warning: failed to read freetag - ' _struct_conn\.details'
BMRB Entry 7403 BMRB - Biological Magnetic Resonance Bank
BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7403

Title: Solution structure of the CR7 terminal hairpin loop from human telomerase RNA   PubMed: 17889661

Authors: Feigon, J.; Theimer, C.; Chim, N; Breece, K.

Citation: Theimer, C.; Jady, B.; Chim, N.; Richard, P.; Breece, K.; Kiss, T.; Feigon, J.. "Structural and functional characterization of human telomerase RNA processing and cajal body localization signals"  Mol. Cell 27, 869-881 (2007).

Assembly members:
Human_telomerase_RNA_CR7_terminal_hairpin_loop, polymer, 24 residues, Formula weight is not available

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Human_telomerase_RNA_CR7_terminal_hairpin_loop: GGAGUGCCUGAGCUGUGGCA CUCC

Data sets:
Data typeCount
13C chemical shifts191
15N chemical shifts54
1H chemical shifts178

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Human telomerase RNA CR7 terminal hairpin loop1

Entities:

Entity 1, Human telomerase RNA CR7 terminal hairpin loop 24 residues - Formula weight is not available

1   GGAGUGCCUG
2   AGCUGUGGCA
3   CUCC

Samples:

sample_1: telomerase_RNA_CR7 1 mM; sodium phosphate 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_2: telomerase_RNA_CR7, [U-13C; U-15N], 1 mM; sodium phosphate 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_conditions_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D NOESY (11echo and watergate)sample_1isotropicsample_conditions_1
2D NOESYsample_1isotropicsample_conditions_1
2D TOCSYsample_1isotropicsample_conditions_1
Natural abundance 2D 13C HSQCsample_1isotropicsample_conditions_1
2D 15N-HMQCsample_2isotropicsample_conditions_1
2D 15N-CPMG-NOESYsample_2isotropicsample_conditions_1
2D JNN-HNN-COSYsample_2isotropicsample_conditions_1
2D 13C-HSQCsample_2isotropicsample_conditions_1
2D HCCH-COCSYsample_2isotropicsample_conditions_1
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
2D 31P spin echo difference HCCH/HSQC/HMQCsample_2isotropicsample_conditions_1
2D CT-CE-HSQCsample_2isotropicsample_conditions_1

Software:

xwinnmr v2.6, Bruker - collection

xwinnmr v2.6, Bruker - processing

AURELIA v3.108, Brunger - data analysis

X-PLOR v3.851, NIH - structure solution

X-PLOR v3.851, NIH - refinement

NMR spectrometers:

  • Bruker DPX 500 MHz
  • Bruker DRX 600 MHz
  • Bruker AVANCE 800 MHz

Related Database Links: