BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34467

Title: Pre-folded structures govern folding pathways of human telomeric G-quadruplexes

Deposition date: 2019-12-17 Original release date: 2020-01-02

Authors: Wang, B.; Frelih, T.; Plavec, J.; Sket, P.

Citation: Baifan, W.; Tjasa, F.; Janez, P.; Primoz, S.. "Pre-folded structures govern folding pathways of human telomeric G-quadruplexes"  . ., .-..

Assembly members:
entity_1, polymer, 23 residues, 7287.690 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TAGGGTTAGGGTTAGGGTTA GGG

Data sets:
Data typeCount
1H chemical shifts50

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 23 residues - 7287.690 Da.

1   DTDADGDGDGDTDTDADGDG
2   DGDTDTDADGDGDGDTDTDA
3   DGDGDG

Samples:

sample_1: GCN, [8% 13C; 8% 15N], 1 mM

sample_2: GCN 1 mM

sample_conditions_1: ionic strength: 0 mM; pH: 5; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
1D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D NOESYsample_2isotropicsample_conditions_1

Software:

VNMR, Varian - processing

Sparky, Goddard - chemical shift assignment, peak picking

Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation

NMR spectrometers:

  • Agilent Agilent Agilent Technologies DD2 600 MHz NMR spectrometer 600 MHz