BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6543

Title: HIV-1 frameshift inducing element RNA   PubMed: 15927637

Authors: Staple, David; Butcher, Samuel

Citation: Staple, David; Butcher, Samuel. "Soultion structure and thermodynamic investigation of the HIV-1 frameshift inducing element"  J. Mol. Biol. 349, 1011-1023 (2005).

Assembly members:
HIV-1 frameshift induciting element RNA, polymer, 45 residues, Formula weight is not available

Natural source:   Common Name: HIV   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: Not applicable   Genus/species: HIV HIV

Experimental source:   Production method: in vitro transcription

Entity Sequences (FASTA):
HIV-1 frameshift induciting element RNA: GGGAAGAUCUGGCCUUCCCA CAAGGGAAGGCCAGGGAAUC UUCCC

Data sets:
Data typeCount
1H chemical shifts308
13C chemical shifts91
15N chemical shifts24

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1HIV-1 frameshift inducing RNA1

Entities:

Entity 1, HIV-1 frameshift inducing RNA 45 residues - Formula weight is not available

1   GGGAAGAUCU
2   GGCCUUCCCA
3   CAAGGGAAGG
4   CCAGGGAAUC
5   UUCCC

Samples:

sample_1: HIV-1 frameshift induciting element RNA, [U-13C; U-15N]-A,U, 1 mM; NaCl 50 mM; D2O 10%; H2O 90%

sample_2: HIV-1 frameshift induciting element RNA, [U-13C; U-15N]-G,C, 1 mM; NaCl 50 mM; D2O 100%

conditions_1: pH: 6.8; pressure: 1 atm; temperature: 303 K

conditions_2: pH: 6.8; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYnot availablenot availablenot available
2D 1H-1H TOCSYnot availablenot availablenot available
2D 1H-13C HSQCnot availablenot availablenot available
2D 1H-15N HMQCnot availablenot availablenot available
2D HNN COSYnot availablenot availablenot available
3D HCCH TOCSYnot availablenot availablenot available
3D HCCH COSYnot availablenot availablenot available
3D NOESY-HMQCnot availablenot availablenot available
Filter/Edit 2D 1H-1H NOEYnot availablenot availablenot available

Software:

No software information available

NMR spectrometers:

  • Bruker DMX 600 MHz
  • Bruker DMX 750 MHz
  • Varian Inova 800 MHz
  • Varian Inova 900 MHz

Related Database Links: