BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7315

Title: The backbone chemical shifts of ribosomal protein L11 in the complex with rRNA and thiostrepton   PubMed: 17292917

Authors: Lee, Donghan; Wang, Yun-Xing

Citation: Lee, D.; Walsh, JD.; Yu, P.; Markus, MA.; Choli-Papadopoulou, T.; Schwieters, CD.; Krueger, S.; Draper, DE.; Wang, YX.. "The structure of free L11 and functional dyanamics of L11 in free, L11-rRNA(58nt) binary and L11-rRNA(58nt)-thiostrepton ternary complexes"  J. Mol. Biol. 367, 1007-1022 (2007).

Assembly members:
L11, polymer, 147 residues, Formula weight is not available
RNA, polymer, 58 residues, Formula weight is not available
Thiostrepton antibiotic, polymer, . residues, Formula weight is not available

Natural source:   Common Name: Thermus thermophilus   Taxonomy ID: 274   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Thermus thermophilus

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
L11: MKKVVAVVKLQLPAGKATPA PPVGPALGQHGANIMEFVKA FNAATANMGDAIVPVEITIY ADRSFTFVTKTPPASYLIRK AAGLEKGAHKPGREKVGRIT WEQVLEIAKQKMPDLNTTDL EAAARMIAGSARSMGVEVVG APEVKDA
RNA: GCCAGGAUGUUGGCUUAGAA GCAGCCAUCAUUUAAAGAAA GCGUAAUAGCUCACUGGU

Data sets:
Data typeCount
13C chemical shifts263
15N chemical shifts135
1H chemical shifts135

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1L111
2RNA2
3Thiostrepton3

Entities:

Entity 1, L11 147 residues - Formula weight is not available

1   METLYSLYSVALVALALAVALVALLYSLEU
2   GLNLEUPROALAGLYLYSALATHRPROALA
3   PROPROVALGLYPROALALEUGLYGLNHIS
4   GLYALAASNILEMETGLUPHEVALLYSALA
5   PHEASNALAALATHRALAASNMETGLYASP
6   ALAILEVALPROVALGLUILETHRILETYR
7   ALAASPARGSERPHETHRPHEVALTHRLYS
8   THRPROPROALASERTYRLEUILEARGLYS
9   ALAALAGLYLEUGLULYSGLYALAHISLYS
10   PROGLYARGGLULYSVALGLYARGILETHR
11   TRPGLUGLNVALLEUGLUILEALALYSGLN
12   LYSMETPROASPLEUASNTHRTHRASPLEU
13   GLUALAALAALAARGMETILEALAGLYSER
14   ALAARGSERMETGLYVALGLUVALVALGLY
15   ALAPROGLUVALLYSASPALA

Entity 2, RNA 58 residues - Formula weight is not available

1   GCCAGGAUGU
2   UGGCUUAGAA
3   GCAGCCAUCA
4   UUUAAAGAAA
5   GCGUAAUAGC
6   UCACUGGU

Entity 3, Thiostrepton - Formula weight is not available

Samples:

sample_1: L11, [U-13C; U-15N; U-2H], 0.7 mM; RNA mM; Thiostrepton mM

conditions_1: pH: 6.5; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
1D [15N,1H]-TRACTsample_1not availableconditions_1
3D TROSY-HNCAsample_1not availableconditions_1
3D TROSY-HNCACBsample_1not availableconditions_1
3D aromatic TROSY-hCCH COSYsample_1not availableconditions_1
3D 15N-resolved NOESYsample_1not availableconditions_1
3D 13C-resolved NOESY (aromatic carbon)sample_1not availableconditions_1

Software:

No software information available

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Varian INOVA 800 MHz

Related Database Links:

BMRB 4965 7314
PDB
DBJ BAD70070
EMBL CAA57138
GB AAS82080 ADW20820 AEG32574 AEV17153 AFH38065
PIR S66576
PRF 2004301A
REF WP_008630514 WP_011174097 WP_014516502 WP_014628913 WP_015716108
SP P36238 P62442 Q5SLP6