BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6633

Title: Structure of the RNA signal essential for translational frameshifting in HIV-1   PubMed: 15907937

Authors: Gaudin, C.; Mazauric, M.; Traikia, M.; Guittet, E.; Yoshizawa, S.; Fourmy, D.

Citation: Gaudin, C.; Mazauric, M.; Traikia, M.; Guittet, E.; Yoshizawa, S.; Fourmy, D.. "Structure of the RNA Signal Essential for Translational Frameshifting in HIV-1"  J. Mol. Biol. 349, 1024-1035 (2005).

Assembly members:
HIV frameshift RNA signal, polymer, 41 residues, Formula weight is not available

Natural source:   Common Name: Lentivirus   Taxonomy ID: 11646   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
HIV frameshift RNA signal: GGCGAUCUGGCCUUCCUACA AGGGAAGGCCAGGGAAUUGC C

Data sets:
Data typeCount
13C chemical shifts273
15N chemical shifts18
1H chemical shifts351

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1HIV-1 frameshift RNA signal1

Entities:

Entity 1, HIV-1 frameshift RNA signal 41 residues - Formula weight is not available

1   GGCGAUCUGG
2   CCUUCCUACA
3   AGGGAAGGCC
4   AGGGAAUUGC
5   C

Samples:

sample_1: HIV frameshift RNA signal 1 mM; Na phosphate buffer 10 mM; D2O 10%; H2O 90%

sample_2: HIV frameshift RNA signal 1 mM; Na phosphate buffer 10 mM; D2O 100%

sample_3: HIV frameshift RNA signal, [U-13C; U-15N], 1 mM; Na phosphate buffer 10 mM; D2O 100%

sample_cond_1: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 283 K

sample_cond_2: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
2D TOCSYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
HP COSYnot availablenot availablenot available
3D-HCCH-TOCSYnot availablenot availablenot available
HSQCnot availablenot availablenot available
3D HCPnot availablenot availablenot available

Software:

xwinnmr v3.1 - processing

GIFA v4.4 - data analysis

AURELIA - data analysis

SPARKY v3.110 - data analysis

DISCOVER - refinement

NMR spectrometers:

  • Bruker DRX 800 MHz
  • Bruker DRX 600 MHz
  • Varian INOVA 500 MHz

Related Database Links: