BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34321

Title: NMR solution structure of the C/D box snoRNA U14   PubMed: 30914254

Authors: Chagot, M.; Quinternet, M.; Rothe, B.; Charpentier, B.; Coutant, J.; Manival, X.; Lebars, I.

Citation: Chagot, M.; Quinternet, M.; Rothe, B.; Charpentier, B.; Coutant, J.; Manival, X.; Lebars, I.. "The yeast C/D box snoRNA U14 adopts a "weak" K-turn like conformation recognized by the Snu13 core protein in solution."  Biochimie ., .-. (2019).

Assembly members:
entity_1, polymer, 31 residues, 9998.949 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
entity_1: GGCACGGUGAUGACCUUCGG GUCUGAGUGCC

Data sets:
Data typeCount
13C chemical shifts207
15N chemical shifts77
1H chemical shifts242
31P chemical shifts11

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 31 residues - 9998.949 Da.

1   GGCACGGUGA
2   UGACCUUCGG
3   GUCUGAGUGC
4   C

Samples:

sample_1: RNA (31-MER)_unlabel 500 uM; RNA (31-MER)_label, [U-99% 13C; U-99% 15N], 500 uM; NaCl 150 mM

sample_2: RNA (31-MER)_unlabel 500 uM; RNA (31-MER)_label, [U-99% 13C; U-99% 15N], 500 uM; NaCl 150 mM

sample_conditions_1: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 288 K

sample_conditions_3: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 293 K

sample_conditions_4: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K

sample_conditions_5: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K

sample_conditions_6: ionic strength: 150 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_4
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_2
2D 1H-15N HSQCsample_1isotropicsample_conditions_4
2D 1H-13C HSQCsample_1isotropicsample_conditions_4
2D 1H-15N HSQCsample_1anisotropicsample_conditions_6
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
2D 1H-1H NOESYsample_2isotropicsample_conditions_4
2D 1H-1H NOESYsample_2isotropicsample_conditions_5
2D MLEVsample_2isotropicsample_conditions_3
2D MLEVsample_2isotropicsample_conditions_4
2D MLEVsample_2isotropicsample_conditions_5
2D 1H-13C HSQCsample_2isotropicsample_conditions_3
2D HNN COSYsample_1isotropicsample_conditions_1
2D HNN COSYsample_1isotropicsample_conditions_2
2D HNN COSYsample_1isotropicsample_conditions_3
2D 1H-13C HSQCsample_2isotropicsample_conditions_4
2D 1H-13C HSQCsample_2isotropicsample_conditions_5
2D 1H-13C HSQCsample_2anisotropicsample_conditions_6
2D DQF-COSYsample_2isotropicsample_conditions_4
2D HCNsample_2isotropicsample_conditions_4
3D HCCH-TOCSYsample_2isotropicsample_conditions_4
3D HCPsample_2isotropicsample_conditions_4
2D HPCOSYsample_2isotropicsample_conditions_4
2D HCCsample_2isotropicsample_conditions_4

Software:

CNS, Brunger A. T. et.al., Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure calculation

TOPSPIN, Bruker Biospin - processing

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker AVANCE NEO 500 MHz

Related Database Links: