BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7319

Title: Polymerase Beta and Double gap double hairpin DNA   PubMed: 19421423

Authors: Mueller, Geoffrey; DeRose, Eugene; Kirby, Thomas; London, Robert

Citation: Mueller, Geoffrey; DeRose, Eugene; Kirby, Thomas; London, Robert. "NMR assignment of polymerase beta labeled with 2H, 13C, and 15N in complex with substrate DNA"  Biomol. NMR Assignments 1, 33-35 (2007).

Assembly members:
pol beta, polymer, 335 residues, 39000 Da.
double gap double hairpin dna, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Rat   Taxonomy ID: 10116   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Rattus norvegicus

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
pol beta: MSKRKAPQETLNGGITDMLV ELANFEKNVSQAIHKYNAYR KAASVIAKYPHKIKSGAEAK KLPGVGTKIAEKIDEFLATG KLRKLEKIRQDDTSSSINFL TRVTGIGPSAARKLVDEGIK TLEDLRKNEDKLNHHQRIGL KYFEDFEKRIPREEMLQMQD IVLNEVKKLDPEYIATVCGS FRRGAESSGDMDVLLTHPNF TSESSKQPKLLHRVVEQLQK VRFITDTLSKGETKFMGVCQ LPSENDENEYPHRRIDIRLI PKDQYYCGVLYFTGSDIFNK NMRAHALEKGFTINEYTIRP LGVTGVAGEPLPVDSEQDIF DYIQWRYREPKDRSE
double gap double hairpin dna: CAGCGAAGCTGGTCGCGAAG CG

Data sets:
Data typeCount
13C chemical shifts775
15N chemical shifts268
1H chemical shifts268

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1polyermase beta1
2double gap double hairpin dna2

Entities:

Entity 1, polyermase beta 335 residues - 39000 Da.

1   METSERLYSARGLYSALAPROGLNGLUTHR
2   LEUASNGLYGLYILETHRASPMETLEUVAL
3   GLULEUALAASNPHEGLULYSASNVALSER
4   GLNALAILEHISLYSTYRASNALATYRARG
5   LYSALAALASERVALILEALALYSTYRPRO
6   HISLYSILELYSSERGLYALAGLUALALYS
7   LYSLEUPROGLYVALGLYTHRLYSILEALA
8   GLULYSILEASPGLUPHELEUALATHRGLY
9   LYSLEUARGLYSLEUGLULYSILEARGGLN
10   ASPASPTHRSERSERSERILEASNPHELEU
11   THRARGVALTHRGLYILEGLYPROSERALA
12   ALAARGLYSLEUVALASPGLUGLYILELYS
13   THRLEUGLUASPLEUARGLYSASNGLUASP
14   LYSLEUASNHISHISGLNARGILEGLYLEU
15   LYSTYRPHEGLUASPPHEGLULYSARGILE
16   PROARGGLUGLUMETLEUGLNMETGLNASP
17   ILEVALLEUASNGLUVALLYSLYSLEUASP
18   PROGLUTYRILEALATHRVALCYSGLYSER
19   PHEARGARGGLYALAGLUSERSERGLYASP
20   METASPVALLEULEUTHRHISPROASNPHE
21   THRSERGLUSERSERLYSGLNPROLYSLEU
22   LEUHISARGVALVALGLUGLNLEUGLNLYS
23   VALARGPHEILETHRASPTHRLEUSERLYS
24   GLYGLUTHRLYSPHEMETGLYVALCYSGLN
25   LEUPROSERGLUASNASPGLUASNGLUTYR
26   PROHISARGARGILEASPILEARGLEUILE
27   PROLYSASPGLNTYRTYRCYSGLYVALLEU
28   TYRPHETHRGLYSERASPILEPHEASNLYS
29   ASNMETARGALAHISALALEUGLULYSGLY
30   PHETHRILEASNGLUTYRTHRILEARGPRO
31   LEUGLYVALTHRGLYVALALAGLYGLUPRO
32   LEUPROVALASPSERGLUGLNASPILEPHE
33   ASPTYRILEGLNTRPARGTYRARGGLUPRO
34   LYSASPARGSERGLU

Entity 2, double gap double hairpin dna 22 residues - Formula weight is not available

1   DCDADGDCDGDADADGDCDT
2   DGDGDTDCDGDCDGDADADG
3   DCDG

Samples:

sample_1: pol beta, [U-2H; U-13C; U-15N], 0.5 mM; dgdhp 0.5 mM; KCl 150 mM; sodium azide 3 mM; Tris buffer 150 mM

conditions_1: pH: 7.4; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
3D TROSY HNCOsample_1not availableconditions_1
3D TROSY HN(CA)COsample_1not availableconditions_1
3D TROSY HN(CO)CAsample_1not availableconditions_1
3D TROSY HNCAsample_1not availableconditions_1
3D TROSY HNCACBsample_1not availableconditions_1
3D TROSY HN(CO)CACBsample_1not availableconditions_1
3D TROSY HN(COCA)CBsample_1not availableconditions_1
15N separated NOEsample_1not availableconditions_1

Software:

No software information available

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links:

BMRB 18267 5208
PDB
DBJ BAC36630 BAE27405 BAE30399
GB AAA41900 AAA41901 AAB00389 AAH60998 AAH98668
REF NP_035260 NP_058837 XP_005066593 XP_005362476
SP P06766 Q8K409