BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4125

Title: The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase P RNA Using Its Non-uniformly Deuterium Labelled Counterpart [the 'NMR-window' concept]

Authors: Glemarec, C.; Kufel, J.; Foldesi, A.; Maltseva, T.; Sandstrom, A.; Kirsebom, L.; Chattopadhyaya, J.

Citation: Glemarec, C.; Kufel, J.; Foldesi, A.; Maltseva, T.; Sandstrom, A.; Kirsebom, L.; Chattopadhyaya, J.. "The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase P RNA Using Its Non-uniformly Deuterium Labelled Counterpart [the 'NMR-window' concept]"  Nucleic Acids Res. 24, 2022-2035 (1996).

Assembly members:
31mer_RNA_1, polymer, 31 residues, Formula weight is not available

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
31mer_RNA_1: GGCCAAAUAGGGGCUUCGGC CCGGGUAGGCU

Data sets:
Data typeCount
1H chemical shifts192

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
131mer_RNA_11

Entities:

Entity 1, 31mer_RNA_1 31 residues - Formula weight is not available

1   GGCCAAAUAG
2   GGGCUUCGGC
3   CCGGGUAGGC
4   U

Samples:

sample_one: 31mer_RNA_1, [U-99%-2H]-C, 1 mM; NaHPO4 10 mM; NaCl 50 mM; EDTA 0.1 mM

sample_two: 31mer_RNA_1 1 mM; NaHPO4 10 mM; NaCl 50 mM; EDTA 0.1 mM

sample_conditions_one: pH: 6.2; temperature: 299 K

Experiments:

NameSampleSample stateSample conditions
not availablenot availablenot availablenot available

Software:

No software information available

NMR spectrometers:

  • unknown unknown 0 MHz

Related Database Links: