BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34269

Title: Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure   PubMed: 30590801

Authors: Kotar, A.; Rigo, R.; Sissi, C.; Plavec, J.

Citation: Kotar, A.; Rigo, R.; Sissi, C.; Plavec, J.. "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure."  Nucleic Acids Res. 47, 2641-2653 (2019).

Assembly members:
entity_1, polymer, 22 residues, 6940.439 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGCGAGGAGGGGCGTGGCCG GC

Data sets:
Data typeCount
1H chemical shifts193

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 22 residues - 6940.439 Da.

1   DGDGDCDGDADGDGDADGDG
2   DGDGDCDGDTDGDGDCDCDG
3   DGDC

Samples:

sample_5: DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3'), [10% 13C; 10% 15N], 0.5 mM; potassium chloride 100 mM; potassium phosphate 20 mM

sample_6: DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3') 0.4 mM; potassium chloride 100 mM; potassium phosphate 20 mM

sample_7: DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3') 0.4 mM; potassium chloride 100 mM; potassium phosphate 20 mM

sample_8: DNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3') 0.5 mM; potassium chloride 100 mM; potassium phosphate 20 mM

sample_conditions_1: ionic strength: 100 mM; pH: 7.4; pressure: 1 atm; temperature: 310 K

sample_conditions_2: ionic strength: 100 mM; pH: 7.8 pD; pressure: 1 atm; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_8isotropicsample_conditions_1
2D 1H-1H NOESYsample_8isotropicsample_conditions_1
1D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_5isotropicsample_conditions_1
2D 1H-1H TOCSYsample_7isotropicsample_conditions_2
2D 1H-13C HSQC aromaticsample_6isotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_5isotropicsample_conditions_1
2D DQF-COSYsample_7isotropicsample_conditions_2
2D 1H-1H NOESYsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_7isotropicsample_conditions_2

Software:

VNMR v3.2A, Varian - collection, processing

SPARKY v3.114, Goddard - chemical shift assignment, peak picking

AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

NMR spectrometers:

  • Varian Uniform NMR System 800 MHz
  • Varian Uniform NMR System 600 MHz

Related Database Links: