BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4345

Title: 1H, 13C, and 15N Chemical Shift Assignments for Yeast Ribosomal Protein L30 in Complex with Its mRNA in Solution

Authors: Mao, Hongyuan; White, Susan; Williamson, james

Citation: Mao, Hongyuan; White, Susan; Williamson, james. "A Novel Loop-loop Recognition Motif in the Yeast Ribosomal Protein L30 Autoregulatory RNA Complex"  Nat. Struct. Biol. 6, 1139-1147 (1999).

Assembly members:
YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30, polymer, 104 residues, 11284 Da.
L30N, polymer, 33 residues, 10814 Da.

Natural source:   Common Name: BAKER   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: recombinant technology   Host organism: ESCHERICHIA COLI

Entity Sequences (FASTA):
YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30: APVKSQESINQKLALVIKSG KYTLGYKSTVKSLRQGKSKL IIIAANTPVLRKSELEYYAM LSKTKVYYFQGGNNELGTAV GKLFRVGVVSILEAGDSDIL TTLA
L30N: GGACCGGAGUGUCGCAAGAC GCAGAGAUGGUCC

Data sets:
Data typeCount
13C chemical shifts648
15N chemical shifts138
1H chemical shifts1009

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1L30 PROTEIN1
2L30 MRNA2

Entities:

Entity 1, L30 PROTEIN 104 residues - 11284 Da.

1   ALAPROVALLYSSERGLNGLUSERILEASN
2   GLNLYSLEUALALEUVALILELYSSERGLY
3   LYSTYRTHRLEUGLYTYRLYSSERTHRVAL
4   LYSSERLEUARGGLNGLYLYSSERLYSLEU
5   ILEILEILEALAALAASNTHRPROVALLEU
6   ARGLYSSERGLULEUGLUTYRTYRALAMET
7   LEUSERLYSTHRLYSVALTYRTYRPHEGLN
8   GLYGLYASNASNGLULEUGLYTHRALAVAL
9   GLYLYSLEUPHEARGVALGLYVALVALSER
10   ILELEUGLUALAGLYASPSERASPILELEU
11   THRTHRLEUALA

Entity 2, L30 MRNA 33 residues - 10814 Da.

1   GGACCGGAGU
2   GUCGCAAGAC
3   GCAGAGAUGG
4   UCC

Samples:

SAMPLE_1: YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30, [U-15N], 1.3 mM; L30N 1.3 mM

SAMPLE_2: YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30, [U-99% 13C; U-99% 15N], 1.7 mM; L30N 1.3 mM

SAMPLE_3: YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30, [U-99% 13C; U-99% 15N], 0.9 mM; L30N 1.3 mM

SAMPLE_4: YEAST (SACCHAROMYCES CEREVISIAE) RIBOSOMAL PROTEIN L30 0.5 mM; L30N, [U-99% 13C; U-99% 15N]-G, 1.3 mM

Ex-cond_1: ionic strength: 0.10 M; pH: 6.5; temperature: 303 K

Ex-cond_2: ionic_strength: 0.10 M; pH: 6.0 na; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions

Software:

NMRPIPE -

NMR spectrometers:

  • VARIAN INOVA 750 MHz
  • VARIAN INOVA 600 MHz

Related Database Links:

BMRB 4339
PDB
DBJ GAA23357
EMBL CAA96731 CAY79728 CCD24685 CEP64155
GB AAA35005 AHY79340 AJP38758 AJR76078 AJR76578
REF NP_011485 XP_003669928
SP P14120
TPG DAA08069