BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4750

Title: NMR structure of the most conserved RNA motif in Srp RNA

Authors: Schmitz, U.; James, T.; Lukavsky, P.; Walter, P.

Citation: Schmitz, U.; James, T.; Lukavsky, P.; Walter, P.. "Structure of the Most Conserved internal loop in Srp RNA"  Nat. Struct. Biol. 6, 634-638 (1999).

Assembly members:
SRP DOMAIN IV, polymer, 28 residues, 8000 Da.

Natural source:   Common Name: Escherichia coli   Taxonomy ID: 562   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Escherichia coli

Entity Sequences (FASTA):
SRP DOMAIN IV: GGCGUCAGGUCCGGAAGGAA GCAGCGCC

Data sets:
Data typeCount
1H chemical shifts214

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SRP DOMAIN IV1

Entities:

Entity 1, SRP DOMAIN IV 28 residues - 8000 Da.

1   GGCGUCAGGU
2   CCGGAAGGAA
3   GCAGCGCC

Samples:

sample_1: SRP DOMAIN IV 0.25 mM

sample_cond_1: pH: 6.5; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
NOESY,not availablenot availablenot available
COSY,not availablenot availablenot available
SSNOESY,not availablenot availablenot available
TOCSYnot availablenot availablenot available

Software:

AMBER v5.0 - REFINEMENT

SPARKY - STRUCTURE CALCULATION

NMR spectrometers:

  • Varian Unity Plus 600 MHz

Related Database Links: