BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 36160

Title: Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex   PubMed: 30158518

Authors: Liu, W.; Zhong, Y.; Liu, L.; Zeng, W.; Wang, F.; Yang, D.; Mao, Z.

Citation: Liu, Wenting; Zhong, Yi-Fang; Liu, Liu-Yi; Shen, Chu-Tong; Zeng, Wenjuan; Wang, Fuyi; Yang, Danzhou; Mao, Zong-Wan. "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding"  Nat. Commun. 9, 3496-3496 (2018).

Assembly members:
G-quadruplex DNA (26-MER), polymer, 26 residues, 8236.324 Da.
4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]-N,N-bis[4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]phenyl]aniline, non-polymer, 1371.303 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
G-quadruplex DNA (26-MER): AAAGGGTTAGGGTTAGGGTT AGGGAA

Data sets:
Data typeCount
1H chemical shifts388

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_1, 11
2entity_1, 21
3entity_9F0, 12
4entity_9F0, 22
5entity_9F0, 32
6entity_9F0, 42

Entities:

Entity 1, entity_1, 1 26 residues - 8236.324 Da.

1   DADADADGDGDGDTDTDADG
2   DGDGDTDTDADGDGDGDTDT
3   DADGDGDGDADA

Entity 2, entity_9F0, 1 - C45 H63 N13 Pt3 - 1371.303 Da.

1   9F0

Samples:

sample_1: G-quadruplex DNA (26-MER), [U-15N]-Thy, 1 mM; Pt-tripod 3 mM; potassium chloride 70 mM; potassium phosphate 25 mM; H2O 90%; D2O, [U-2H], 10%

sample_2: G-quadruplex DNA (26-MER) 1 mM; Pt-tripod 3 mM; potassium chloride 70 mM; potassium phosphate 25 mM; H2O 90%; D2O, [U-2H], 10%

sample_conditions_1: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 288 K

sample_conditions_3: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_2anisotropicsample_conditions_1
2D 1H-1H COSYsample_2anisotropicsample_conditions_1
2D 1H-1H NOESYsample_2anisotropicsample_conditions_2
2D 1H-1H TOCSYsample_2anisotropicsample_conditions_2
2D 1H-1H COSYsample_2anisotropicsample_conditions_2
2D 1H-15N HSQCsample_1isotropicsample_conditions_3

Software:

DISCOVER, Accelrys Software Inc. - structure calculation

SPARKY, Goddard - chemical shift assignment, peak picking

TOPSPIN, Bruker Biospin - processing

X-PLOR, Brunger - refinement

NMR spectrometers:

  • Bruker AvanceIII 600 MHz
  • Bruker AvanceIII 700 MHz

Related Database Links: