BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5167

Title: NMR Structure of an AT-Rich DNA with the GAA-Hairpin Loop   PubMed: 11991355

Authors: Ulyanov, N.; Bauer, W.; James, T.

Citation: Ulyanov, N.; Bauer, W.; James, T.. "High-resolution NMR Structure of an AT-rich DNA Sequence"  J. Biomol. NMR 22, 265-280 (2002).

Assembly members:
GAA-Hairpin loop, polymer, 27 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
GAA-Hairpin loop: CCTAATTATAACGAAGTTAT AATTAGG

Data sets:
Data typeCount
1H chemical shifts252

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1AT-Rich DNA with the GAA-Hairpin Loop1

Entities:

Entity 1, AT-Rich DNA with the GAA-Hairpin Loop 27 residues - Formula weight is not available

1   DCDCDTDADADTDTDADTDA
2   DADCDGDADADGDTDTDADT
3   DADADTDTDADGDG

Samples:

sample_1: GAA-Hairpin loop 2 mM; phosphate buffer 30 mM; EDTA 1 mM; H2O 90%; D2O 10%

sample_cond_1: ionic strength: 30 mM; pH: 8.0; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D-NOESYsample_1not availablesample_cond_1
DQF-COSYsample_1not availablesample_cond_1
TOCSYsample_1not availablesample_cond_1

Software:

VNMR v6.1 - collection

NMRPipe v1.8 - processing

SPARKY v3.1 - data analysis

MARDIGRAS v3.2 - iterative matrix relaxation

DYANA v1.5 - refinement

miniCarlo valpha version - refinement

NMR spectrometers:

  • Varian INOVA 600 MHz

Related Database Links: