BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34332

Title: Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet   PubMed: 30657306

Authors: Bielskute, S.; Plavec, J.; Podbevsek, P.

Citation: Bielskute, S.; Plavec, J.; Podbevsek, P.. "Impact of Oxidative Lesions on the Human Telomeric G-quadruplex"  J. Am. Chem. Soc. 141, 2594-2603 (2019).

Assembly members:
entity_1, polymer, 24 residues, 7607.883 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TTGGGTTAGGGTTAGGGTTA XGGA

Data sets:
Data typeCount
1H chemical shifts157

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 24 residues - 7607.883 Da.

1   DTDTDGDGDGDTDTDADGDG
2   DGDTDTDADGDGDGDTDTDA
3   8OGDGDGDA

Samples:

sample_1: DNA 1 ± 0.2 mM; potassium phosphate buffer 20 mM; KCl 70 mM

sample_conditions_1: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1

Software:

CcpNMR, CCPN - chemical shift assignment

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation

NMR spectrometers:

  • Agilent DDR2 800 MHz

Related Database Links: