BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34221

Title: The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex

Authors: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.

Citation: Santana, A.; Serrano, I.; Montalvillo-Jimenez, L.; Corzana, F.; Bastida, A.; Jimenez-Barbero, J.; Gonzalez, C.; Asensio, J.. "Minimalistic scaffolds for the selective recognition of Quad-ruplex-Duplex Junctions: Targeting the G4 Hot-Spot"  . ., .-..

Assembly members:
entity_1, polymer, 27 residues, 8445.403 Da.
entity_D5B, non-polymer, 236.312 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGTTGGCGCGAAGCATTCGC GGGTTGG

Data sets:
Data typeCount
1H chemical shifts233

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 27 residues - 8445.403 Da.

1   DGDGDTDTDGDGDCDGDCDG
2   DADADGDCDADTDTDCDGDC
3   DGDGDGDTDTDGDG

Entity 2, entity_2 - C16 H16 N2 - 236.312 Da.

1   D5B

Samples:

sample_1: JQ2 0.5 mM; KPi 20 mM; KCl 20 mM

sample_conditions_1: ionic strength: 40 mM; pH: 6.9; pressure: 1 atm; temperature: 278 K

sample_conditions_2: ionic strength: 40 mM; pH: 6.9; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
2D 1H-1H TOCSYsample_1isotropicsample_conditions_2

Software:

TOPSPIN, Bruker Biospin - collection, processing

SPARKY, Goddard - chemical shift assignment

CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: