BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6115

Title: Structural and Functional Analysis of a picornaviral Internal cis-acting replication element   PubMed: 15314212

Authors: Kaluarachchi, Kumaralal; Thiviyanathan, Varatharasa

Citation: Thiviyanathan, Varatharasa; Yang, Y.; Kaluarachchi, Kumaralal; Rijnbrand, R.; Gorenstein, D.; Lemon, S.. "High resolution Structure of a Picornaviral Internal Cis-acting RNA Replication Element (cre)"  Proc. Natl. Acad. Sci. U.S.A. 101, 12688-12693 (2004).

Assembly members:
Cis-acting replication element, polymer, 34 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: viruses   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Cis-acting replication element: GGUCAUCGUUGAGAAAACGA AACAGACGGUGGCC

Data sets:
  • assigned_chemical_shifts
Data typeCount
1H chemical shifts268

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1cre1

Entities:

Entity 1, cre 34 residues - Formula weight is not available

1   GGUCAUCGUU
2   GAGAAAACGA
3   AACAGACGGU
4   GGCC

Samples:

sample_1: Cis-acting replication element, [U-13C; U-15N], 0.8 – 2.0 mM

ex-cond_1: pH: 6.8; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H-15N HSQCsample_1not availableex-cond_1

Software:

FELIX v2000 - peak assignmnets, volume measurements

NMR spectrometers:

  • Varian UnityPlus 600 MHz
  • Varian UnityPlus 750 MHz

Related Database Links: