BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34103

Title: Structure of TRBP dsRBD 1 and 2 in complex with a 19 bp siRNA (Complex B)   PubMed: 29449323

Deposition date: 2017-02-23 Original release date: 2018-02-19

Authors: Masliah, G.; Maris, C.; Allain, H.

Citation: Masliah, G.; Maris, C.; Koenig, L.; Yulikov, M.; Aeschimann, F.; Malinowska, A.; Mabille, J.; Weiler, J.; Holla, A.; Meisner-Kober, N.; Meisner-Kober, N.; Schuler, B.; Jeschke, G.; Allain, H.. "Structural basis of siRNA recognition by TRBP double-stranded RNA binding domains"  Embo J. 37, e97089-e97089 (2018).

Assembly members:
entity_1, polymer, 215 residues, 23012.332 Da.
entity_2, polymer, 21 residues, 6534.828 Da.
entity_3, polymer, 21 residues, 6747.062 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity_1: GGSLPSIEQMLAANPGKTPI SLLQEYGTRIGKTPVYDLLK AEGQAHQPNFTFRVTVGDTS CTGQGPSKKAAKHKAAEVAL KHLKGGSMLEPALEDSSSFS PLDSSLPEDIPVFTAAAAAT PVPSVVLTRSPPMELQPPVS PQQSECNPVGALQELVVQKG WRLPEYTVTQESGPAHRKEF TMTCRVERFIEIGSGTSKKL AKRNAAAKMLLRVHT
entity_2: UUAAUUAUCUAUUCCGUACU U
entity_3: GUACGGAAUAGAUAAUUAAU U

Data sets:
Data typeCount
13C chemical shifts484
15N chemical shifts182
1H chemical shifts1076

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22
3entity_33

Entities:

Entity 1, entity_1 215 residues - 23012.332 Da.

1   GLYGLYSERLEUPROSERILEGLUGLNMET
2   LEUALAALAASNPROGLYLYSTHRPROILE
3   SERLEULEUGLNGLUTYRGLYTHRARGILE
4   GLYLYSTHRPROVALTYRASPLEULEULYS
5   ALAGLUGLYGLNALAHISGLNPROASNPHE
6   THRPHEARGVALTHRVALGLYASPTHRSER
7   CYSTHRGLYGLNGLYPROSERLYSLYSALA
8   ALALYSHISLYSALAALAGLUVALALALEU
9   LYSHISLEULYSGLYGLYSERMETLEUGLU
10   PROALALEUGLUASPSERSERSERPHESER
11   PROLEUASPSERSERLEUPROGLUASPILE
12   PROVALPHETHRALAALAALAALAALATHR
13   PROVALPROSERVALVALLEUTHRARGSER
14   PROPROMETGLULEUGLNPROPROVALSER
15   PROGLNGLNSERGLUCYSASNPROVALGLY
16   ALALEUGLNGLULEUVALVALGLNLYSGLY
17   TRPARGLEUPROGLUTYRTHRVALTHRGLN
18   GLUSERGLYPROALAHISARGLYSGLUPHE
19   THRMETTHRCYSARGVALGLUARGPHEILE
20   GLUILEGLYSERGLYTHRSERLYSLYSLEU
21   ALALYSARGASNALAALAALALYSMETLEU
22   LEUARGVALHISTHR

Entity 2, entity_2 21 residues - 6534.828 Da.

1   UUAAUUAUCU
2   AUUCCGUACU
3   U

Entity 3, entity_3 21 residues - 6747.062 Da.

1   GUACGGAAUA
2   GAUAAUUAAU
3   U

Samples:

sample_1: dsRBD1, [U-100% 13C; U-100% 15N], 1 mM; EL86 1 mM

sample_2: EL86 1 mM; dsRBD2, [U-100% 13C; U-100% 15N], 1 mM

sample_3: EL86 1 mM; dsRBD12, [U-100% 13C; U-100% 15N; U-80% 2H], 1 mM

sample_4: EL86 1 mM; dsRBD12, [U-100% 13C; U-100% 15N; U-80% 2H], 1 mM

sample_5: EL86 1 mM; dsRBD12, [U-100% 13C; U-100% 15N; U-80% 2H], 1 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
hCccoNHsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_2isotropicsample_conditions_1
3D 1H-15N NOESYsample_2isotropicsample_conditions_1
3D HNCAsample_2isotropicsample_conditions_1
3D f1-13C-filtered,f2-13C-edited NOESY aliphatic-HMQCsample_3isotropicsample_conditions_1
TROSY IPAPsample_4isotropicsample_conditions_1
TROSY IPAPsample_5anisotropicsample_conditions_1

Software:

AMBER v12, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

CYANA v3.0, Guntert, Mumenthaler and Wuthrich - structure calculation

SPARKY, Goddard - chemical shift assignment

TOPSPIN v3.0, Bruker Biospin - collection

NMR spectrometers:

  • Bruker AvanceIII 750 MHz
  • Bruker AvanceIII 900 MHz
  • Bruker AvanceIII 600 MHz
  • Bruker AvanceIII 500 MHz

Download simulated HSQC data in one of the following formats:
CSV: Backbone or all simulated shifts
SPARKY: Backbone or all simulated shifts