BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4346

Title: 1H, 13C, and 15N Chemical Shift Assignments for the Regulatory mRNA of the Yeast Ribosomal Protein L30

Authors: Mao, Hongyuan; White, Susan; Williamson, james

Citation: Mao, Hongyuan; White, Susan; Williamson, james. "A Novel Loop-loop Recognition Motif in the Yeast Ribosomal Protein L30 Autoregulatory RNA Complex"  Nat. Struct. Biol. 6, 1139-1147 (1999).

Assembly members:
L30 MRNA, polymer, 33 residues, Formula weight is not available

Natural source:   Common Name: BAKER   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota FUNGI

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
L30 MRNA: GGACCGGAGUGUCGCAAGAC GCAGAGAUGGUCC

Data sets:
Data typeCount
13C chemical shifts193
15N chemical shifts24
1H chemical shifts255

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1L30RNA1

Entities:

Entity 1, L30RNA 33 residues - Formula weight is not available

1   GGACCGGAGU
2   GUCGCAAGAC
3   GCAGAGAUGG
4   UCC

Samples:

SAMPLE_1: L30 MRNA, N/A, 1.8 mM

SAMPLE_2: L30 MRNA, [U-99% 13C; U-99% 15N], 0.9 mM

SAMPLE_3: L30 MRNA, [U-95% 13C; U-99% 15N]-G, 0.5 mM

Ex-cond_1: ionic strength: 0.1 M; pH: 6.0; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions

Software:

NMRPipe -

NMR spectrometers:

  • VARIAN INOVA 600 MHz
  • FBML FBML 500 MHz

Related Database Links: