BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 36168

Title: Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence   PubMed: 29666187

Authors: Liu, Y.; Lan, W.

Citation: Liu, Yaping; Lan, Wenxian; Wang, Chunxi; Cao, Chunyang. "A putative G-quadruplex structure in the proximal promoter of VEGFR-2 has implications for drug design to inhibit tumor angiogenesis."  J. Biol. Chem. 293, 8947-8955 (2018).

Assembly members:
entity_1, polymer, 24 residues, 7563.837 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGTACCCGGGTGAGGTGCG GGGT

Data sets:
Data typeCount
13C chemical shifts11
1H chemical shifts236
31P chemical shifts24

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 24 residues - 7563.837 Da.

1   DGDGDGDTDADCDCDCDGDG
2   DGDTDGDADGDGDTDGDCDG
3   DGDGDGDT

Samples:

sample_1: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3') 1 mM; potassium chloride 80 mM; potassium phosphate 20 mM; H2O 90%; D2O, [U-2H], 10%

sample_2: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3') 1.0 mM; potassium chloride 80 mM; potassium phosphate 20 mM; D2O, [U-2H], 100%

sample_3: DNA (5'-D(*GP*GP*GP*TP*AP*CP*CP*CP*GP*GP*GP*TP*GP*AP*GP*GP*TP*GP*CP*GP*GP*GP*GP*T)-3'), [U-13C; U-15N]-Gua, 0.1 mM; potassium chloride 80 mM; potassium phosphate 20 mM; H2O 90%; D2O, [U-2H], 10%

sample_conditions_1: ionic strength: 100 mM; pH: 6.8; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_1anisotropicsample_conditions_1
2D DQF-COSYsample_1anisotropicsample_conditions_1
2D 1H-13C HSQCsample_1anisotropicsample_conditions_1
2D 1H-1H NOESYsample_2anisotropicsample_conditions_1

Software:

CNS, Brunger A.T. et.al. - refinement

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz
  • Bruker Avance 600 MHz

Related Database Links: