BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4867

Title: SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA   PubMed: 11118222

Authors: Allain, F.; Bouvet, P.; Dieckmann, T.; Feigon, J.

Citation: Allain, F.; Bouvet, P.; Dieckmann, T.; Feigon, J.. "Molecular Basis of Sequence-specific Recognition of Pre-ribosomal RNA by Nucleolin"  EMBO Journal 19, 6870-6881 (2000).

Assembly members:
SNRE RNA, polymer, 22 residues, Formula weight is not available
NUCLEOLIN RBD12, polymer, 175 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: unclassified   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
SNRE RNA: GGCCGAAAUCCCGAAGUAGG CC
NUCLEOLIN RBD12: GSHMVEGSESTTPFNLFIGN LNPNKSVAELKVAISELFAK NDLAVVDVRTGTNRKFGYVD FESAEDLEKALELTGLKVFG NEIKLEKPKGRDSKKVRAAR TLLAKNLSFNITEDELKEVF EDALEIRLVSQDGKSKGIAY IEFKSEADAEKNLEEKQGAE IDGRSVSLYYTGEKG

Data sets:
Data typeCount
13C chemical shifts628
15N chemical shifts192
1H chemical shifts1340

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SNRE RNA1
2NUCLEOLIN RBD122

Entities:

Entity 1, SNRE RNA 22 residues - Formula weight is not available

1   GGCCGAAAUC
2   CCGAAGUAGG
3   CC

Entity 2, NUCLEOLIN RBD12 175 residues - Formula weight is not available

1   GLYSERHISMETVALGLUGLYSERGLUSER
2   THRTHRPROPHEASNLEUPHEILEGLYASN
3   LEUASNPROASNLYSSERVALALAGLULEU
4   LYSVALALAILESERGLULEUPHEALALYS
5   ASNASPLEUALAVALVALASPVALARGTHR
6   GLYTHRASNARGLYSPHEGLYTYRVALASP
7   PHEGLUSERALAGLUASPLEUGLULYSALA
8   LEUGLULEUTHRGLYLEULYSVALPHEGLY
9   ASNGLUILELYSLEUGLULYSPROLYSGLY
10   ARGASPSERLYSLYSVALARGALAALAARG
11   THRLEULEUALALYSASNLEUSERPHEASN
12   ILETHRGLUASPGLULEULYSGLUVALPHE
13   GLUASPALALEUGLUILEARGLEUVALSER
14   GLNASPGLYLYSSERLYSGLYILEALATYR
15   ILEGLUPHELYSSERGLUALAASPALAGLU
16   LYSASNLEUGLUGLULYSGLNGLYALAGLU
17   ILEASPGLYARGSERVALSERLEUTYRTYR
18   THRGLYGLULYSGLY

Samples:

sample_1: SNRE RNA 1 mM; NUCLEOLIN RBD12, [U-15N; U-13C], 1 mM

sample_2: SNRE RNA, [U-15N; U-13C], 1 mM; NUCLEOLIN RBD12, [U-15N], 1 mM; D2O 100%

sample_cond_1: ionic strength: 150 mM; pH: 6.2; temperature: 303 K

sample_cond_2: ionic strength: 150 mM; pH: 6.2; temperature: 318 K

Experiments:

NameSampleSample stateSample conditions
3D 13C-separated NOESYnot availablenot availablenot available
13C-12C filtered 3Dnot availablenot availablenot available
3D 15N-separated NOESYnot availablenot availablenot available
2D NOESYnot availablenot availablenot available

Software:

X-PLOR v3.841 - data refinement, structure solution

NMR spectrometers:

  • Bruker DRX 600 MHz

Related Database Links:

PDB
GB EGW00584