BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34421

Title: Solution structure of Staufen1 dsRBD3+4 - hARF1 SBS dsRNA complex.   PubMed: 31875226

Authors: Yadav, D.; Lukavsky, P.

Citation: Yadav, D.; Zigackova, D.; Zlobina, M.; Klumpler, T.; Beaumont, C.; Kubickova, M.; Vanacova, S.; Lukavsky, P.. "Staufen1 reads out structure and sequence features in ARF1 dsRNA for target recognition."  Nucleic Acids Res. ., .-. (2019).

Assembly members:
entity_1, polymer, 177 residues, 19771.119 Da.
entity_2, polymer, 34 residues, 10899.479 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli BL21(DE3)

Entity Sequences (FASTA):
entity_1: GSHMKSEISQVFEIALKRNL PVNFEVARESGPPHMKNFVT KVSVGEFVGEGEGKSKKISK KNAAIAVLEELKKLPPLPAV ERVKPRIKKKTKPIVKPQTS PEYGQGINPISRLAQIQQAK KEKEPEYTLLTERGLPRRRE FVMQVKVGNHTAEGTGTNKK VAKRNAAENMLEILGFK
entity_2: GGCAGAAGCUGCCUCUUCGG AGGCAGUUUCUGCC

Data sets:
Data typeCount
13C chemical shifts848
15N chemical shifts156
1H chemical shifts1381

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 177 residues - 19771.119 Da.

1   GLYSERHISMETLYSSERGLUILESERGLN
2   VALPHEGLUILEALALEULYSARGASNLEU
3   PROVALASNPHEGLUVALALAARGGLUSER
4   GLYPROPROHISMETLYSASNPHEVALTHR
5   LYSVALSERVALGLYGLUPHEVALGLYGLU
6   GLYGLUGLYLYSSERLYSLYSILESERLYS
7   LYSASNALAALAILEALAVALLEUGLUGLU
8   LEULYSLYSLEUPROPROLEUPROALAVAL
9   GLUARGVALLYSPROARGILELYSLYSLYS
10   THRLYSPROILEVALLYSPROGLNTHRSER
11   PROGLUTYRGLYGLNGLYILEASNPROILE
12   SERARGLEUALAGLNILEGLNGLNALALYS
13   LYSGLULYSGLUPROGLUTYRTHRLEULEU
14   THRGLUARGGLYLEUPROARGARGARGGLU
15   PHEVALMETGLNVALLYSVALGLYASNHIS
16   THRALAGLUGLYTHRGLYTHRASNLYSLYS
17   VALALALYSARGASNALAALAGLUASNMET
18   LEUGLUILELEUGLYPHELYS

Entity 2, entity_2 34 residues - 10899.479 Da.

1   GGCAGAAGCU
2   GCCUCUUCGG
3   AGGCAGUUUC
4   UGCC

Samples:

sample_1: Staufen1 dsRBD4, [U-15N], 310 uM; hARF1, Unlabelled, 310 uM

sample_2: Staufen1 dsRBD4, [U-13C; U-15N], 405 uM; hARF1, Unlabelled, 405 uM

sample_3: hARF1, Unlabelled, 310 uM

sample_4: hARF1, [U-13C], 478 uM

sample_5: Staufen1 dsRBD4, [U-15N], 354 uM; hARF1, [U-13C], 354 uM

sample_6: Staufen1 dsRDB4, [U-13C; U-15N], 451 uM; hARF1, Unlabelled, 451 uM

sample_7: hARF1, Unlabelled, 310 uM

sample_8: Staufen1 dsRBD3, [U-15N], 417 uM; hARF1, Unlabelled, 417 uM

sample_9: hARF1, Unlabelled, 458 uM; Staufen1 dsRBD3, [U-13C; U-15N], 458 uM

sample_10: hARF1, Unlabelled, 458 uM; Staufen1 dsRBD3, [U-13C; U-15N], 458 uM

sample_11: Staufen1 dsRBD4, Unlabelled, 157 uM; hARF1, Unlabelled, 157 uM; Staufen1 dsRBD3, [U-13C; U-15N], 157 uM

sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_2isotropicsample_conditions_1
3D HNCAsample_2isotropicsample_conditions_1
3D HNCOsample_2isotropicsample_conditions_1
3D CBCA(CO)NHsample_2isotropicsample_conditions_1
3D HNCACBsample_2isotropicsample_conditions_1
3D HBHA(CO)NHsample_2isotropicsample_conditions_1
3D HcccoNH-TOCSYsample_2isotropicsample_conditions_1
3D CccoNH-TOCSYsample_2isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_2isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_2isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
2D 1H-1H, 13C 2F-filtered NOESYsample_6isotropicsample_conditions_1
3D 13C 1F-filtered 2F-edited HSQC-NOESYsample_6isotropicsample_conditions_1
3D 1H-13C NOESY ribosesample_5isotropicsample_conditions_1
2D 1H-1H TOCSYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
3D HCCH-TOCSYsample_4isotropicsample_conditions_1
3D 1H-13C NOESYsample_4isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_4isotropicsample_conditions_1
2D 13C 1F-filtered 2F-filtered NOESYsample_6isotropicsample_conditions_1
2D 1H-13C HSQCsample_5isotropicsample_conditions_1
2D 1H-1H TOCSYsample_7isotropicsample_conditions_1
2D 1H-1H NOESYsample_7isotropicsample_conditions_1
3D HCCH-COSY aromaticsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_8isotropicsample_conditions_1
2D 1H-15N HSQCsample_8isotropicsample_conditions_1
2D 1H-15N HSQCsample_8isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_9isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_9isotropicsample_conditions_1
3D HNCAsample_9isotropicsample_conditions_1
3D HNCOsample_9isotropicsample_conditions_1
3D CBCA(CO)NHsample_9isotropicsample_conditions_1
3D HNCACBsample_9isotropicsample_conditions_1
3D HBHA(CO)NHsample_9isotropicsample_conditions_1
3D HA(CO)NHsample_9isotropicsample_conditions_1
3D HcccoNH-TOCSYsample_9isotropicsample_conditions_1
3D CccoNH-TOCSYsample_9isotropicsample_conditions_1
3D HCCH-TOCSYsample_10isotropicsample_conditions_1
3D HCCH-TOCSYsample_10isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_9isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_9isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_10isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_10isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_9isotropicsample_conditions_1
3D 1H-15N NOESYsample_8isotropicsample_conditions_1
2D 1H-1H, 13C 2F-filtered NOESYsample_11isotropicsample_conditions_1
2D 1H-1H, 13C 1F-filtered 2F-filtered NOESYsample_11isotropicsample_conditions_1
3D 13C 1F-filtered 2F-edited HSQC-NOESYsample_11isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_6isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_4isotropicsample_conditions_1
2D 1H-13C HSQC ribosesample_5isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_5isotropicsample_conditions_1

Software:

Amber vAMBER14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

CYANA vcyana-3.98.5, Guntert, Mumenthaler and Wuthrich - structure calculation

CARA vcara_1.8.4, Keller, Damberger and Wuthrich - chemical shift assignment, peak picking

Sparky vSPARKY3, Goddard and Kneller - chemical shift assignment, peak picking

ATNOS-CANDID vUNIO 2.0.3, Herrmann and Guntert - structure calculation

TopSpin vTOPSPIN3.2, Bruker Biospin - collection, processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

PROCHECK / PROCHECK-NMR, Laskowski, MacArthur, Smith, Jones, Hutchinson, Morris, Moss and Thornton - refinement

NMR spectrometers:

  • Bruker AVANCE III 700 MHz
  • Bruker AVANCE III 850 MHz
  • Bruker AVANCE III 950 MHz

Related Database Links: