BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6094

Title: NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus   PubMed: 15003457

Authors: DSouza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael

Citation: D'Souza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael. "NMR structure of the 101 nucleotide core encapsidation signal of the moloney murine leukemia virus"  J. Mol. Biol. 337, 427-442 (2004).

Assembly members:
single chain of RNA, polymer, 101 residues, Formula weight is not available

Natural source:   Common Name: Moloney Murine Leukemia Virus   Taxonomy ID: 11786   Superkingdom: Viruses   Kingdom: not available   Genus/species: Gammaretrovirus murine leukemia virus

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
single chain of RNA: GGCGGUACUAGUUGAGAAAC UAGCUCUGUAUCUGGUGGAC CCGUGGUGGAACUGUGAAGU UCGGAACACCCGGCCGCAAC CCUGGGAGAGGUCCCAGGGU U

Data sets:
  • assigned_chemical_shifts
Data typeCount
13C chemical shifts578
15N chemical shifts35
1H chemical shifts683

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1psi site monomer1

Entities:

Entity 1, psi site monomer 101 residues - Formula weight is not available

1   GGCGGUACUA
2   GUUGAGAAAC
3   UAGCUCUGUA
4   UCUGGUGGAC
5   CCGUGGUGGA
6   ACUGUGAAGU
7   UCGGAACACC
8   CGGCCGCAAC
9   CCUGGGAGAG
10   GUCCCAGGGU
11   U

Samples:

sample_1: single chain of RNA, [13C; 15N]-Ade, 1.2

sample_2: single chain of RNA, [13C; 15N]-Gua, 1.2

sample_3: single chain of RNA, [13C; 15N]-Cyt, 1.2

sample_4: single chain of RNA, [13C; 15N]-Ura, 1.2

sample_5: single chain of RNA, [15N]-Gua-Ura, 1.2

sample_6: single chain of RNA, [2D]-Ade-Ura-Cyt, 1.2

sample_7: single chain of RNA, [2D]-Ade-Gua-Ura, 1.2

sample_8: single chain of RNA, [2D]-Ade-Gua-Cyt, 1.2

sample_9: single chain of RNA, [2D]-Gua-Cyt-Ura, 1.2

cond-1: pH: 7.0; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablecond-1
2D ROESYnot availablenot availablecond-1
2D HMQCnot availablenot availablecond-1
3D HMQC-NOESYnot availablenot availablecond-1
4d-HMQC NOESY HMQCnot availablenot availablecond-1
2D 1H-15N HSQCnot availablenot availablecond-1
3D HSQC-NOESYnot availablenot availablecond-1

Software:

No software information available

NMR spectrometers:

  • Bruker . 800 MHz
  • Bruker . 600 MHz

Related Database Links: