BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6485

Title: A novel RNA pentaloop fold involved in targeting ADAR2   PubMed: 15840813

Authors: Stefl, Richard; Allain, Frederic

Citation: Stefl, R.; Allain, F.. "A novel RNA pentaloop fold involved in targeting ADAR2"  RNA 11, 592-597 (2005).

Assembly members:
GluR-B R/G stem-loop RNA, polymer, 27 residues, Formula weight is not available

Natural source:   Common Name: 9606   Taxonomy ID: Human   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
GluR-B R/G stem-loop RNA: GGUAACAAUAUGCUAAAUGU UGUUACC

Data sets:
Data typeCount
13C chemical shifts183
1H chemical shifts221

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1GluR-B R/G RNA1

Entities:

Entity 1, GluR-B R/G RNA 27 residues - Formula weight is not available

1   GGUAACAAUA
2   UGCUAAAUGU
3   UGUUACC

Samples:

sample_1: GluR-B R/G stem-loop RNA, [U-13C; U-15N], 0.5 – 2 mM

condition_1: pH: 6; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1not availablecondition_1
2D TOCSYsample_1not availablecondition_1
13C-HSQCsample_1not availablecondition_1
3D 13-separated NOESYsample_1not availablecondition_1
and 3D HCCH-TOCSYsample_1not availablecondition_1

Software:

No software information available

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker Avance 600 MHz

Related Database Links: