BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6814

Title: Class I GTP aptamer   PubMed: 16510427

Authors: Carothers, J.; Davis, J.; Chou, J.; Szostak, J.

Citation: Carothers, J.; Davis, J.; Chou, J.; Szostak, J.. "Solution structure of an informationally complex high-affinity RNA aptamer to GTP"  RNA 12, 567-579 (2006).

Assembly members:
Class I RNA aptamer to GTP, polymer, 41 residues, Formula weight is not available
GTP, non-polymer, 523.180 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Class I RNA aptamer to GTP: GGGACGAAGUGGUUGGGCGC UUCGGCGUGUGAAAACGUCU C

Data sets:
Data typeCount
1H chemical shifts295

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Class I RNA aptamer to GTP1
2GUANOSINE-5'-TRIPHOSPHATE2

Entities:

Entity 1, Class I RNA aptamer to GTP 41 residues - Formula weight is not available

1   GGGACGAAGU
2   GGUUGGGCGC
3   UUCGGCGUGU
4   GAAAACGUCU
5   C

Entity 2, GUANOSINE-5'-TRIPHOSPHATE - C10 H16 N5 O14 P3 - 523.180 Da.

1   GTP

Samples:

sample_1: Class I RNA aptamer to GTP, [U-15N; U-13C], 3.3 mM; GUANOSINE-5'-TRIPHOSPHATE 3.63 mM; phosphate buffer 10%; D2O 99%

sample_2: Class I RNA aptamer to GTP, [U-15N; U-13C], 0.9 mM; GUANOSINE-5'-TRIPHOSPHATE 0.99 mM; phosphate buffer 10%; D2O 99%

sample_3: Class I RNA aptamer to GTP, [U-15N; U-13C], 3.3 mM; GUANOSINE-5'-TRIPHOSPHATE 3.63 mM; phosphate buffer 10%; D2O 5%; H2O 95%

sample_4: Class I RNA aptamer to GTP, [U-15N; U-13C], 0.9 mM; GUANOSINE-5'-TRIPHOSPHATE 0.99 mM; phosphate buffer 10%; D2O 5%; H2O 95%

sample_cond_1: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 288 K

sample_cond_2: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 303 K

sample_cond_3: ionic strength: 80 mM; pH: 6.1; pressure: 1 atm; temperature: 298 K

sample_cond_4: ionic strength: 80 mM; pH: 6.8; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
3D 13C-separated NOESYnot availablenot availablenot available
3D 15N-separated NOESYnot availablenot availablenot available
2D NOESYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
2D 1H decoupled 13C-1H CT HSQCnot availablenot availablenot available
2D 13C-1H CT-TROSYnot availablenot availablenot available

Software:

NMRPipe v2.3 - processing

X-PLOR NIH v2.9.2 - structure solution, refinement

SPARKY v3 - data analysis

NMR spectrometers:

  • Bruker AVANCE 500 MHz

Related Database Links: