BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34435

Title: Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure   PubMed: 31750579

Authors: Kotar, A.; Kocman, V.; Plavec, J.

Citation: Plavec, J.; Kocman, V.; Kotar, A.. "Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure."  Chemistry ., .-. (2019).

Assembly members:
entity_1, polymer, 31 residues, 9888.333 Da.
entity_LWQ, non-polymer, 449.504 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGAGCGAGGGAGCGAGGGA GCGAGGGAGCG

Data sets:
Data typeCount
1H chemical shifts235

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 31 residues - 9888.333 Da.

1   DGDGDGDADGDCDGDADGDG
2   DGDADGDCDGDADGDGDGDA
3   DGDCDGDADGDGDGDADGDC
4   DG

Entity 2, entity_2 - C27 H23 N5 O2 - 449.504 Da.

1   LWQ

Samples:

sample_1: VK2 0.35 mM; LiCl 100 mM

sample_2: VK2, 10% Residue-specific labrelling, 0.35 mM; LiCl 100 mM

sample_conditions_1: ionic strength: 100 mM; pH: 6.0; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1

Software:

VNMR, Varian - chemical shift assignment, collection, processing

Sparky, Goddard - data analysis

Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

NMR spectrometers:

  • Agilent ASC Agilent Technologies Superconducting Magnet 600 MHz
  • Agilent Oxford Superconducting Magnet 800 MHz

Related Database Links: