BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34259

Title: Solution structure of FUS-RRM bound to stem-loop RNA   PubMed: 30581145

Authors: Loughlin, F.; Allain, F.

Citation: Loughlin, F.; Lukavsky, P.; Kazeeva, T.; Reber, S.; Hock, E.; Colombo, M.; Von Schroetter, C.; Pauli, P.; Clery, A.; Muhlemann, O.; Polymenidou, M.; Ruepp, M.; Allain, F.. "The Solution Structure of FUS Bound to RNA Reveals a Bipartite Mode of RNA Recognition with Both Sequence and Shape Specificity."  Mol. Cell 73, 490-504 (2019).

Assembly members:
entity_1, polymer, 102 residues, 11289.521 Da.
entity_2, polymer, 23 residues, 7286.336 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity_1: GSHMDNSDNNTIFVQGLGEN VTIESVADYFKQIGIIKTNK KTGQPMINLYTDRETGKLKG EATVSFDDPPSAKAAIDWFD GKEFSGNPIKVSFATRRADF NR
entity_2: GGCAGAUUACAAUUCUAUUU GCC

Data typeCount
13C chemical shifts479
15N chemical shifts120
1H chemical shifts901

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 102 residues - 11289.521 Da.

1   GLYSERHISMETASPASNSERASPASNASN
2   THRILEPHEVALGLNGLYLEUGLYGLUASN
3   VALTHRILEGLUSERVALALAASPTYRPHE
4   LYSGLNILEGLYILEILELYSTHRASNLYS
5   LYSTHRGLYGLNPROMETILEASNLEUTYR
6   THRASPARGGLUTHRGLYLYSLEULYSGLY
7   GLUALATHRVALSERPHEASPASPPROPRO
8   SERALALYSALAALAILEASPTRPPHEASP
9   GLYLYSGLUPHESERGLYASNPROILELYS
10   VALSERPHEALATHRARGARGALAASPPHE
11   ASNARG

Entity 2, entity_2 23 residues - 7286.336 Da.

1   GGCAGAUUAC
2   AAUUCUAUUU
3   GCC

Samples:

sample_1: FUS-RRM, [U-99% 13C; U-99% 15N], 0.8 mM; RNA stem loop, [U-99% 15N], 0.8 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM

sample_2: FUS-RRM, [U-99% 13C; U-99% 15N], 0.8 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 15N], 0.8 mM

sample_3: FUS-RRM, [U-99% 15N], 1 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 13C; U-99% 15N], 0.8 mM

sample_4: FUS-RRM, [U-99% 15N], 1.0 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 13C; U-99% 15N], 0.8 mM

sample_5: FUS-RRM, [U-99% 15N], 1.0 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 15N], 1.0 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 Pa; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
3D 1H-13C NOESY aromaticsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_4isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_4isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1

Software:

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation

SPARKY, Goddard - data analysis

CANDID, Herrmann, Guntert and Wuthrich - peak picking

TOPSPIN, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker Avance 900 MHz
  • Bruker AvanceIII 700 MHz

Related Database Links: