BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6239

Title: Chemical shifts assignments for stem-loop VI of the VS ribozyme.   PubMed: 15328609

Authors: Dieckmann, Thorsten; Flinders, Jeremy

Citation: Flinders, Jeremy; Dieckmann, Thorsten. "The Solution Structure of the VS Ribozyme Active Site Loop Reveals a Dynamic 'Hotspot'"  J. Mol. Biol. 341, 935-949 (2004).

Assembly members:
VSVI RNA, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
VSVI RNA: GGUGACGCCGUAAGGCGCAG CC

Data sets:
Data typeCount
13C chemical shifts139
15N chemical shifts1
1H chemical shifts183

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1VSVI RNA1

Entities:

Entity 1, VSVI RNA 22 residues - Formula weight is not available

1   GGUGACGCCG
2   UAAGGCGCAG
3   CC

Samples:

sample_1: VSVI RNA 1.5 mM

sample_2: VSVI RNA, [U-95% 13C; U-95% 15N], 1.2 mM

sample_3: VSVI RNA, [U-95% 15N], 1.5 mM

Ex-cond_1: pH: 6.0; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
not availablenot availablenot availableEx-cond_1

Software:

XWIN-NMR v3.5, Bruker - Acquisition, Processing

SPARKY v3.106, UCSF - Analysis (Peak Picking)

NMR spectrometers:

  • Bruker DRX 600 MHz

Related Database Links: