BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4253

Title: An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2

Authors: Holland, Jason; Hansen, Mark; Du, Zhiua; Hoffman, Dave

Citation: Holland, Jason; Hansen, Mark; Du, Zhiua; Hoffman, Dave. "An Examination of Coaxial Stacking of Helical Stems in a Pseudoknot Motif: the Gene 32 Messenger RNA Pseudoknot of Bacteriophage T2"  RNA 5, 257-271 (1999).

Assembly members:
Gene 32 mRNA Pseudoknot of Bacteriophage T2, polymer, 36 residues, Formula weight is not available

Natural source:   Common Name: Bacteriophage T2   Taxonomy ID: 10664   Superkingdom: not available   Kingdom: not available   Genus/species: T4-like phages coliphage T2

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Gene 32 mRNA Pseudoknot of Bacteriophage T2: GCUGACCAGCUAUGAGGUCA UACAUCGUCAUAGCAC

Data sets:
Data typeCount
13C chemical shifts162
15N chemical shifts93
1H chemical shifts221

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1T2 RNA Pseudoknot1

Entities:

Entity 1, T2 RNA Pseudoknot 36 residues - Formula weight is not available

1   GCUGACCAGC
2   UAUGAGGUCA
3   UACAUCGUCA
4   UAGCAC

Samples:

sample_one: Gene 32 mRNA Pseudoknot of Bacteriophage T2, [U-100% 15N], 10 mg/ul

sample_two: Gene 32 mRNA Pseudoknot of Bacteriophage T2 11 mg/ul

sample_three: Gene 32 mRNA Pseudoknot of Bacteriophage T2 11 mg/ul

sample_conditions_one: pH: 6.4; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H NOESYsample_onenot availablesample_conditions_one
1H-13C CT-HSQCsample_onenot availablesample_conditions_one
1H-15N HMBCsample_onenot availablesample_conditions_one
1H JR-NOESYsample_onenot availablesample_conditions_one
1H COSYsample_onenot availablesample_conditions_one
1H TOCSYsample_onenot availablesample_conditions_one
1H-13C HMQCNOESYsample_onenot availablesample_conditions_one
1H-13C HCCH-COSYsample_onenot availablesample_conditions_one

Software:

FELIX v2.0 - chemical shift assignments and NOE crosspeak intensities

NMR spectrometers:

  • Varian UNITY-Inova . MHz

Related Database Links: