BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6445

Title: Backbone 1H, 13C, and 15N and 13CB Chemical Shift Assignments for Six C2H2 Zinc Fingers (F1-6) of MTF-1 in the DNA Bound State (22 bp)

Authors: Potter, Belinda; Laity, John; Wilson, Jed

Citation: Potter, Belinda; Knudsen, Nathan; Feng, Linda; Matskevich, Viktor; Wilson, Jed; Andrews, Glen; Laity, John. "NMR Assignment of the Six Zinc Fingers of MTF-1 in the Free and DNA Bound States"  J. Biomol. NMR 31, 94-94 (2005).

Assembly members:
Metal response element, polymer, 22 residues, 13633 Da.
Metal response element, polymer, 22 residues, 13633 Da.
metal-response element-binding transcription factor-1, polymer, 177 residues, 20367 Da.
ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: mouse   Taxonomy ID: 10090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Mus musculus

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Metal response element: GCTCTGCACTCCGCCCGAAA AG
Metal response element: CTTTTCGGGCGGAGTGCAGA GC
metal-response element-binding transcription factor-1: VKRYQCTFEGCPRTYSTAGN LRTHQKTHRGEYTFVCNQEG CGKAFLTSYSLRIHVRVHTK EKPFECDVQGCEKAFNTLYR LKAHQRLHTGKTFNCESQGC SKYFTTLSDLRKHIRTHTGE KPFRCDHDGCGKAFAASHHL KTHVRTHTGERPFFCPSNGC EKTFSTQYSLKSHMKGH

Data sets:
Data typeCount
13C chemical shifts490
1H chemical shifts165
15N chemical shifts165

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1MTF-1 monomer3
2DNA strand one1
3DNA strand two2
4ZINC (II) ION 14
5ZINC (II) ION 24
6ZINC (II) ION 34
7ZINC (II) ION 44
8ZINC (II) ION 54
9ZINC (II) ION 64

Entities:

Entity 3, MTF-1 monomer 177 residues - 20367 Da.

1   VALLYSARGTYRGLNCYSTHRPHEGLUGLY
2   CYSPROARGTHRTYRSERTHRALAGLYASN
3   LEUARGTHRHISGLNLYSTHRHISARGGLY
4   GLUTYRTHRPHEVALCYSASNGLNGLUGLY
5   CYSGLYLYSALAPHELEUTHRSERTYRSER
6   LEUARGILEHISVALARGVALHISTHRLYS
7   GLULYSPROPHEGLUCYSASPVALGLNGLY
8   CYSGLULYSALAPHEASNTHRLEUTYRARG
9   LEULYSALAHISGLNARGLEUHISTHRGLY
10   LYSTHRPHEASNCYSGLUSERGLNGLYCYS
11   SERLYSTYRPHETHRTHRLEUSERASPLEU
12   ARGLYSHISILEARGTHRHISTHRGLYGLU
13   LYSPROPHEARGCYSASPHISASPGLYCYS
14   GLYLYSALAPHEALAALASERHISHISLEU
15   LYSTHRHISVALARGTHRHISTHRGLYGLU
16   ARGPROPHEPHECYSPROSERASNGLYCYS
17   GLULYSTHRPHESERTHRGLNTYRSERLEU
18   LYSSERHISMETLYSGLYHIS

Entity 1, DNA strand one 22 residues - 13633 Da.

1   DGDCDTDCDTDGDCDADCDT
2   DCDCDGDCDCDCDGDADADA
3   DADG

Entity 2, DNA strand two 22 residues - 13633 Da.

1   DCDTDTDTDTDCDGDGDGDC
2   DGDGDADGDTDGDCDADGDA
3   DGDC

Entity 4, ZINC (II) ION 1 - Zn - 65.409 Da.

1   ZN

Samples:

all_samples: metal-response element-binding transcription factor-1, [U-98% 13C; U-98% 15N], 0.3 – 0.6 mM; Metal response element0.3 – 0.6 mM; Metal response element0.3 – 0.6 mM; H2O 95%; D2O 5%

Cond_1: pH: 6.9; temperature: 303 K; ionic strength: 0.01 M

Experiments:

NameSampleSample stateSample conditions
1H-15N HSQCall_samplesnot availableCond_1
HNCACBall_samplesnot availableCond_1
HNCAall_samplesnot availableCond_1
HNCOall_samplesnot availableCond_1
HN(CO)CAall_samplesnot availableCond_1

Software:

NMRPipe v97.027.12.56 - Raw spectral data processing

NMRView v5.0.4 - Data analysis

NMR spectrometers:

  • Varian INOVA 600 MHz

Related Database Links:

BMRB 6275 6276