BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30552

Title: MYC Promoter G-Quadruplex with 1:6:1 loop length

Authors: Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D.

Citation: Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D.. "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length"  Acs Omega 4, 2533-2539 (2019).

Assembly members:
entity_1, polymer, 27 residues, 8563.501 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TTGGGGAGGGTTTTAAGGGT GGGGAAT

Data sets:
Data typeCount
13C chemical shifts32
1H chemical shifts260

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 27 residues - 8563.501 Da.

1   DTDTDGDGDGDGDADGDGDG
2   DTDTDTDTDADADGDGDGDT
3   DGDGDGDGDADADT

Samples:

sample_1: DNA (27-MER) 1.5 mM; potassium phosphate 25 mM; potassium chloride 75 mM

sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 278 K

sample_conditions_3: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_3
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1

Software:

AMBER v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement

X-PLOR NIH v2.48, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

CcpNMR, CCPN - chemical shift assignment, peak picking

TOPSPIN v3.5, Bruker Biospin - processing

NMR spectrometers:

  • Bruker AvanceIII 800 MHz

Related Database Links: