BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6353

Title: 1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C

Authors: Kobayashi, Masakazu; Siegal, Gregg

Citation: Kobayashi, Masakazu; Siegal, Gregg. "Letter to the Editor: 1H, 15N and 13C resonance assignments of the BRCT Region of the large subunit of human Replication Factor C"  J. Biomol. NMR 31, 183-184 (2005).

Assembly members:
RFC p140 BRCT region, polymer, 106 residues, Formula weight is not available
self - annealing hairpin - dsDNA, polymer, 28 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Eschericia coli

Entity Sequences (FASTA):
RFC p140 BRCT region: KRTNYQAYRSYLNREGPKAL GSKEIPKGAENCLEGLIFVI TGVLESIERDEAKSLIERYG GKVTGNVSKKTNYLVMGRDS GQSKSDKAAALGTKIIDEDG LLNLIR
self - annealing hairpin - dsDNA: CTCGAGGTCGTCATCGACCT CGAGATCA

Data sets:
Data typeCount
1H chemical shifts748
13C chemical shifts321
15N chemical shifts113

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RFC p140 375-480 BRCT region1
2self - annealing hairpin - dsDNA2

Entities:

Entity 1, RFC p140 375-480 BRCT region 106 residues - Formula weight is not available

1   LYSARGTHRASNTYRGLNALATYRARGSER
2   TYRLEUASNARGGLUGLYPROLYSALALEU
3   GLYSERLYSGLUILEPROLYSGLYALAGLU
4   ASNCYSLEUGLUGLYLEUILEPHEVALILE
5   THRGLYVALLEUGLUSERILEGLUARGASP
6   GLUALALYSSERLEUILEGLUARGTYRGLY
7   GLYLYSVALTHRGLYASNVALSERLYSLYS
8   THRASNTYRLEUVALMETGLYARGASPSER
9   GLYGLNSERLYSSERASPLYSALAALAALA
10   LEUGLYTHRLYSILEILEASPGLUASPGLY
11   LEULEUASNLEUILEARG

Entity 2, self - annealing hairpin - dsDNA 28 residues - Formula weight is not available

1   DCDTDCDGDADGDGDTDCDG
2   DTDCDADTDCDGDADCDCDT
3   DCDGDADGDADTDCDA

Samples:

sample_1: RFC p140 BRCT region, [U-15N; U-13C], 0.5 mM; self - annealing hairpin - dsDNA 0.5 mM; Tris-HCl 20 mM; NaCl 5 mM; DTT 1 mM

sample_conditions: pH: 7.5; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
not availablesample_1not availablesample_conditions

Software:

XEASY -

NMR spectrometers:

  • Bruker DMX 600 MHz

Related Database Links:

PDB
DBJ BAE88328 BAF84301 BAG10592
EMBL CAA49475 CAA51260 CAA80355
GB AAA16121 AAA21643 AAA79698 AAA81558 AAB60452
REF NP_001191676 NP_002904 NP_035388 XP_001091287 XP_001140765
SP P35251 P35601