BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7354

Title: NMR STRUCTURE OF A PROTEIN-DNA COMPLEX OF AN ALTERED SPECIFICITY MUTANT OF THE LAC REPRESSOR THAT MIMICS THE GAL REPRESSOR   PubMed: 16094693

Authors: Salinas, R.; Folkers, G.; Bonvin, A.; Das, D.; Boelens, R.; Kaptein, R.

Citation: Kopke Salinas, Roberto; Folkers, Gert; Bonvin, Alexandre; Das, Devashish; Boelens, Rolf; Kaptein, Robert. "Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor"  Chembiochem 6, 1628-1637 (2005).

Assembly members:
LAC-GAL_OPERATOR, polymer, 22 residues, Formula weight is not available
LAC_HEADPIECE_1-62, polymer, 62 residues, Formula weight is not available

Natural source:   Common Name: ESCHERICHIA COLI   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology   Host organism: ESCHERICHIA COLI

Entity Sequences (FASTA):
LAC-GAL_OPERATOR: GAATTGTAAGCGCTTACAAT TC
LAC_HEADPIECE_1-62: MKPVTLYDVAEYAGVSVATV SRVVNQASHVSAKTREKVEA AMAELNYIPNRCAQQLAGKQ SL

Data sets:
Data typeCount
13C chemical shifts248
15N chemical shifts70
1H chemical shifts544

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1LAC_REPRESSOR1
2LAC_REPRESSOR1
3LAC_REPRESSOR2
4LAC_REPRESSOR2

Entities:

Entity 1, LAC_REPRESSOR 22 residues - Formula weight is not available

1   DGDADADTDTDGDTDADADG
2   DCDGDCDTDTDADCDADADT
3   DTDC

Entity 2, LAC_REPRESSOR 62 residues - Formula weight is not available

1   METLYSPROVALTHRLEUTYRASPVALALA
2   GLUTYRALAGLYVALSERVALALATHRVAL
3   SERARGVALVALASNGLNALASERHISVAL
4   SERALALYSTHRARGGLULYSVALGLUALA
5   ALAMETALAGLULEUASNTYRILEPROASN
6   ARGCYSALAGLNGLNLEUALAGLYLYSGLN
7   SERLEU

Samples:

sample: LAC_REPRESSOR mM; D2O 5%; H2O 95%

sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1.0 atm; temperature: 315.0 K

Experiments:

NameSampleSample stateSample conditions
3D 15N NOESY-HSQCsampleisotropicsample_conditions_1
3D 13C NOESY-HSQCsampleisotropicsample_conditions_1
2D NOESYsampleisotropicsample_conditions_1
2D NOESY WITH X-FILTERSsampleisotropicsample_conditions_1
3D CBCACONHsampleisotropicsample_conditions_1
3D HNCOsampleisotropicsample_conditions_1
3D HBHACONHsampleisotropicsample_conditions_1
3D HCCCONHsampleisotropicsample_conditions_1
3D HCCH-TOCSYsampleisotropicsample_conditions_1
2D 1H-13C HSQCsampleisotropicsample_conditions_1
2D 1H-15N HSQCsampleisotropicsample_conditions_1
2D 1H-15N J- MODULATED HSQCsampleisotropicsample_conditions_1

Software:

CNS, BRUNGER,ADAMS,CLORE,DELANO,GROS, GROSSE-KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,READ,RICE,SIMONSON,WARREN - refinement

CNS - structure solution

NMR spectrometers:

  • BRUKER DMX 900 MHz

Related Database Links:

PDB