 93 14 14 G H2' H 4.553 0.02 1 94 14 14 G H3' H 4.474 0.02 1 95 14 14 G H5'' H 4.072 0.02 1 96 14 14 G H8 H 7.167 0.02 1 97 14 14 G H21 H 7.994 0.02 1 98 14 14 G H22 H 5.891 0.02 1 99 15 15 A H1' H 6.025 0.02 1 100 15 15 A H2 H 7.864 0.02 1 101 15 15 A H2' H 4.639 0.02 1 102 15 15 A H3' H 4.639 0.02 1 103 15 15 A H8 H 7.806 0.02 1 104 15 15 A H61 H 8.442 0.02 1 105 15 15 A H62 H 6.676 0.02 1 106 16 16 C H1' H 5.356 0.02 1 107 16 16 C H2' H 4.421 0.02 1 108 16 16 C H3' H 4.125 0.02 1 109 16 16 C H4' H 4.427 0.02 1 110 16 16 C H5 H 5.210 0.02 1 111 16 16 C H5' H 4.433 0.02 1 112 16 16 C H5'' H 4.017 0.02 1 113 16 16 C H6 H 7.210 0.02 1 114 16 16 C H41 H 8.629 0.02 1 115 16 16 C H42 H 7.107 0.02 1 116 16 16 C HO2' H 7.037 0.02 1 117 17 17 U H1' H 5.691 0.02 1 118 17 17 U H2' H 3.807 0.02 1 119 17 17 U H3 H 11.906 0.02 1 120 17 17 U H3' H 4.550 0.02 1 121 17 17 U H4' H 4.382 0.02 1 122 17 17 U H5 H 5.650 0.02 1 123 17 17 U H5'' H 4.114 0.02 1 124 17 17 U H6 H 7.787 0.02 1 125 17 17 U HO2' H 6.773 0.02 1 126 18 18 U H1' H 6.125 0.02 1 127 18 18 U H2' H 4.699 0.02 1 128 18 18 U H3' H 4.044 0.02 1 129 18 18 U H4' H 4.504 0.02 1 130 18 18 U H5 H 5.884 0.02 1 131 18 18 U H5' H 4.264 0.02 1 132 18 18 U H5'' H 4.062 0.02 1 133 18 18 U H6 H 8.046 0.02 1 134 19 19 C H1' H 5.990 0.02 1 135 19 19 C H2' H 4.127 0.02 1 136 19 19 C H3' H 4.508 0.02 1 137 19 19 C H4' H 3.828 0.02 1 138 19 19 C H5 H 6.143 0.02 1 139 19 19 C H5' H 2.731 0.02 1 140 19 19 C H5'' H 3.631 0.02 1 141 19 19 C H6 H 7.726 0.02 1 142 19 19 C H41 H 7.219 0.02 1 143 19 19 C H42 H 6.400 0.02 1 144 20 20 G H1 H 9.954 0.02 1 145 20 20 G H1' H 5.992 0.02 1 146 20 20 G H2' H 4.854 0.02 1 147 20 20 G H3' H 5.667 0.02 1 148 20 20 G H4' H 4.438 0.02 1 149 20 20 G H5' H 4.215 0.02 1 150 20 20 G H5'' H 4.437 0.02 1 151 20 20 G H8 H 7.891 0.02 1 152 21 21 G H1 H 13.582 0.02 1 153 21 21 G H1' H 4.453 0.02 1 154 21 21 G H2' H 4.429 0.02 1 155 21 21 G H3' H 4.271 0.02 1 156 21 21 G H4' H 4.414 0.02 1 157 21 21 G H5' H 4.292 0.02 1 158 21 21 G H5'' H 4.528 0.02 1 159 21 21 G H8 H 8.356 0.02 1 160 21 21 G H21 H 8.849 0.02 1 161 21 21 G H22 H 6.719 0.02 1 162 21 21 G HO2' H 6.899 0.02 1 163 22 22 U H1' H 5.608 0.02 1 164 22 22 U H2' H 4.592 0.02 1 165 22 22 U H3 H 14.455 0.02 1 166 22 22 U H3' H 4.592 0.02 1 167 22 22 U H5 H 5.134 0.02 1 168 22 22 U H5' H 4.520 0.02 1 169 22 22 U H5'' H 4.064 0.02 1 170 22 22 U H6 H 7.873 0.02 1 171 23 23 C H1' H 5.606 0.02 1 172 23 23 C H2' H 4.434 0.02 1 173 23 23 C H3' H 4.464 0.02 1 174 23 23 C H5 H 5.707 0.02 1 175 23 23 C H6 H 7.903 0.02 1 176 23 23 C H41 H 8.590 0.02 1 177 23 23 C H42 H 7.091 0.02 1 178 24 24 C H1' H 5.444 0.02 1 179 24 24 C H2' H 4.363 0.02 1 180 24 24 C H3' H 4.450 0.02 1 181 24 24 C H5 H 5.540 0.02 1 182 24 24 C H6 H 7.802 0.02 1 183 24 24 C H41 H 8.485 0.02 1 184 24 24 C H42 H 6.964 0.02 1 185 24 24 C HO2' H 6.750 0.02 1 186 25 25 U H1' H 5.502 0.02 1 187 25 25 U H2' H 4.456 0.02 1 188 25 25 U H3 H 13.975 0.02 1 189 25 25 U H3' H 4.523 0.02 1 190 25 25 U H5 H 5.385 0.02 1 191 25 25 U H6 H 7.906 0.02 1 192 26 26 C H1' H 5.492 0.02 1 193 26 26 C H2' H 4.342 0.02 1 194 26 26 C H3' H 4.482 0.02 1 195 26 26 C H4' H 4.408 0.02 1 196 26 26 C H5 H 5.605 0.02 1 197 26 26 C H6 H 7.759 0.02 1 198 26 26 C H41 H 7.986 0.02 1 199 26 26 C H42 H 6.963 0.02 1 200 27 27 A H1' H 5.752 0.02 1 201 27 27 A H2 H 6.799 0.02 1 202 27 27 A H2' H 4.288 0.02 1 203 27 27 A H8 H 7.943 0.02 1 204 28 28 A H1' H 5.825 0.02 1 205 28 28 A H2 H 8.003 0.02 1 206 28 28 A H2' H 4.572 0.02 1 207 28 28 A H3' H 4.744 0.02 1 208 28 28 A H8 H 8.088 0.02 1 209 29 29 G H1 H 13.011 0.02 1 210 29 29 G H1' H 5.518 0.02 1 211 29 29 G H2' H 4.735 0.02 1 212 29 29 G H3' H 4.546 0.02 1 213 29 29 G H5'' H 4.229 0.02 1 214 29 29 G H8 H 7.938 0.02 1 215 29 29 G H21 H 8.610 0.02 1 216 29 29 G H22 H 6.418 0.02 1 217 30 30 U H1' H 5.677 0.02 1 218 30 30 U H2' H 4.599 0.02 1 219 30 30 U H3 H 14.217 0.02 1 220 30 30 U H3' H 4.526 0.02 1 221 30 30 U H5 H 5.118 0.02 1 222 30 30 U H6 H 7.832 0.02 1 223 31 31 U H1' H 5.696 0.02 1 224 31 31 U H2' H 4.483 0.02 1 225 31 31 U H3 H 13.914 0.02 1 226 31 31 U H3' H 4.539 0.02 1 227 31 31 U H5 H 5.594 0.02 1 228 31 31 U H6 H 8.072 0.02 1 229 32 32 U H1' H 5.619 0.02 1 230 32 32 U H2' H 4.421 0.02 1 231 32 32 U H3 H 13.736 0.02 1 232 32 32 U H3' H 4.484 0.02 1 233 32 32 U H5 H 5.595 0.02 1 234 32 32 U H6 H 8.049 0.02 1 235 33 33 C H1' H 5.490 0.02 1 236 33 33 C H2' H 4.392 0.02 1 237 33 33 C H3' H 4.595 0.02 1 238 33 33 C H5 H 5.675 0.02 1 239 33 33 C H6 H 7.902 0.02 1 240 33 33 C H41 H 8.366 0.02 1 241 33 33 C H42 H 7.017 0.02 1 242 33 33 C HO2' H 6.625 0.02 1 243 34 34 A H1' H 5.876 0.02 1 244 34 34 A H2 H 7.347 0.02 1 245 34 34 A H2' H 4.513 0.02 1 246 34 34 A H3' H 4.706 0.02 1 247 34 34 A H5'' H 4.149 0.02 1 248 34 34 A H8 H 8.123 0.02 1 249 34 34 A H61 H 8.002 0.02 1 250 34 34 A H62 H 6.385 0.02 1 251 35 35 C H1' H 5.415 0.02 1 252 35 35 C H2' H 4.219 0.02 1 253 35 35 C H3' H 4.397 0.02 1 254 35 35 C H5 H 5.205 0.02 1 255 35 35 C H5'' H 4.065 0.02 1 256 35 35 C H6 H 7.596 0.02 1 257 35 35 C H41 H 8.420 0.02 1 258 35 35 C H42 H 7.029 0.02 1 259 35 35 C HO2' H 6.860 0.02 1 260 36 36 C H1' H 5.514 0.02 1 261 36 36 C H2' H 4.265 0.02 1 262 36 36 C H3' H 4.500 0.02 1 263 36 36 C H5 H 5.432 0.02 1 264 36 36 C H6 H 7.792 0.02 1 265 36 36 C H41 H 8.530 0.02 1 266 36 36 C H42 H 6.926 0.02 1 267 36 36 C HO2' H 6.871 0.02 1 268 37 37 C H1' H 5.772 0.02 1 269 37 37 C H2' H 4.024 0.02 1 270 37 37 C H3' H 4.193 0.02 1 271 37 37 C H4' H 4.184 0.02 1 272 37 37 C H5 H 5.500 0.02 1 273 37 37 C H5' H 4.522 0.02 1 274 37 37 C H5'' H 4.041 0.02 1 275 37 37 C H6 H 7.692 0.02 1 276 37 37 C H41 H 8.340 0.02 1 277 37 37 C H42 H 7.088 0.02 1 stop_ save_