BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 36159

Title: Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex   PubMed: 30158518

Authors: Liu, W.; Zhong, Y.; Liu, L.; Zeng, W.; Wang, F.; Yang, D.; Mao, Z.

Citation: Liu, Wenting; Zhong, Yi-Fang; Liu, Liu-Yi; Shen, Chu-Tong; Zeng, Wenjuan; Wang, Fuyi; Yang, Danzhou; Mao, Zong-Wan. "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding"  Nat. Commun. 9, 3496-3496 (2018).

Assembly members:
G-quadruplex DNA (26-MER), polymer, 26 residues, 8236.324 Da.
4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]-N,N-bis[4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]phenyl]aniline, non-polymer, 1371.303 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
G-quadruplex DNA (26-MER): AAAGGGTTAGGGTTAGGGTT AGGGAA

Data sets:
Data typeCount
1H chemical shifts260

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_9F02

Entities:

Entity 1, entity_1 26 residues - 8236.324 Da.

1   DADADADGDGDGDTDTDADG
2   DGDGDTDTDADGDGDGDTDT
3   DADGDGDGDADA

Entity 2, entity_9F0 - C45 H63 N13 Pt3 - 1371.303 Da.

1   9F0

Samples:

sample_1: G-quadruplex DNA (26-MER) 1.0 mM; Pt-tripod 1.0 mM; potassium chloride 70 mM; potassium phosphate 25 mM; H2O 90%; D2O, [U-2H], 10%

sample_conditions_1: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_1anisotropicsample_conditions_1
2D 1H-1H COSYsample_1anisotropicsample_conditions_1
2D 1H-1H NOESYsample_1anisotropicsample_conditions_2
2D 1H-1H TOCSYsample_1anisotropicsample_conditions_2
2D 1H-1H COSYsample_1anisotropicsample_conditions_2

Software:

DISCOVER, Accelrys Software Inc. - refinement

SPARKY, Goddard - chemical shift assignment, peak picking

TOPSPIN, Bruker Biospin - processing

X-PLOR, Brunger - refinement, structure calculation

NMR spectrometers:

  • Bruker AVIII 600 MHz
  • Bruker AVIII 700 MHz

Related Database Links: