BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6756

Title: Solution structure of domain 6 from the ai5(gamma) group II intron   PubMed: 17200997

Authors: Erat, Michele; Sigel, Roland

Citation: Erat, Michele; Zerbe, Oliver; Fox, Thomas; Sigel, Roland. "Solution Structure of Domain 6 from a Self-Splicing Group II Intron Ribozyme: A Mg(2+) Binding Site is Located Close to the Stacked Branch Adenosine"  Chembiochem. 8, 306-314 (2007).

Assembly members:
Domain 6, polymer, 27 residues, 8787 Da.
MG, non-polymer, 24.305 Da.

Natural source:   Common Name: Saccharomyces cerevisiae   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Domain 6: GGAGCGGGGGUGUAAACCUA UCGCUCC

Data sets:
Data typeCount
13C chemical shifts143
15N chemical shifts11
1H chemical shifts235

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1D6short1
2MAGNESIUM (II) ION2

Entities:

Entity 1, D6short 27 residues - 8787 Da.

1   GGAGCGGGGG
2   UGUAAACCUA
3   UCGCUCC

Entity 2, MAGNESIUM (II) ION - Mg - 24.305 Da.

1   MG

Samples:

sample_1: Domain 6 0.6 ± 0 mM; D2O 99.999%; KCL 100 mM; EDTA 10 uM

sample_2: Domain 6 0.6 ± 0 mM; D2O 10%; H2O 90%; KCL 100 mM; EDTA 10 uM

sample_3: Domain 6, [U-13C; U-15N], 0.6 ± 0 mM; D2O 99.999%; KCL 100 mM; EDTA 10 uM

conditions_1: ionic strength: 1.1 M; pH: 6.8; temperature: 303 K

conditions_2: ionic strength: 1.1 M; pH: 6.8; temperature: 275 K

Experiments:

NameSampleSample stateSample conditions
2D 1H1H Noesy in D2O and H2Onot availablenot availablenot available
2D 1H1H Tocsynot availablenot availablenot available
13C1H HSQCnot availablenot availablenot available
15N1H HSQCnot availablenot availablenot available
HCCH-Tocsynot availablenot availablenot available
HCCH-Cosynot availablenot availablenot available

Software:

No software information available

NMR spectrometers:

  • Bruker AVANCE 700 MHz
  • Bruker DRX 500 MHz

Related Database Links: